Printer Friendly

Clonal genotype of Geomyces destructans among bats with white nose syndrome, New York, USA.

Geomycosis, or white nose syndrome, is a newly recognized fungal infection of hibernating bats. The etiologic agent, the psychrophilic fungus Geomyces destructans, was first recognized in caves and mines around Albany, New York, USA (1,2). The disease has spread rapidly in New York and other states in the northeastern United States. At least 1 affected bat species is predicted to face regional extinction in the near future (3). Much remains unknown about this fungus, including its ecology and geographic distribution. For example, although hibernacula are high on the list of suspected sites, where the bats acquire this infection is not known. Similarly, although strongly suspected, the role of humans and other animals in the dispersal of G. destructans and the effect of such dispersals in bat infections have not been confirmed. We recently showed that 6 G. destructans strains from sites near Albany were genetically similar (2), raising the possibility of a common source for the spread of this infection. Corollary to this observation and other opinions (3,4), the US Fish & Wildlife Service has made an administrative decision to bar human access to caves as a precautionary measure

(www.fws.gov/whitenosesyndrome/pdf/NWRS_WNS_ Guidance_Final1.pdf). Thus, an understanding of the dispersal mechanism of G. destructans is urgently needed to formulate effective strategies to control bat geomycosis.

The Study

We applied multiple gene genealogic analyses in studying G. destructans isolates; this approach yields robust results that are easily reproduced by other laboratories (5). Sixteen G. destructans isolates recovered from infected bats during 2008-2010 were analyzed. These isolates originated from 7 counties in New York and an adjoining county in Vermont, all within a 500-mile radius (Table 1). The details of isolation and identification of G. destructans from bat samples have been described (2). One isolate of a closely related fungus G. pannorum M1372 (University of Alberta Mold Herbarium, Edmonton, Alberta, Canada) was included as a reference control. To generate molecular markers, 1 isolate, G. destructans (M1379), was grown in yeast extract peptone dextrose broth at 15[degrees]C, and high molecular weight genomic DNA was prepared according to Moller et al. (6). A cosmid DNA library was constructed by using pWEB kit (Epicenter Biotechnologies, Madison, WI, USA) by following protocols described elsewhere (7). One hundred cosmid clones, each with [approximately equal to]40-Kb DNA insert, were partially sequenced in both directions by using primers M13 and T7. The nucleotide sequences were assembled with Sequencher 4.6 (Gene Codes Corp., Ann Arbor, MI, USA) and BLAST (www.ncbi.nlm.nih.gov/ BLAST) homology searches identified 37 putative genes. Sequences of 10 genes, including open reading frames, 3' and/or 5' untranslated regions, and introns, were evaluated as potential markers for analyzing G. pannorum and G. destructans. Our screening approach indicated that 8 gene targets could be amplified from both G. destructans and G. pannorum by PCR (Table 2).

To obtain DNA sequences from 1 G. pannorum and 16 G. destructans isolates, we prepared genomic DNA from mycelia grown in yeast extract peptone dextrose broth through conventional glass bead treatment and phenolchloroform extraction and then ethanol precipitation (7). AccuTaq LA DNA Polymerase (Sigma-Aldrich, St. Louis, MO, USA) was used for PCR: 3 min initial denaturation at 94[degrees]C, 35 amplification cycles with a 15-sec denaturation at 94[degrees]C, 30-sec annealing at 55[degrees]C, and 1-min extension at 68[degrees]C and a 5-min final extension at 68[degrees]C. PCR products were treated with ExoSAP-IT (USB Corp., Cleveland, OH, USA) before sequencing. Both strands of amplicons were sequenced by the same primers used for PCR amplification (Table 2). A database was created by using Microsoft Access (Microsoft, Redmond, WA, USA) to deposit and analyze the sequences. Nucleotide sequences were aligned with ClustalW version 1.4 (www.clustal.org) and edited with MacVector 7.1.1 software (Accelrys, San Diego, CA, USA). Phylogenetic analyses were done by using PAUP 4.0 (8) and MEGA 4 (9).

We cloned and sequenced [approximately equal to] 200 Kb of the G. destructans genome and identified genes involved in a variety of cellular processes and metabolic pathways (Table 2). DNA sequence typing by using 8 gene fragments showed that all 16 G. destructans isolates had identical nucleotide sequences at all 8 sequenced gene fragments but were distinct from G. pannorum sequences. A maximum-parsimony tree generated from the 8 concatenated gene fragments indicated a single, clonal genotype for the 16 G. destructans strains (Figure 1). This consensus tree included 4,470 aligned nucleotides from all targeted gene sequences with 545 variable sites that separate the G. destructans clonal genotype from G. pannorum. Further analyses of the same concatenated gene fragments with exclusion of 50 insertions and deletions between G. destructans and G. pannorum yielded a tree with a shorter length (495 steps instead of 545 steps) but an identical topology (online Technical Appendix Figure 1, www.cdc.gov/EID/ content/17/7/1273-Techapp.pdf). This pattern remained unchanged when different phylogenetics models were used for analysis (online Technical Appendix Figure 2). The lack of polymorphism among the 16 G. destructans isolates was unlikely because of evolutionary constraint at the sequenced gene fragments. We found many synonymous and nonsynonymous substitutions in target genes among a diversity of fungal species, including between G. destructans and G. pannorum (10) (online Technical Appendix Figure 3).

Conclusions

Our finding of a single clonal genotype in G. destructans population fits well with the rapid spread of geomycosis in New York (Figure 2). Our sampling population covered both spatial and temporal dimensions, and the numbers of isolates analyzed were adequate in view of difficulties encountered in obtaining pure isolations of G. destructans (11). Although the affected New York sites are separated by sizable distances and include geographic barriers, a role for the natural dissemination of the fungus through air, soil, and water cannot be ruled out. Indeed, several fungi with geographic distributions similar to that in our study have shown major genetic variation among strains (12,13). It is also possible that humans and/or animals contributed to the rapid clonal dispersal. In such a scenario, the diseased or asymptomatic bats might act as carriers of the fungus by their migration into new hibernation sites where new animals get infected and the dissemination cycle continues (4). Similarly, the likely roles played by humans and/or other animals in the transfer of the fungal propagules from an affected site to a clean one cannot be ruled out from our data.

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

Virulent clones of human and plant pathogenic fungi that spread rapidly among affected populations have been recognized with increasing frequency in recent years (12,14). However, other pathogens, such as the frog-killing fungus Batrachochytrium dendrobatidis, have emerged with both clonal and recombining populations (13). Our data do not eliminate the possibility that the G. destructans population undergoes recombination in nature. This process to generate genetic variability would require some form of sexual reproduction, which remains unknown in G. destructans. In addition, the fungus might have both asexual and sexual modes in its saprobic life elsewhere in nature, but it exists only in asexual mode on bats (15).

In conclusion, our data suggest that a single clonal genotype of G. destructans has spread among affected bats in New York. This finding might be helpful for the professionals involved in devising control measures. Many outstanding questions remain about the origin of G. destructans, its migration, and reproduction, all of which will require concerted efforts if we are to save bats from predicted extinction (3).

Acknowledgments

We acknowledge the Wadsworth Center Applied Genomic Technologies Core for DNA sequencing and Media, Glassware and Tissue Culture Unit for specialized culture media. We thank Jared Mayron for creating a Microsoft Access database.

References

(1.) Blehert DS, Hicks AC, Behr M, Meteyer CU, Berlowski-Zier BM, Buckles EL, et al. Bat white-nose syndrome: an emerging fungal pathogen? Science. 2009;323:227. doi:10.1126/science.1163874

(2.) Chaturvedi V, Springer DJ, Behr MJ, Ramani R, Li X, Peck MK, et al. Morphological and molecular characterizations of psychrophilic fungus Geomyces destructans from New York bats with white nose syndrome (WNS). PLoS ONE. 2010;5:e10783. doi:10.1371/journal. pone.0010783

(3.) Frick WF, Pollock JF, Hicks AC, Langwig KE, Reynolds DS, Turner GG, et al. An emerging disease causes regional population collapse of a common North American bat species. Science. 2010;329:67982. doi:10.1126/science.1188594

(4.) Hallam TG, McCracken GF. Management of the panzootic white-nose syndrome through culling of bats. Conserv Biol. 2011;25:18994. doi:10.1111/j.1523-1739.2010.01603.x

(5.) Xu J. Fundamentals of fungal molecular population genetic analyses. Curr Issues Mol Biol. 2006;8:75-89.

(6.) Moller EM, Bahnweg G, Sandermann H, Geiger HH. A simple and efficient protocol for isolation of high molecular weight DNA from filamentous fungi, fruit bodies, and infected plant tissues. Nucleic Acids Res. 1992;20:6115-6. doi:10.1093/nar/20.22.6115

(7.) Ren P, Roncaglia P, Springer DJ, Fan JJ, Chaturvedi V. Genomic organization and expression of 23 new genes from MAT alpha locus of Cryptococcus neoformans var. gattii. Biochem Biophys Res Commun. 2005;326:233-41.

(8.) Swafford DL. PAUP*: Phylogenetic analysis using parsimony *and other methods. Sutherland (MA): Sinauer Associates; 2000.

(9.) Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596-9. doi:10.1093/molbev/msm092

(10.) Kasuga T, White TJ, Taylor JW. Estimation of nucleotide substitution rates in eurotiomycete fungi. Mol Biol Evol. 2002;19:2318-24.

(11.) Wibbelt G, Kurth A, Hellmann D, Weishaar M, Barlow A, Veith M, et al. White-nose syndrome fungus (Geomyces destructans) in bats, Europe. Emerg Infect Dis. 2010;16:1237-43. doi:10.3201/eid1608.100002

(12.) Hovmeller MS, Yahyaoui AH, Milus EA, Justesen AF. Rapid global spread of two aggressive strains of a wheat rust fungus. Mol Ecol. 2008;17:3818-26. doi:10.1111/j.1365-294X.2008.03886.x

(13.) Morgan JAT, Vredenburg VT, Rachowicz LJ, Knapp RA, Stice MJ, Tunstall T, et al. Population genetics of the frog-killing fungus Batrachochytrium dendrobatidis. Proc Natl Acad Sci U S A. 2007;104:13845-50. doi:10.1073/pnas.0701838104

(14.) Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, Fyfe M, et al. A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Columbia, Canada). Proc Natl Acad Sci U S A. 2004;101:17258-63. doi:10.1073/pnas.0402981101

(15.) Halkett F, Simon J-C, Balloux F. Tackling the population genetics of clonal and partially clonal organisms. Trends Ecol Evol. 2005;20:194-201. doi:10.1016/j.tree.2005.01.001

Address for correspondence: Vishnu Chaturvedi, Mycology Laboratory, Wadsworth Center, New York State Department of Health, 120 New Scotland Ave, Albany, NY 12208, USA; email: vishnu@wadsworth.org

Author affiliations: New York State Department of Health, Albany, New York, USA (S.S. Rajkumar, X. Li, R.J. Rudd, S. Chaturvedi, V. Chaturvedi); New York State Department of Environmental Conservation, Albany (J.C. Okoniewski); McMaster University, Hamilton, Ontario, Canada (J. Xu); and State University of New York at Albany, Albany (S. Chaturvedi, V. Chaturvedi)

Dr Rajkumar is a postdoctoral research affiliate in the Mycology Laboratory at the Wadsworth Center, New York State Department of Health, Albany, New York, USA. His research interests are molecular genetics, genomics, and antifungal drugs.

DOI: 10.3201/eid1707.102056
Table 1. Geomyces destructans isolates studied, New York, USA

Isolate            Date obtained          Site, county *

M1379 ([dagger])    2008 Mar 28     Williams Hotel Mine, Ulster
M1380 ([dagger])    2008 Mar 28     Williams Hotel Mine, Ulster
M1381 ([dagger])    2008 Mar 28     Williams Hotel Mine, Ulster
M1383 ([dagger])    2008 Apr 11        Graphite Mine, Warren
M2325               2010 Jan 25             Westchester
M2327               2010 Feb 2           Dewitt, Onondaga
M2330               2009 Mar 5            Lancaster, Erie
M2331               2009 Mar 9       White Plains, Westchester
M2332               2009 Mar 11         Dannemora, Clinton
M2333               2009 Mar 11         Dannemora, Clinton
M2334               2009 Mar 12           Newstead, Erie
M2335               2009 Mar 16          Ithaca, Tompkins
M2336               2009 Oct 6     Bridgewater Mine, Windsor, VT
M2337               2010 Feb 9           Akron Mine, Erie
M2338               2010 Mar 4          Hailes Cave, Albany
M2339               2010 Mar 11    Letchworth Tunnel, Livingston

* All locations in New York state except Bridgewater Mine,
Windsor, Vermont.

([dagger]) Previously analyzed by randomly amplified polymorphic DNA
typing.

Table 2. Geomyces destructans and G. pannorum target gene
fragments used for multiple gene genealogic analyses, New York,
USA

                                          Amplicon size/
               Homology (GenBank         sequence used for
Gene *           accession no.)           comparison, bp

ALR       Penicillium marneffei          654/534
            (XP_002152078.1)

Bpntase   Glomerella graminicola         921/745
            (EFQ33509.1)

DHC1      Sordaria macrospora            597/418
            (CBI53717.1)

GPHN      Ajellomyces capsulatus         659/525
            (EEH06836.1)

PCS       A. capsulatus                  920/749
            (EEH08767.1)

POB3      Pyrenophora tritici-repentis   653/417
            (XP_001937502.1)

SRP72     A. dermatitidis                941/640
            (EEQ90678.1)

VPS13     Verticillium albo-atrum        665/545
            (XP_003001174.1)

                                               G. destructans/G.
          Primer sequence, 5' [right arrow]    pannorum GenBank
Gene *              3't ([dagger])              accession nos.

ALR       V1905 (f): CGGAGTGAGATTTATGACGGC         HQ834314-
          V1904 (r): CGTCCATCCCAGACGTTCATC     HQ834329/HQ834330

Bpntase   V1869 (f): TCAGACGGACTCGGAGGGCAAG        HQ834331-
          V1926 (r): TCGGTTACAGAGCCTCAGTCG     HQ834346/HQ834347

DHC1      V1906 (f): GGATGATTCGGTCACCAAACAG        HQ834348-
          V1907 (r): ACAGCAAACACAGCGCTGCAAG    HQ834363/HQ834364

GPHN      V1918 (f): CACTATTACATCGCCAGGCTC         HQ834365-
          V1919 (r): CTAAACGCAGGCACTGCCTC      HQ834380/HQ834381

PCS       V1929 (f): AGGCTGCGATTGCTGAGTGC          HQ834382-
          V1873 (r): CCTTATCCAGCTTTCCTTGGTC    HQ834397/HQ834398

POB3      V1908 (f): CACAGTGGAGCAAGGCATCC          HQ834399-
          V1909 (r): ACATACCTAGGCGTCAAGTGC     HQ834414/HQ834415

SRP72     V1927 (f): AAGGGAAGGTTGGAGAGACTC         HQ834416-
          V1895 (r): CAAGCAGCATTGTACGCCGTC     HQ834431/HQ834432

VPS13     V1922 (f): GAGACAACGCTTGTTTGCAAGG        HQ834433-
          V1923 (r): ACATGCGTCGTTCCAAGATCTG    HQ834448/HQ834449

* Genes: ALR, [alpha]-L-rhamnosidase; Bpntase, 3'(2'),5'-bisphosphate
nucleotidase; DHC1, Dynein heavy chain; GPHN, Gephyrin,
molybdenum cofactor biosynthesis protein; PCS, peroxisomal-coenzyme
A synthetase; POB3, FACT complex subunit; SRP72, signal recognition
particle protein 72; VPS13, vacuolar protein sorting-associated
protein.

([dagger]) f, forward; r, reverse.
COPYRIGHT 2011 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2011 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:DISPATCHES
Author:Rajkumar, Sunanda S.; Li, Xiaojiang; Rudd, Robert J.; Okoniewski, Joseph C.; Xu, Jianping; Chaturved
Publication:Emerging Infectious Diseases
Geographic Code:1U2NY
Date:Jul 1, 2011
Words:2276
Previous Article:Bartonella spp. in bats, Guatemala.
Next Article:Natural Burkholderia mallei infection in dromedary, Bahrain.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters