Printer Friendly

Clonacion, expresion y evaluacion inmunologica de la proteina Omp31 de Brucella melitensis y evaluacion de su posible uso para el diagnostico en brucelosis bovina.

CLONING, EXPRESSION AND IMMUNOLOGICAL EVALUATION OF THE OMP31 PROTEIN OF Brucella melitensis AND EVALUATION OF ITS POSSIBLE USE FOR THE DIAGNOSIS IN BOVINE BRUCELLOSIS

INTRODUCCION

Brucella abortus es un cocobacilo gran negativo, causante de afecciones cronicas debilitantes en humanos, asi como aborto e infertilidad en el ganado y otros animales, dando lugar a serias perdidas economicas en la ganaderia y problemas de salud publica a nivel global. No existe una vacuna eficaz y segura para el humano, por lo que la prevencion de la infeccion en animales es una forma de controlar la brucelosis humana.

Se han desarrollado diferentes enfoques de diagnostico, principalmente cultivo bacteriano, ensayos serologicos y deteccion de nivel de ADN. Entre estos, los ensayos serologicos se consideran como el metodo principal por su sensibilidad diagnostica, disponibilidad y ventaja economica (Al Dahouk et al., 2003). La deteccion de anticuerpos contra lipopolisacaridos es el elemento principal en el serodiagnostico de la brucelosis; sin embargo, presentan reaccion cruzada con bacterias como Escherichia coli O157, Salmonella typhimurium y Vibrio cholerae, asi como con Yersinia enterocolitica O:9 con la que tiene la reaccion cruzada mas prominente debido a la alta similitud estructural del O-polisacarido (OPS) (Bundle et al., 1984; Chenais et al., 2012).

El desarrollo de la inmunoproteomica ha allanado el camino para la identificacion de proteinas inmunogenicas de varios patogenos (Tjalsma et al., 2008; Hu et al., 2014; Pellon et al,. 2016; Chavez-Fumagalli et al., 2017). La aplicacion de proteinas inmunogenicas de B. abortus ha demostrado ser un enfoque eficaz para minimizar las reacciones cruzadas en el diagnostico de la brucelosis (Zhao et al., 2011). Por lo tanto, varios componentes superficiales o citoplasmicos de Brucella se han usado como marcadores potenciales para el diagnostico de brucelosis, incluida la lumazina sintetasa (Goldbaum et al., 1999), la proteina del sistema de secrecion de tipo IV VirB5 (Tan et al., 2012), la proteina de membrana externa Omp28 (Thavaselvam et al., 2010) y la proteina periplasmica inmunogenica Bp26 (Tiwari et al., 2011). La proteina de membrana externa Omp31 ha sido evaluada serologicamente en animales diferentes a bovinos, de alli que resulto interesante que fuera reportada usando sueros de bovinos positivos a Brucella abortus biovar S19 (Connolly et al., 2006), mientras que en otro estudio similar usando la cepa vacunal de Brucella abortus RB51 no la hayan detectado (Kim et al. 2014).

Con base en estos estudios, se ha considerado la clonacion del gen de Omp31 para expresar la proteina y evaluar su potencial en el serodiagnostico de brucelosis en bovinos (Vizcaino et al., 1996; Cassataro et al., 2004; Estein et al., 2004). El diagnostico de la brucelosis se basa principalmente en la deteccion de anticuerpos especificos, mediante metodos como Rosa de Bengala (RBT), prueba de aglutinacion en suero (TAT), ensayo inmunoabsorbente ligado a enzimas (ELISA), prueba de fijacion del complemento (CFT) y prueba de anticuerpos fluorescentes (FTA) (Chenchev et al., 1978; Bricker 2002; Nielsen 2002). El RBT como prueba de deteccion y el TAT como confirmacion se consideran como metodos estandares para el diagnostico serodiagnostico de la brucelosis en Venezuela (Lord y Flores, 1983; Lord V y Lord R, 1991; Francisco y Vargas, 2002).

La RBT es una tecnica economica y rapida; sin embargo, posee baja especificidad por lo que es fundamental desarrollar nuevas tecnicas de diagnostico de deteccion rapida y eficaces para el diagnostico de brucelosis. Este estudio tuvo como objetivo evaluar la tecnica de ELISA indirecta utilizando una proteina inmunogenica recombinante para garantizar la especificidad diagnostica y confirmar el diagnostico en animales que han sido diagnosticados con brucelosis con tecnicas complementarias.

MATERIALES Y METODOS

Analisis Bioinformatico

Para el diseno de oligos se utilizo el software Oligo Explorer v. 1.4 (http:// www.genelink.com/tools/gl-oe.asp) y la secuencia del gen Omp31de Brucella melitensis con numero de acceso GQ184729.1 (https://www.ncbi.nlm.nih.gov/ nuccore/GQ184729.1). Para el alineamiento de las proteinas Omp31 se escogieron tres secuencias de B. abortus: CAJ11595.1 (https://www.ncbi.nlm.nih.gov/protein/ CAJ 11595.1), EFH35395.1 (https:// www.ncbi.nlm.nih.gov/protein/EFH35395.1), ACD73018 (https://www.ncbi.nlm.nih.gov/ protein/ACD73018) y una de B. melitensis: GQ184729 (https://www.ncbi.nlm.nih.gov/ nuccore/GQ184729). Estas secuencias se alinearon usando MultAlin (http:// multalin.toulouse.inra.fr/multalm/) y el porcentaje de identidad de aminoacidos se obtuvo usando el software UGENE v. 1.27.0 (http:// ugene.net/).

Cepas Bacterianas

Una muestra de cepa lisa y virulenta de B. melitensis 16M fue proporcionada por el Instituto Nacional de Higiene Rafael Rangel (INH "RR"), la cepa atenuada de Brucella abortus biovar 1119 fue cedida por el Instituto Nacional de Investigaciones Agricolas (INIA) y la cepa Escherichia coli BL21(DE3) fue donada por el Centro de Inmunoproduccion de Antigenos (CIMA), la cual fue usada para producir las construcciones plasmidicas. La cepa de E. coli se cultivo a 37[grados]C en caldo Luria-Bertani (LB) o agar suplementado con 30 mg/ml de kanamicina (Sigma, EEUU).

Preparacion del Plasmido

La secuencia de 723 pb codificante del gen de Omp31 de B. melitensis se amplifico por PCR utilizando el siguiente par de cebadores: Omp31 Forw 5'CCCGGA TCCATGA-AATCCGTAA-TTTTGGC3 ' (Sitio EcoRI subrayado) y REV 5' CCCGCGGCCGCTTAGAACTTGTAGTTCAGACCG3' (sitio Noti subrayado). La PCR se realizo utilizando los siguientes parametros: calentamiento a 95[grados]C durante 5 min; 32 ciclos de desnaturalizacion a 95[grados]C durante 1 min, hibridacion a 62[grados]C durante 1 min y extension a 72[grados]C durante 1 min, y una elongacion final a 72[grados]C durante 5 min. El ADN amplificado fue digerido con enzimas de restriccion apropiadas EcoRI y NotI (Promega, EEUU) durante 2 h a 37[grados]C y se ligo al vector pET28a (Novagen, EEUU) a 4[grados]C durante la noche, de acuerdo con las instrucciones del fabricante. El plasmido recombinante se transformo en E. coli BL21(DE3).

Induccion y Purificacion de Omp31 Recombinante

La expresion de la proteina fue inducida en LB suplementado con 30 mg/ml de kanamicina con la adicion 1 mM isopropil-dthiogalactopyranoside (IPTG) y las celulas transformadas fueron incubadas durante 4 h. Las bacterias fueron recolectadas por centrifugacion (12000 g por 15 min a 4[grados]C) y congeladas a -20[grados]C hasta su uso.

Las celulas bacterianas se suspendieron en una solucion que consiste en Tris 50 mM, EDTA 5 mM, y 1% de Triton X-100 (pH 8.0) (solucion de suspension) y sonicados durante tres ciclos de 1 min a 4[grados]C. Los cuerpos de inclusion fueron recolectados a 15 000 g por 15 min a 4[grados]C y lavadas dos veces con solucion de suspension sin Triton X-100. Los cuerpos de inclusion se solubilizaron en una solucion que contiene Tris 50 mM, 5 mM EDTA y urea 8M (pH 8.0) a temperatura ambiente durante la noche con agitacion. Despues de la centrifugacion (15 000 g por 15 min a 4[grados]C), la proteina soluble fue purificada mediante cromatografia a traves de una resina ProBond (Invitrogen, EEUU). La presencia de Omp31r fue verificado por Western blot con el anticuerpo anti-Omp31 producido en conejo. La pureza fue evaluada mediante electroforesis en gel de SDS-poliacrilamida y tincion con azul de Coomassie.

SDS-PAGE y Ensayos de Western Blot

EL SDS-PAGE se realizo segun Laemmli (Laemmli, 1970). La Omp31r purificada se llevo a 95[grados]C durante 10 min y se diluyo en 2x tampon de muestra Laemmli (4% de SDS, 20% de glicerol, 10% de 2-mercaptoetanol, 0.004% de azul de bromofenol y 0.125 M de Tris HCl, pH 6.8). Luego de la electroforesis, los geles se tineron durante una hora con Azul Brillante de Coomassie (Azul Brillante de Coomassie R250 al 0.1%, acido acetico al 10%, metanol al 50%) y posteriormente se destineron con una solucion de metanol al 50%. En los ensayos de Wester-blot, despues de la electroforesis, la proteina se transfirio a membranas de Immobilon-P (Milipore, EEUU) en tampon de transferencia (Tris 25 mM, glicina 192 mM y metanol al 20%) con una corriente constante de 2 mA/cm2 durante 30 min, usando un equipo de transferencia semiseco (Bio-Rad, EEUU). La membrana se bloqueo con leche descremada al 5%, durante 1 h a 4[grados]C, se lavo tres veces con PBS-Tween 20 al 0.05% y se incubo con un suero positivo anti-Omp31r, producido a partir de un conejo inmunizado con Omp31r, dilucion 1: 1.000, en tampon de bloqueo a 4[grados]C durante 2 h. La membrana se lavo con 0.05% de PBS-Tween 20 y se incubo con anticuerpo anti-IgG de conejo hecho en cabra conjugado con peroxidasa de rabano picante (HRP) (dilucion 1: 5.000, Sigma, EEUU), en tampon de bloqueo durante 1 h a 4[grados]C, y finalmente lavado con 0.05% de PBS-Tween 20. La proteina se detecto con una solucion de deteccion de diaminobencidina-[H.sub.2][O.sub.2]. Los sueros controles positivos a brucelosis de bovinos y negativos fueron donados por el Instituto Nacional de Investigaciones Agricolas (INIA).

ELISA Usando Omp31r

Se recubrieron placas de poliestireno (96 pocillos) con Omp31r (0.2 ig/pocillo), diluido en tampon de fosfato solucion salina (PBS). Los sitios no enlazados en las placas fueron bloqueados con 200 [micron]l de PBS que contiene 3% de albumina de suero bovino (BSA) por pozo. Posteriormente, los pozos fueron lavados con PBS que contiene 0.05% de Tween 20 (PBS-T). Los sueros fueron diluidos en PBS-T que contiene 1% de BSA y colocados en cada pozo.

Se detectaron anticuerpos especificos usando un conjugado anti-bovino peroxidasa. La reaccion fue desarrollada agregando TMB (2 g/l) en tampon de 0.1 M citrato-fosfato que contiene 0.03% de [H.sub.2][O.sub.2]. Para establecer los valores de corte del ensayo se usaron sueros controles sanos, no infectados, bajo las mismas condiciones. El valor de corte de cada suero vinculado al sistema de ensayo se calculo como la media de la densidad optica (DO) especifica de los sueros controles mas dos desviaciones estandar.

Punto de Corte

El umbral o punto de corte es el valor de absorbancia (DO) y fue calculado para 32 determinaciones de controles sanos, basados en la relacion [X.sub.s] = X + 3[delta] (Sutula y Cuillet, 1986), donde [X.sub.s] = umbral, X 0 media de los controles sanos, y [delta] = desviacion estandar. Esto implica que las muestras problemas que registren una [DO.sub.450nm] superiores al valor del punto de corte se consideran positivas y los que esten por debajo se consideran como negativas.

Sensibilidad y Especificidad

La sensibilidad y especificidad de las pruebas se calcularon con respecto a los bovinos infectados y sanos de Brucella, segun el metodo descrito por Hop et al., 2016).

RESULTADOS Y DISCUSION

El analisis bioinformatico de las proteinas Omp31 de B. melitensis y B. abortus mostro un 70% se similaridad (Figura 1; Cuadro 1). La similitud entre las Omp31 de las mismas especies fue de 100% (Cuadro 1).

La alta similitud implica que puede existir una reaccion cruzada entre ambas proteinas al ser evaluadas con sueros de animales infectados con especies de Brucella que expresen esta proteina. Connolly et al. (2006) detectaron una Omp31 de B. abortus biovar 224 usando sueros de bovinos positivos a brucelosis, por lo que podria encontrarse en otras B. abortus silvestres. Es por ello, que esta proteina fue escogida para ser evaluada. Se disenaron oligos para amplificar el gen Omp31 de B. melitensis a partir de ADN genomico (Figura 2A), obteniendose una banda de 723 pb, donde la secuenciacion corroboro la identidad del gen (datos no mostrados). Este fragmento fue clonado en el vector de expresion pET28a y fue verificado por PCR (Figura 2B, C, D).

La proteina Omp31r se indujo con 1 mM IPTG y se purifico con cromatografia IMAC (Figura 3). La Omp31r se obtuvo con un rendimiento de 70 [micron]g/ml. Esta proteina fue usada para las pruebas de ELISA y Western Blot (Figura 3).

Como antigeno control se utilizo un extracto fenolizado de B. abortus biovar 1119, cepa empleada para la fabricacion del Rosa de Bengala (RB). El valor de corte de cada antigeno en la prueba de ELISA (Figura 4) se calculo como la media especifica de las DO de 32 sueros libres de Brucella usados como control mas dos desviaciones estandar. La media para Omp31r fue de 0.1919 y el punto de corte de 0.3838. Con el antigeno de Brucella cepa 1119 se obtuvo una media de 0.1183 y un punto de corte de 0.2366. Los bovinos positivos (n=57) produjeron un OD entre 0.285 y 0.975 (media: 0.547; D.E.: 0.203). De estos bovinos, se detectaron anticuerpos contra Omp31 en 43 de ellos (75.4%); y al utilizar la cepa de Brucella 1119 como antigeno los 57 sueros se detectaron como positivos. Al comparar los antigenos, solo 14 sueros positivos no fueron detectados por la Omp31r. La sensibilidad y especificidad de la Omp31r en comparacion a la Cepa 1119 fue de 77.2% y 90.6%, respectivamente.

De los 52 sueros negativos, tres reaccionaron con Omp31r, lo cual pudo deberse a la presencia de proteinas de E. coli que copurificaron en la obtencion de la proteina recombinante y dieron reaccion cruzada con estos sueros. Esto ha sido reportado para proteinas de membrana Bp26 (Debbarh et al., 1996; Cloeckaert et al., 2001; Liu et al., 2011; Tiwari et al., 2011) y Omp28 (Thavaselvam et al., 2010; Kumar et al., 2012; Lim et al., 2012), empleadas como antigenos en el diagnostico de brucelosis en ovejas y cabras.

Otra forma de evidenciar estas reacciones cruzadas es realizando un Westernblot, donde al usar sueros de bovinos se observan las bandas contaminantes de E. coli. (Figura 5C). Estas bandas dan reaccion cruzada y provocan falsos positivos en ELISA. Esto podria ser mejorado optimizando la purificacion de la Omp31r. La especificidad se observa por Western-blot al evaluar sueros positivos, dado que estos reconocen a la banda de Omp31r y una banda de 31 kDa en el extracto de B. abortus 1119, pero no reconocen a B. abortus RB51 (Figura 5C). Ademas, sueros de bovinos sanos y vacunados contra B. abortus RB51 no reconocen la banda de Omp31r (Figura 5D, 5E).

Este resultado es importante ya que discrimina animales no vacunados de los vacunados, por lo que se evidencia su potencial en el desarrollo de pruebas diagnosticas de brucelosis. Entre las pruebas convencionales esta Rosa de Bengala (RB) (Ramirez-Pfeiffer et al., 2008) y la fijacion del complemento (FC) (Blasco et al., 1994; Adone y Ciuchini, 2001), asi como las pruebas que usan extractos ricos en S-LPS (como antigeno y usando un anticuerpo monoclonal) (Chin et al., 1989; Laurent et al., 2004; Nielsen et al., 2007; Perrett et al., 2010). Estas pruebas tienen en comun que detectan principalmente anticuerpos antigenicos determinantes, presentes en la cadena O del LPS-S (Dzata et al., 1991). En el presente trabajo, el potencial diagnostico de la Omp31r muestra que el formato ELISA es util para el diagnostico de infeccion por B. abortus en bovinos; sin embargo, el uso de Omp31 no ha sido reportado para su uso en bovinos, sino para cabras y ovejas (Cassataro et al., 2004; Jacques et al., 2007; Estein et al., 2009). Esto se debe a que B. melitensis infecta a estos animales de manera especifica; sin embargo, al no encontrarse la proteina en B. abortus no habia sido usada en bovinos (Vizcaino et al., 2001).

Por otro lado, se ha probado extractos de B. abortus por ELISA que resultan mas sensibles que la Omp31r, por lo que en este trabajo se uso a B. abortus 1119. La baja sensibilidad de Omp31r podria deberse a que el bovino no desarrolla anticuerpos especificos contra esta o, desde el punto de vista tecnico, la Omp31r no se unio adecuadamente a la placa de ELISA por ser hidrofobica. No se puede descartar que la ausencia de reactividad de anticuerpos contra esta proteina tambien pudiera deberse a la eliminacion de epitopos conformacionales, debido a la desnaturalizacion de la proteina bajo condiciones que se realizo la prueba de ELISA.

Al realizar los ensayos de ELISA (Figura 4), los valores de sensibilidad (77.2%) y especificidad (90.6%) encontrados para Omp31r en bovinos son similares a los reportados en ovejas, cabras, y humanos evaluados con las proteinas de membrana recombinantes Bp26 (Debbarh et al., 1996; Cloeckaert et al., 2001; Tiwari et al., 2011) con sensibilidad y especificidad de 88 y 93%, respectivamente, para Omp28 de 97.5% de sensibilidad y 85.9% de especificidad (Thavaselvam et al., 2010) y para Omp31 de 67% de sensibilidad (Cassataro et al., 2004).

CONCLUSIONES

A partir de ADN genomico de Brucella melitensis se logro clonar, expresar y purificar la proteina recombinante Omp31, la cual presento una alta sensibilidad (77.2%) y especificidad (90.6%) en el diagnostico por ELISA de sueros bovinos.

http://dx.doi.org/10.15381/rivep.v29i3.14008

Agradecimiento

Los autores agradecen al Dr. De Sanctis JB por sus valiosos aportes al manuscrito.

LITERATURA CITADA

(1.) Adone R, Ciuchini F. 2001. Brucella abortus RB51 and hot saline extract from Brucella ovis as antigens in a complement fixation test used to detect sheep vaccinated with Brucella abortus RB51. Clin Diagn Lab Immunol 8: 119-122. doi: 10.1128/CDLI.8.1.119122.2001

(2.) Al Dahouk S, Tomaso H, Nockler K, Neubauer H, Frangoulidis D. 2003. Laboratory-based diagnosis of brucellosis -a review of the literature. Part I: Techniques for direct detection and identification of Brucella spp. Clin Lab 49: 487-505.

(3.) Blasco JM, Garin-Bastuji B, Marin CM, Gerbier G, Fanlo J, Jimenez de Bagues MP, Cau C. 1994. Efficacy of different Rose Bengal and complement fixation antigens for the diagnosis of Brucella melitensis infection in sheep and goats. Vet Rec 134: 415-420.

(4.) BrickerBJ. 2002. Diagnostic strategies used for the identification of Brucella. Vet Microbiol 90: 433-434.

(5.) Bundle DR, Gidney MA, Perry MB, Duncan JR, Cherwonogrodzky JW. 1984. Serological confirmation of Brucella abortus and Yersinia enterocolitica O:9 O-antigens by monoclonal antibodies. Infect Immun 46: 389-393.

(6.) Cassataro J, Pasquevich K, Bruno L, Wallach JC, Fossati CA, Baldi PC. 2004. Antibody reactivity to Omp31 from Brucella melitensis in human and animal infections by smooth and rough Brucellae. Clin Diagn Lab Immunol 11: 111-114. doi: 10.1128/CDLI.11.1.111114.2004

(7.) Chavez-Fumagalli MA, Schneider MS, Lage DP, Machado-de-Avila RA. Coelho EA. 2017. An in silico functional annotation and screening of potential drug targets derived from Leishmania spp hypothetical proteins identified by immunoproteomics. Exp Parasitol 176: 66-74. doi: 10.1016/j.exppara. 2017.03.005

(8.) Chenais E, Bagge E, Lambertz ST, Artursson K. 2012. Yersinia enterocolitica serotype O:9 cultured from Swedish sheep showing serologically false-positive reactions for Brucella melitensis. Infect Ecol Epidemiol 2. doi: 10.3402/iee .v2i0.19027

(9.) Chenchev I, Khristoforov L, Peshkov I, Kostov G, Mineva I. 1978. [Diagnostic value of agglutination reaction with buffered Brucella antigen stained with rose bengal]. Vet Med Nauki 15: 3-9.

(10.) Chin J, Daniels J, Bundesen P. 1989. Bovine brucellosis: evaluation of field sera by a competitive and superimposable ELISA utilising a monoclonal antibody against Brucella abortus lipopolysaccharide. Vet Immunol Immunopathol 20: 109-118. doi: 10.1016/ 0165-2427(89)90092-5

(11.) Cloeckaert A, Baucheron S, Vizcaino N, Zygmunt MS. 2001. Use of recombinant BP26 protein in serological diagnosis of Brucella melitensis infection in sheep. Clin Diagn Lab Immunol 8: 772-775. doi: 10.1128/ CDLI.8.4.772-775.2001

(12.) Connolly JP, ComerciD, Alefantis TG, Walz A, Quan M, Chafin R, Grewal P, et al. 2006. Proteomic analysis of Brucella abortus cell envelope and identification of immunogenic candidate proteins for vaccine development. Proteomics 6: 3767-3780. doi: 10.1002/ pmic.200500730

(13.) Debbarh HS, Zygmunt MS, Dubray G, Cloeckaert A. 1996. Competitive enzyme-linked immunosorbent assay using monoclonal antibodies to the Brucella melitensis BP26 protein to evaluate antibody responses in infected and B. melitensis Rev.1 vaccinated sheep. Vet Microbiol 53: 325-337.

(14.) Dzata GK, Wyckoff III JH, Confer AW. 1991. Immunopotentiation of cattle vaccinated with a soluble Brucella abortus antigen with low LPS content: an analysis of cellular and humoral immune responses. Vet Microbiol 29: 1526. doi: 10.1016/0378-1135(91)90107-Q

(15.) Estein SM, Cheves PC, Fiorentino MA, Cassataro J, Paolicchi FA, Bowden RA. 2004. Immunogenicity of recombinant Omp3 1 from Brucella melitensis in rams and serum bactericidal activity against B. ovis. Vet Microbiol 102: 203-213. doi: 10.1016/j.vetmic.2004.05.004

(16.) Estein SM, Fiorentino MA, Paolicchi FA, Clausse M, Manazza J, Cassataro J, Giambartolomei GH, et al. 2009. The polymeric antigen BLSOmp31 confers protection against Brucella ovis infection in rams. Vaccine 27: 6704-6711. doi: 10.1016/j.vaccine.2009.08.097

(17.) Francisco J, Vargas O. 2002. Brucellosis in Venezuela. Vet Microbiol 90: 39-44. doi: 10.1016/S03781135(02)00243-2

(18.) Goldbaum FA, Velikovsky CA, Baldi PC, Mortl S, Bacher A, Fossati CA. 1999. The 18-kDa cytoplasmic protein of Brucella species--an antigen useful for diagnosis--is a lumazine synthase. J Med Microbiol 48: 833-839. doi: 10.1099/ 00222615-48-9-833

(19.) Hu DD, Cui J, Xiao D, Wang L, Liu LN, Liu RD, Zhang JZ, Wang ZQ. 2014. Identification of early diagnostic antigens from Spirometra erinaceieuropaei sparganum soluble proteins using immunoproteomics. Southeast Asian J Trop Med Public Health 45: 576-583.

(20.) Jacques I, Verger JM, Laroucau K, Grayon M, Vizcaino N, Peix A, Cortade F, et al. 2007. Immunological responses and protective efficacy against Brucella melitensis induced by bp26 and omp31 B. melitensis Rev. 1 deletion mutants in sheep. Vaccine 25: 794-805. doi : 10.1016/j .vaccine.2006.09.051

(21.) Kim JY, Sung SR, Lee K, Lee HK, Kang SI, Lee JJ, Jung SC, et al. 2014. Immunoproteomics of Brucella abortus RB51 as candidate antigens in serological diagnosis of brucellosis. Vet Immunol Immunopathol 160: 218-224. doi: 10.1016/j.vetimm.2014.05.009

(22.) Kumar A, Tiwari S, Thavaselvam D, Sathyaseelan K, Prakash A, Barua A, Arora S, Kameswara RM. 2012. Optimization and efficient purification of recombinant Omp28 protein of Brucella melitensis using Triton X-100 and beta-mercaptoethanol. Protein Expr Purif 83: 226-232. doi: 10.1016/j.pep.2012.04.002

(23.) Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.

(24.) Laurent TC, Mertens P, Dierick JF, Letesson JJ, Lambert C, De Bolle X. 2004. Functional, molecular and structural characterisation of five anti-Brucella LPS mAb. Mol Immunol 40: 1237-1247. doi: 10.1016/j.molimm.2003.11.037

(25.) Lim JJ, Kim DH, Lee JJ, Kim DG, Min W, Lee HJ, Rhee MH, Kim S. 2012. Protective effects of recombinant Brucella abortus Omp28 against infection with a virulent strain of Brucella abortus 544 in mice. J Vet Sci 13: 287-292. doi: 10.4142/jvs.2012.13.3.287

(26.) Liu WX, Hu S, Qiao ZJ, Chen WY, Liu LT, Wang FK, Hua RH, et al. 2011. Expression, purification, and improved antigenic specificity of a truncated recombinant bp26 protein of Brucella melitensis M5-90: a potential antigen for differential serodiagnosis of brucellosis in sheep and goats. Biotechnol Appl Biochem 58: 32-38.

(27.) Lord V, Flores R. 1983. Brucella spp from the capybara (Hydrochaeris hydrochaeris) in Venezuela: serologic studies and metabolic characterization of isolates. J Wildl Dis 19: 308-314. doi: 10.7589/0090-3558-19.4.308

(28.) Lord V, Lord R. 1991. Brucella suis infections in collared peccaries in Venezuela. J Wildl Dis 27: 477-481. doi: 10.7589/0090-3558-27.3.477

(29.) Nielsen K. 2002. Diagnosis of brucellosis by serology. Vet Microbiol 90: 447-459. doi: /10.1016/S0378-1135(02)00229-8

(30.) Nielsen K, Smith P, Yu WL, Elmgren C, Nicoletti P, Perez B, Bermudez R, Renteria T. 2007. Second generation competitive enzyme immunoassay for detection of bovine antibody to Brucella abortus. Vet Microbiol 124: 173-177. doi: 10.1016/j.vetmic.2007.03.023

(31.) Pellon A, Ramirez-Garcia A, Buldain I, Antoran A, Rementeria A, Hernando FL. 2016. Immunoproteomics-based analysis of the immunocompetent serological response to Lomentospora prolificans. J Proteome Res 15: 595-607. doi: 10.1021/acs.jproteome.5b00978

(32.) Perret LL, McGiven JA, Brew SD, Stack JA. 2010. Evaluation of competitive ELISA for detection of antibodies to Brucella infection in domestic animals. Croat Med J 51: 314-319.

(33.) Ramirez-Pfeiffer C, Diaz-Aparicio E, Gomez-Flores R, Rodriguez-Padilla C, Morales-Loredo A, Alvarez-Ojeda G 2008. Use of the Brucella melitensis native hapten to diagnose brucellosis in goats by a rapid, simple, and specific fluorescence polarization assay. Clin Vaccine Immunol 15: 911-915. doi: 10.1128/CVI.00046-08

(34.) Tan W, Wang XR, Nie Y, Wang C, Cheng LQ, Wang XC, Zhang R, Yan GM. 2012. Recombinant VirB5 protein as a potential serological marker for the diagnosis of bovine brucellosis. Mol Cell Probes 26:127-131.

(35.) Thavaselvam D, Kumar A, Tiwari S, Mishra M, Prakash A. 2010. Cloning and expression of the immunoreactive Brucella melitensis 28 kDa outer-membrane protein (Omp28) encoding gene and evaluation of the potential of Omp28 for clinical diagnosis of brucellosis. J Med Microbiol 59: 421-428. doi: 10.1099/jmm.0.017566-0

(36.) Tiwari AK, Kumar S, Pal V, Bhardwaj B, Rai GP. 2011. Evaluation of the recombinant 10-kilodalton immunodominant region of the BP26 protein of Brucella abortus for specific diagnosis of bovine brucellosis. Clin Vaccine Immunol 18: 1760-1764. doi: 10.1128/ CVI.05159-11

(37.) Tjalsma H, Schaeps RM, Swinkels DW. 2008. Immunoproteomics: from biomar-ker discovery to diagnostic applications. Proteomics Clin Appl 2: 167-180. doi: 10.1002/prca.200780012

(38.) Vizcaino N, Cloeckaert A, Zygmunt MS, Dubray G. 1996. Cloning, nucleotide sequence, and expression of the Brucella melitensis omp31 gene coding for an immunogenic major outer membrane protein. Infect Immun 64: 3744-3751.

(39.) Vizcain o N, Kittelberger R, Cloeckaert A, Marin CM, Fernandez-Lago L. 2001. Minor nucleotide substitutions in the omp31 gene of Brucella ovis result in antigenic differences in the major outer membrane protein that it encodes compared to those of the other Brucella species. Infect Immun 69: 7020-7028. doi: 10.1128/IAI.69.11.7020-7028.2001

(40.) Zhao Z, Yan F, Ji W, Luo D, Liu X, Xing L, Duan Y, et al. 2011. Identification of immunoreactive proteins of Brucella melitensis by immunoproteomics. Sci China Life Sci 54: 880-887. doi: 10.1007/s 11427-011-4218-2

Jose-David Rosales [1,5], Annie Castillo Ochoa [1], Armando Reyna-Bello [2], Ana Teresa Serrano [3], Rodolfo Fernandez-Gomez [4]

[1] Centro de Inmunoproduccion Masiva de Anticuerpos, Fundacion Instituto de Estudios Avanzados (IDEA), Caracas, Venezuela

[2] Grupo de Investigacion en Sanidad Animal y Humana (GISAH), Carrera Ingenieria en Biotecnologia, Departamento de Ciencias de la Vida, Universidad de las Fuerzas Armadas ESPE, Santo Domingo, Ecuador

[3] Facultad de Ciencias Veterinarias, Universidad Central de Venezuela, Maracay, Venezuela

[4] Grupo de Investigacion en Sanidad Animal y Humana (GISAH), Carrera Ingenieria en Biotecnologia, Departamento de Ciencias de la Vida, Universidad de las Fuerzas Armadas ESPE, Sangolqui, Ecuador; Programa Prometeo, SENESCYT, Biophysic Solutions CA, Caracas, Venezuela

[5] E-mail: jdrr55@yahoo.com

Trabajo financiado por los proyectos: 26193 BID-FONACITII y Sub-Proyecto No. 1 2007001425 Mision Ciencias FONACIT

El trabajo representa parte de la tesis doctoral de Jose David Rosales en Biotecnologia, Mencion Animal, de la Escuela Socialista de Agricultura Tropical (ESAT)

Recibido: 28 de noviembre de 2017

Aceptado para publicacion: 31 de mayo de 2018

Leyenda: Figura 1. Alineamiento de aminoacidos de proteinas Omp31 usando MultAlin. Alineamiento de la secuencia Omp31r de Brucella melitensis 16M, B.m_OMP31r_GQ184729.1 y otras Brucellas B. abortus 2308, Ba_CAJ11595.1 (GenBank acceso CAJ11595.1), B. abortus B3196, Ba_EFH35395.1 (GenBank acceso EFH35395.1), B. abortus S19, Ba_ACD73018.1, (GenBank acceso. ACD73018), B. melitensis 152 (GenBank acceso GQ184729.1), B.m OMP31r, secuencia obtenida en este trabajo

Leyenda: Figura 2. (A) Purificacion de ADN genomico de Brucella melitensis 16M; (B) Amplificado del gen Omp31; (C) digestion del vector pET28a con EcoRI/NotI (canal 2); (D) PCRcolonia de diferentes colonias, transformadas con la ligacion pET28a/Omp31; (PM) Detalle del marcador de peso molecular de ADN

Leyenda: Figura 3. Analisis por SDS-PAGE 12% de las fracciones obtenidas al inducir la Omp31 recombinante con IPTG a 37[grados]C. (A): Linea 1, marcadores de peso molecular; linea 2, fraccion sin inducir; linea 3, fraccion a 3 h de induccion; linea 4, fraccion insoluble, fraccion 5, fraccion soluble. (B): Linea 1, marcadores de peso molecular; lineas 2 a 4, fracciones eluidas con 250 mM de imidazol. El peso molecular aparente de la Omp31r es de 28 kDA

Leyenda: Figura 4. Datos de reactividad del antigeno recombinante Omp31r empleado en el serodiagnostico por ensayo de ELISA. Se evaluo la Omp31r (20 ng/pozo) y un extracto de Brucella abortus biovar 1119 (2 ng/pozo) usando 82 sueros de bovinos clasificados por grupos: I, sueros positivos a brucelosis y II, sueros bovinos negativos a brucelosis. La linea gruesa horizontal indica el valor del punto de corte para cada antigeno

Leyenda: Figura 5. Western-Blot evaluando un extracto de E. coli, Omp31r (10 [micron]g/pozo), un extracto de B. abortus RB51 y un extracto de B. abortus cepa 1119 por anticuerpos especificos para Omp31r y sueros bovinos sanos y positivos a brucelosis. (A) Las proteinas (10 [micron]g de cada fraccion) fueron separadas en SDS-PAGE (12.5%) y tenidas con azul de coomassie. (B) Fueron electroforeticamente transferidas a nitrocelulosa y detectadas con anti-[Omp31.sub.R] realizado en conejo (dilucion 1: 1000) y conjugado (1:8000). Se cargo 0.75 [micron]g de Omp31r. Las posiciones de los marcadores de peso molecular son indicadas a la izquierda. (C) Se usaron tres sueros bovinos positivos que reconocen la banda de Omp31r y la banda de Omp31 nativa en el extracto de B.abortus 1119 (reconocen bandas en el extracto de E. coli, pero no reconoce a B. abortus RB51). (D) Al usar una mezcla de tres sueros negativos de machos bovinos, no reconocen la banda de Omp31. (E) Al usar tres sueros de machos bovinos vacunados con la vacuna RB51 se observa reconocimiento de la banda de Omp31. Los sueros se usaron a una dilucion 1:100 y el conjugado a 1:5000
Cuadro 1. Porcentaje de identidad de aminoacidos entre diferentes
proteinas Omp31

                           B. abortus   B. abortus   B. abortus
                              2308        B3196       ACD73018

B. abortus 2308               100          100          100
B. abortus B3196              100          100          100
B. abortus ACD73018           100          100          100
B. melitensis 152              70           70           70
B. melitensis OMP31r 16M      100          100          100

                           B. melitensis   B. melitensis
                                152         OMP31r 16M

B. abortus 2308                 70              100
B. abortus B3196                70              100
B. abortus ACD73018             70              100
B. melitensis 152               100             70
B. melitensis OMP31r 16M        70              100
COPYRIGHT 2018 Universidad Nacional Mayor de San Marcos
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Rosales, Jose-David; Castillo Ochoa, Annie; Reyna-Bello, Armando; Serrano, Ana Teresa; Fernandez-Gom
Publication:Revista de Investigaciones Veterinarias del Peru (RIVEP)
Date:Jul 1, 2018
Words:5332
Previous Article:Mycobacterium avium subespecie paratuberculosis en heces de bovinos del municipio de Sincelejo, Sucre, Colombia.
Next Article:Expresion y cuantificacion de ROR[gamma]t e IL-17 en mucosa intestinal de crias de alpacas (Vicugna pacos).
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters