Printer Friendly

Characterization of the cDna encoding membrane-bound trehalase, its expression and enzyme activity in bactrocera dorsalis (Diptera: Tephritidae).

Trehalose, a disaccharide, is a major carbohydrate in insect hemolymph. It plays a critical role in energy metabolism, and coping with stress. Trehalose is abundant in larvae, pupae and adult insects (Elbein et al. 2003). Trehalase (alpha, alpha-trehalose glucohydrolase, EC 3.2.1.28) is the main enzyme that catalyzes the hydrolysis of tre halose into 2 molecules of glucose. In insects, trehalase exists in many tissues where it serves to supply energy. There are 2 different forms of trehalase in insects, i.e., a soluble and a membrane-bound form, and the latter was characterized by gene cloning, purification of protein and enzyme assay(Tang et al. 2008). Presence/absence of the transmembrane domain is the judgment standard for membrane-bound or soluble form of trehalase (Tatun et al. 2008b). The soluble form mainly exists in the cytoplasm, while the membrane-bound form sticks to the cytomembrane. Both forms are important for energy metabolism and participate in the activation of the chitin synthesis pathway in insects (Tang et al. 2008). Thus, trehalase has become a new potential target of insecticide development. Trehalase obligate inhibitors, such as trehazolin (Ando et al. 1991), salbostatin (Temesvari & Cotter 1997), and validoxylamine A (Zheng et al. 2004), can specifically inhibit the activity of trehalase. Injection of these inhibitors into an immature insect can cause lethal metamorphosis into the adult (Wegener et al. 2010), and unsuccessful pupation of the larva (Asano et al. 1990). However, other methods of delivery did not work as well as injection to effectively inhibit trehalase, because the inhibitory compounds cannot penetrate the epidermis (Kono 2002).

The oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), is a destructive insect pest distributed in Asia, North America, and Oceania. This insect can damage the fruits of more than 250 plant species (Chen & Ye 2007; Clarke et al. 2005) and most of them are economically important fruit and vegetable crops. Currently, the control of this pest mainly depends on chemical insecticides. However in recent yr, the pest has developed high levels of resistance to organophosphates, pyrethroids, and avermectin (Jin et al. 2011). To effectively control this pest, it is urgent to develop new insecticides based on still unexploited physiological or biochemical targets. Since the energy supply of vertebrates is provided by the metabolic pathway of trehalose, and because this disacharide is critically important in insect metabolism, trehalase may be developed as a specific target of new biopesticides. Therefore, it is necessary to discover the specific function of trehalase in B. dorsalis.

Here, we report the cloning and characterization of the membrane-bound trehalase cDNA BdTre2 in B. dorsalis. In addition, expression profiles of BdTre2 and the activities of trehalase 2 in the various developmental stages and tissues were investigated using the methods of quantitative real-time PCR and enzyme assays, respectively. The current study provides the first insights into the B. dorsalis trehalase genes at the molecular level.

MATERIALS AND METHODS

Insects

The laboratory stock of B. dorsalis was originally collected in Fujian province, People's Republic of China, in autumn of 2010, and cultured in the laboratory at 27 [+ or -] 1[degrees]C, 70 [+ or -] 5% RH, and 14:10 h L:D photoperiod. The insects were fed using artificial diets (Cong et al. 2012). The various developmental stages of B. dorsalis including egg, larva, pupa, and adult were collected and stored at -80[degrees]C for RNA isolation. The midgut, Malpighian tubules, and fat body of B. dorsalis adults were dissected in PBS with 0.75% NaCl under a stereomicroscope and were used immediately for enzyme activity assay and RNA isolation.

Total RNA Isolation and cDNA Synthesis

Total RNA was extracted from B. dorsalis adults using RNeasy[R] Plus Mini Kit (Qiagen, Hilden, Germany).The samples were dissolved in 30 mL DEPC-treated water, and the total RNA was tested by the ratio of [OD.sub.260]/[OD.sub.280] and electrophoresis to detect its purity and quality. High quality RNA was stored at -80[degrees]C. Two[micro]g of RNA were used to synthesize cDNAs by means of the PrimeScript[R] 1st Strand cDNA Synthesis Kit following the manufacturer's instructions (TaKaRa, Dalian, China). The cDNAs were stored at -20[degrees]C. The template for rapid amplification of cDNA ends (RACE) was synthesized by the ClontechSMARTer[TM] RACE cDNA Amplification Kit (TaKaRa, Dalian, China).

Cloning BdTre2c DNA

The specific primers (Table 1) were designed according to the 3 fragments of BdTre2, and synthesized by Invitrogen (Invitrogen Life Technologies, Shanghai, China) based on the transcriptome data of our previous study (Shen et al. 2011). First-strand cDNA was used as a template in PCR under the following conditions: initial denaturation at 95[degrees]C for 3 min, followed by 34 cycles of denaturation at 95[degrees]C for 30 s, 55[degrees]C for 30 s and 72[degrees]C for 1 min with final extension at 72[degrees]C for 10 min. The total volume was 25 mL, contained: 15 mL dd[H.sub.2] O, 2.5 mL 10 x PCR Buffer ([Mg.sup.2+] free), 2.5 mL [Mg.sup.2+] (2.5 mM), 2 mL dNTP (2.5 mM), 1 mL of eaTh primer (10 mM), 1 mL cDNA, and 0.25 mL rTaq[TM] polymerase (TaKaRa, Dalian, China). The PCR products were detected in 1.0% agarose gel mixed with GoodView[TM] (SBS Genetech, Beijing, China). After excised, the target band of cDNAs was recovered by the Gel Extraction Mini Kit (Watson Biotechnologies, Shanghai, China). Purified cDNA fragments were cloned into pGEM[R]-T Easy vector (Promega, Madison, Wisconsin) and transformed into DH5[alpha] competent cells (Transgen, Beijing, China). After the selection of successful clones, cDNAs were sequenced by BGI (Beijing Genomics Institute, Beijing, China). A long length of fragment was obtained by the amplification of BdTre2 SA-F/R. Based on the fragment, 3'- and 5'- RACE were executed using specific primers to acquire full length of cDNA sequence.

Sequence Analysis and Phylogenetic Tree Construction

The sequence of Tre2c DNA was compared with other sequences downloaded from the GenBank by "nucleotide-blast" tool at the NCBI website (http://www.ncbi.nlm.nih.gov/). The homological analysis and construction of the phylogenetic tree were completed by Clustal X (Aiyar 2000) and MEGA 4.1 (Kumar et al. 2008), respectively. The transmembrane domain of protein and N-linked glycosylation sites were analyzed using TMHMM Server v.2.0 (http://www.cbs.dtu.dk/services/TMHMM) and NetNGlyc 1.0 Server (http:// www.cbs.dtu.dk/services/NetNGlyc/), respectively. The DNAMAN 5.2.2 (Lynnon BioSoft, Quebec, Canada) was applied to predict molecular weight and isoelectric point. For use as outgroups, a total of 36 insect trehalase genes were obtained from GenBank, including 16 Tre2, 14 Tre1 and another 6 trehalase genes from microbes and mammals (Table 2). All these genes were aligned by Clustal X 1.81 and assembled to a neighbor-joining tree by MEGA 4.1.

Quantitative Real-Time PCR (qPCR)

Quantitative real-time PCR (qPCR) was used to analyze the stage- and tissue-specific expression of BdTre2. RNAs from different tissues (fat body, midgut, and Malpighian tubules of adults), as well as 1st- and 2nd-instar larvae, were isolated by using RNeasy[R] Plus Micro Kit with Qiageng DNA Eliminator spin column (Qiagen, Hilden, Germany). Total RNA for 3rd-instar larva, pupa and adult was extracted using Trizol (Transgen, Beijing, China), and treated with RQ1 DNAase (TaKaRa, Dalian, China) to exclude gDNA. RNA isolation was repeated 3 times in 3 independent experiments. First-strand cDNAs were obtained by PrimeScript[R] RT reagent Kit (TaKaRa, Dalian, China)and the specific primers (Tre-DLL&Tre-DLR, Table 1) were designed by Primer 3v0.4.0 (http://frodo.wi.mit.edu/primer3/). The reaction conditions of RT-PCR were the same as mentioned above.

Based on the results of RT-PCR, the corresponding qPCR was executed to advance the investigation of changes in BdTre2 expression in the various developmental stages. The whole reaction was performed using a Mx3000P thermal cycler (Stratagene, La Jolla, California) in 25 [micro]L reactions containing 2 [micro]L of template cDNA, 12.5 [micro]L iQ[TM] SYBR[R] Green Supermix (BIO-RAD, Hercules, USA) and 0.2 mM of the primers(Tre-DLL&Tre-DLR). Amplification conditions were as follows: initial denaturation at 95[degrees]C for 2 min, followed by 40 cycles of denaturation at 95[degrees]C for 15 s, 60[degrees]C for 30 s and 72[degrees]C for 30 s. The [alpha]-tubulin gene was used as a stable reference (Shen et al. 2011; Shen et al. 2012). PCR efficiencies of BdTre2 and [alpha]-tubulin gene were calculated by the Mxpro-Mx3000P version 4.01 (Stratagene, La Jolla, California). The data for both development- and tissue-specific expression patterns were subjected to analysis of variance and means were separated by least significant difference test (LSD) (SPSS 12.0 for Windows).

Measurement of Trehalase Activity

The samples in 6 developmental stages (including egg, 1st-, 2nd-, and 3rd- instar larva, pupa, and adult), and 3 kinds of tissue in the adult (fat body, midgut, and Malpighian tubule) were collected. The experiments were repeated 3 times in 3 independent experiments. The samples (80-90 mg) were homogenized in liquid nitrogen with mortar and pestle, and after removal of liquid nitrogen, 2 mLs phosphate buffer (0.02 mol/L, pH 5.8) was added. The sample solution was centrifuged at 10,000 x g for 1 h at 4[degrees]C and the supernatant was discharged. The sediment was re-suspended and homogenized in phosphate buffer, incubated with 30 mM CHAPS with gentle stirring at room temperature for 30 min. The supernatant was centrifuged at 10,000 x g for 1 h at 4[degrees]C, and it contained membrane-bound trehalase.

The trehalase activity was measured by the method of Lindsay (1973) using 3,5-dinitrosalicylic acid (DNS). The color development reagent contained 1g DNS, 1g NaOH, 0.2g phenol and 0.05g [Na.sub.2] S[O.sub.3] and was dissolved in 100 [micro]L dd[H.sub.2]O. Fifty [micro]L supernatant was added into the 1.5 mL tube, compounded with 100 [micro]L trehalose solution (40 mmol/L) (Sigma-Aldrich, Shanghai, China). The mixture was incubated in a water bath at 37[degrees]C for 30 min. The reaction was ended in boiling water for 2-3 min and cooled on ice. Then 150 mL color development reagent was added into the solution and incubated in a 90[degrees]C water bath for 5 min. After the tube was cooled in ice, 50 [micro]L Rochelle salt solutions (40%) was added. The absorbance was measured at 550 nm by a Microplate Spec trophotometer XMark[TM] (BIO-RAD, Hercules, USA). The amount of glucose catalyzed by trehalase was then determined from the standard curve. The protein content was determined using Coomassie brilliant blue G-250 and bovine serum albumin as a standard. Trehalase activity was expressed as [micro]mol.[mg.sup.-1] protein.[min.sup.-1].

RESULTS

Sequence Analysis

A full-length cDNA(Bd7Te2) of trehalase from B. dorsalis was obtained by cDNA amplification (Fig. 1). The BdTre2 transcript contains an UTR of 808 bp and ORF of 1842 bp, which encodes 613 amino acids. The molecular weight and pI of BdTre2 were predicted to be approximately 70.1 kDa and 4.97, respectively. A transmembrane helix region existed in the 7-29 amino acid residue region. Residues 282, 349, and 447 were detected to be N-linked glycosylation sites. Multiple alignment showed that there were 2 signature motifs, "PGGRFIEFYYWDSY(185-199)" and "QWDFPNVWPP(483-493)", and 5 other conserved sequences, "DSKTFVDMK (residues70-79)", "IPNGGRVYY (230-239)", "RSQPPFL (241-248)", "GPRPESYREDI (300-311)", and "ELKAGAESGMDFSSRWFV (328-346)". Residues 547-553("GGGGEY") were detected to be a glycine-rich region. In BdTre2, there is no signal peptide site, which is different from other Dipteran insects, like Drosophila melanogaster Meigen and D. simulans Sturteveant, (Drosophilidae).

Phylogenetic Analysis

Using the protein sequences, we analyzed the phylogenetic relationships among BdTre2 and other Tre2 and Tre1 genes across insect species based on the neighbor-joining method (Fig. 2). Tre2 genes of Diptera were clustered separately from those of other insects. In the dipteran part of the phylogenetic tree, BdTre2 clustered with fruitflies, but was separated from mosquitoes (Cu licidae). In addition, BLAST-P in NCBI showed that BdTre2 shared 65% identity with Tre2 of D. melanogaster (DQ864060), 65% identity with D. simulans (ABH06710), 57% identity with Aedes aegypti (XM_001660243), and 54% identity with Anopheles gambiae (XM_320471), all of which suggested that BdTre2 was most closely related to the Tre2 of Dipteran species.

Expression Patterns in Different Developmental Stages and Tissues

The expression patterns of BdTre2 were analyzed using qPCR of samples taken from various developmental stages and tissues (Fig. 3). The results showed that the expression of BdTre2 was detectable in all tested developmental stages. The highest and lowest mRNA levels were found in adult and pupa stages, respectively. The expression levels in the adult were 3-, 6-, 2-, 4-, 49-fold higher than in the egg, 1st, 2nd, and 3rd- instar larva, and pupa, respectively (Fig. 3A). Moreover, statistical analysis showed that the expression in adult was significantly higher than those in other stages (P < 0.05).

The relative expression patterns of BdTre2 in different tissues were shown in Fig. 3B. BdTre2 was detectable in the midgut, Malpighian tubules, and fat body. Expression of BdTre2 was significantly greater in the midgut than in the other 2 tissues (P < 0.05). More specifically, the expression level in midgut was 8- and 4- fold higher than that in Malpighian tubules and fat body, respectively.

Trehalase Activity Measurements

In the enzyme activity assay, membrane-bound trehalase of B. dorsalis presented activity in all of the developmental stages. More specifically, enzyme activity in adults was higher than in the other stages, especially significantly higher than in the egg (P < 0.05). The enzyme activities in the egg, 1st, 2nd and 3rd- instar larvae, and pupae were 2-, 1.2-, 4-, 1.6- and 4-fold lower than in the adult (Fig. 4A; P < 0.05).

Trehalase2 activity found in the midgut, Malpighian tubules and fat body was 0.28, 0.34 and 0.25 [micro]mol [mg.sup.-1] protein [min.sup.-1], respectively. Trehalase activity in Malpighian tubules was significantly higher than in the midgut and fat body (Fig. 4B, P < 0.05).

Discussion

The trehalase gene has been cloned from many insect species. The soluble trehalase gene was first reported from Tenebrio molitor (Takiguchi et al. 1992) and subsequently from other species, including Bombyx mori (Su et al. 1993), Pimpla hypochondriaca (Parkinson et al. 2003), and Locusta migratoria (Liu et al. 2012). However, the membrane-bound isoform was first detected in Bombyx mori in 2005 (Mitsumasu et al. 2005). These 2 types of trehalase were found to exist in many insects including Apis mellifera (Lee et al. 2007), Omphisa fuscidentalis (Tatun et al. 2008a), Spodoptera exigua (Chen et al. 2010), and Laodelphax striatellus (Zhang et al. 2012). In this study, BdTre2 has signature motifs of trehalase in the trans-membrane helix region. The phylogenetic analysis found that BdTre2 has higher identity with other Tre2 genes in the Diptera. This confirmed that BdTre2 was the membrane-bound trehalase gene of B. dorsalis.

Trehalases are important enzymes in insect physiological activities, as they can catalyze one molecule of trehalose into 2 molecules of glucose (Azuma & Yamashita 1985; Su et al. 1993). The main function of trehalase 2 is to hydrolyze sugar in muscle and the midgut in order to provide energy for activities. Through RNA interference technology (RNAi), it was reported that the feeding of dsTre2 can cause weight loss and death in Laodelphax striatellus (Zhang et al. 2012). The membrane-bound trehalase presents high activity in Locusta migratoria flight muscle, whereas the soluble trehalase does not appear to have obvious activity in flight muscle (Wegener et al. 2010). Moreover, since trehalase 2 participated in transporting sugar into ovarian cells (Su et al. 1994), the gene expression and enzyme activity of trehalase 2 were enhanced in the ovary at day 7 after a blood meal of Rhodnius prolixus (Santos et al. 2012). Tre2 expression and enzyme activity assay throughout the whole life cycle of B. dorsalis showed that this gene and its corresponding enzyme mainly played a role in the adult. Both the enzyme activity and gene expression level were significantly enhanced in the adult compared to the pupa. It is possible that Tre2 expression and enzyme activity are involved in a major way in the frequent flight and reproduction behaviors of adults.

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

[FIGURE 3 OMITTED]

In S. exigua larvae, Tre2 was found highly expressed in the midgut, Malpighian tubules and fat body, but much less so in the brain, cuticle, trachea and testes (Tang et al. 2008). After R. prolixus had been fed, the trehalase activity in midgut was higher than in the fat body and Malpighian tubules(Mariano et al. 2009). Both types of trehalase existed in midgut of B. mori (Mitsumasu et al. 2005); trehalase 2 was associated with supporting peristaltic movement of the midgut by providing energy to visceral muscles (Azuma & Yamashita 1985; Mitsumasu et al. 2005). Our results suggested that this gene was expressed in these metabolic tissues both in larvae and adults. In addition, Tre2 was strongly expressed in the midgut not only because of the energy requirements of this organ, but also to support the chitin synthesis pathway in the midgut (Chen et al. 2010; Tang et al. 2008). After the injection of dsTre2, the expression of chitin synthase gene B was also suppressed (Chen et al. 2010). In our study, the gene expression level in the midgut was significantly higher than in other tissues and this suggested that trehalase 2 may be involved in providing energy to the chitin synthesis process in the midgut.

[FIGURE 4 OMITTED]

In insects, trehalase 2 is involved in many physiological processes, like flight (Wegener et al. 2010), reproduction, development (Santos et al. 2012) and digestion in the midgut (Mitsumasu et al. 2005). In fight muscle, the concentration of trehalose decreased in the initial period of flight and remains low during long durations of flight (van der Horst et al. 1978). Prolonged flight can cause glycolysis in flight muscle (Wegener 1996). Trehalose must be catabolized by trehalase. Therefore, we assume that Bdtre2 may be involved in the flight of B. dorsalis. In addition, in the metabolic pathway of trehalose, trehalase transport factor and trehalase synthase are as important as trehalase (Kikawada et al. 2007; Kunieda et al. 2006; Xu et al. 2009). The relative functions of these genes, plus their importance in the physiology of B. dorsalis suggest that they present a possible target for RNAi strategies to manage this pest.

Caption: Fig. 1. Nucleotide and amino acid sequence of B. dorsalis membrane-bound trehalase gene (GenBank accession number: JQ228448). The start and stop codon are indicated with bold, bold and asterisk, respectively. Black boxes: trehalase signature motifs (residues 185-199 and 483-493); white boxes: N-linked glycosylation sites (residues 282, 349 and 447); gray boxes: conserved regions (residues 70-79, 230-239, 241-248, 300-311 and 328-346). The transmembrane helix region is marked by single underlining (residues 7-29). The glycine-rich region is marked by double underlining (residues 547-553).

Caption: Fig. 2. Phylogenetic tree of trehalases based on the deduced amino acid sequences. These sequences from different organisms were aligned and analyzed by using MEGA 4.1. The topology was tested by the Neighbor-joining algorithm and a bootstrap of 1,000 replications. The species and GenBank accession numbers are presented in Table 2.

Caption: Fig. 3. Expression patterns of the BdTre2 in different developmental stages (A) and tissues (B) of B. dorsalis (each bar presents the mean [+ or -] SD; different letters above each bar indicated a significant difference, P < 0.05, LSD in ANOVA).1st, 2nd, and 3rd means the 1st-, 2nd-, and 3rd- instar. MG, MT, and FB represent the midgut, Malpighian tubules, and fat body, respectively, dissected from adults.

Caption: Fig. 4. Enzyme activity assay of membrane-bound trehalase in different developmental stages (A) and tissues (B) of B. dorsalis. Samples were incubated for 15 min in the presence of 40 mM trehalose. Results are mean [+ or -] SD for 3 independent determinations. Different letters above each bar indicated a significant difference (P < 0.05, LSD in ANOVA). 1st, 2nd, and 3rd means the 1st-, 2nd-, and 3rd- instar larva. MG, MT, and FB represent midgut, Malpighian tubule, and fat body, respectively, dissected from adults. Trehalase activity is expressed as umoLmg-1protein.[min.sup.-1].

ACKNOWLEDGMENTS

This work was supported in part by the Program for Innovative Research Team in University (IRT0976), Natural Science Foundation of Chongqing (cst c2013jjB0176), and the Earmarked Fund for Modern Agro-industry (Citrus) Technology Research System of China.

REFERENCES CITED

AIYAR, A. 2000. The use of CLUSTAL W and CLUSTAL X for multiple sequence alignment. Methods in molecular biology (Clifton, NJ). 132: 221-241.

ANDO, O., SATAKE, H., ITOI, K., SATO, A., NAKAJIMA, M., TAKAHASHI, S., HARUYAMA, H., OHKUMA, Y., KINOSHITA, T., AND ENOKITA, R. 1991. Trehazolin, a new trehalase inhibitor. J. Antibiot. 44: 1165-1168.

ASANO, N., TAKEUCHI, M., KAMEDA, Y., MATSUI, K., AND KONO, Y. 1990. Trehalase inhibitors, validoxylamine A and related compounds as insecticides. J. Antibiot. 43: 722-726.

AZUMA, M., AND YAMASHITA, O. 1985. Cellular localization and proposed function of midguttrehalase in the silkworm larva, Bombyx mori. Tissue Cell 17: 539-551.

CHEN, J., TANG, B., CHEN, H. X., YAO, Q., HUANG, X. F., ZHANG, D. W., AND ZHANG, W. Q. 2010. Different functions of the insect soluble and membrane-bound trehalase genes in chitin biosynthesis revealed by RNA interference. PLoS One 5: e10133

CHEN, P., YE, H. 2007. Population dynamics of Bactrocera dorsalis (Diptera : Tephritidae) and analysis of factors influencing populations in Baoshanba, Yunnan, China. Entomol. Sci. 10: 141-147.

CLARKE, A. R., ARMSTRONG, K. F., CARMICHAEL, A. E., MILNE, J. R., RAGHU, S., RODERICK, G. K., AND YEATES, D. K. 2005. Invasive phytophagous pests arising through a recent tropical evolutionary radiation: The Bactrocera dorsalis complex of fruit flies. Annu. Rev. Entomol. 50: 293-319.

CONG, L., YANG, W. J., SHEN, G. M., DOU, W., AND WANG, J. J. 2012. Molecular characterization of the cDNA encoding ecdysone receptor isoform B1 and its expression in oriential fruit fly, Bactrocera dorsalis (Diptera: Tephritidae). Florida Entomol. 95: 650-658.

ELBEIN, A. D., PAN, Y. T., PASTUSZAK, I., AND CARROLL, D. 2003. New insights on trehalose: a multifunctional molecule. Glycobiology 13: 17R-27R.

JIN, T., ZENG, L., LIN, Y. Y., LU, Y.Y., AND LIANG, G. W. 2011. Insecticide resistance of the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), in mainland China. Pest Mgt. Sci. 67: 370-376.

KIKAWADA, T., SAITO, A., KANAMORI, Y., NAKAHARA, Y., IWATA, K. I., TANAKA, D., WATANABE, M., AND OKUDA, T. 2007. Trehalose transporter 1, a facilitated and high-capacity trehalose transporter, allows exogenous trehalose uptake into cells. Proc. Natl. Acad. Sci. 104: 11585-11590.

KONO, Y. 2002. Trehalase as a prospective target of insecticide. J. Pestic. Sci. 27: 396-400.

KUMAR, S., NEI, M., DUDLEY, J., AND TAMURA, K. 2008. MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 9: 299-306.

KUNIEDA, T., FUJIYUKI, T., KUCHARSKI, R., FORET, S., AMENT, S. A., TOTH, A. L., OHASHI, K., TAKEUCHI, H., KAMIKOUCHI, A., KAGE, E., MORIOKA, M., BEYE, M., KUBO, T., ROBINSON, G. E., AND MALESZKA, R. 2006. Carbohydrate metabolism genes and pathways in insects: insights from the honey bee genome. Insect Mol. Biol. 15: 563-576.

LEE, J. H., SAITO, S., MORI, H., NISHIMOTO, M., OKUYAMA, M., KIM, D., WONGCHAWALIT, J., KIMURA, A., AND CHIBA, S. 2007. Molecular cloning of cDNA for trehalase from the European honeybee, Apis mellifera L., and its heterologous expression in Pichia pastoris. Biosci. Biotechnol. Biochem. 71: 2256-2265.

LINDSAY, H. 1973. A colorimetric estimation of reducing sugars in potatoes with 3, 5-dinitrosalicylic acid. Potato Res. 16: 176-179.

LIU, X. J., ZHANG, H. H., LI, D. Q., CUI, M., AND MA, E. B., ZHANG, J. Z. 2012. Sequence characterization and mRNA expression profiling of a soluble trehalase gene in Locusta migratoria (Orthoptera: Acrididae). Acta. Entomol. Sin. 55: 1264-1271.

MARIANO, A. C., SANTOS, R., GONZALEZ, M. S., FEDER, D., MACHADO, E. A., PASCARELLI, B., GONDIM, K. C., AND MEYER-FERNANDES, J. R. 2009. Synthesis and mobilization of glycogen and trehalose in adult male Rhodnius prolixus. Arch. Insect Biochem. Physiol. 72: 1-15.

MITSUMASU, K., AZUMA, M., NIIMI, T., YAMASHITA, O., AND YAGINUMA, T. 2005. Membrane-penetrating trehalase from silkworm Bombyx mori. Molecular cloning and localization in larval midgut. Insect Mol. Biol. 14: 501-508.

PARKINSON, N. M., CONYERS, C. M., KEEN, J. N., MACNICOLL, A. D., SMITH, I., AND WEAVER, R. J. 2003. cDNAs encoding large venom proteins from the parasitoid wasp Pimpla hypochondriaca identified by random sequence analysis. Comp. Biochem. Physiol. C 134: 513-520.

SANTOS, R., ALVES-BEZERRA, M., ROSAS-OLIVEIRA, R., MAJEROWICZ, D., MEYER-FERNANDES, J. R., AND GONDIM, K. C. 2012. Gene identification and enzymatic properties of a membrane-bound trehalase from the ovary of Rhodnius prolixus. Acta. Entomol. Sin. 81: 199-213.

SHEN, G. M., DOU, W., NIU, J. Z., JIANG, H. B., YANG, W. J., JIA, F. X., HU, F., CONG, L., AND WANG, J. J. 2011. Transcriptome analysis of the oriental fruit fly (Bactrocera dorsalis). PLoS One 6: e29127.

SHEN, G.M., WANG, X.N., DOU, W., AND WANG, J.J. 2012. Biochemical and molecular characterisation of acetylcholinesterase in four field populations of Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). Pest Mgt. Sci. 68: 1553-1563.

SU, Z. H., IKEDA, M., SATO, Y., SAITO, H., IMAI, K., ISOBE, M., AND YAMASHITA, O. 1994. Molecular characterization of ovary trehalase of the silkworm, Bombyx mori and its transcriptional activation by diapause hormone. Biochim. Biophys. Acta, Gene Struct. Expression 1218: 366-374.

SU, Z. H., SATO, Y., AND YAMASHITA, O. 1993. Purification, cDNA cloning and northern blot analysis of trehalase of pupal midgut of the silkworm, Bombyx mori. Biochim. Biophys. Acta, Gene Struct. Expression 1173: 217-224.

TAKIGUCHI, M., NIIMI, T., SU, Z. H., AND YAGINUMA, T. 1992. Trehalase from male accessory-gland of an insect, Tenebrio molitor. cDNA sequencing and developmental profile of the gene expression. Biochem. J. 288: 19-22.

TANG, B., CHEN, X. F., LIU, Y., TIAN, H. G., LIU, J., HU, J., XU, W. H., AND ZHANG, W. Q. 2008. Characterization and expression patterns of a membrane-bound trehalase from Spodoptera exigua. BMC Mol. Biol. 9: 51.

TATUN, N., SINGTRIPOP, T., AND SAKURAI, S. 2008a. Dual control of midgut trehalase activity by 20-hydroxyecdysone and an inhibitory factor in the bamboo borer Omphisa fuscidentalis Hampson. J. Insect Physiol. 54: 351-357.

TATUN, N., SINGTRIPOP, T., TUNGJITWITAYAKUL, J., AND SAKURAI, S. 2008b. Regulation of soluble and membrane-bound trehalase activity and expression of the enzyme in the larval midgut of the bamboo borer Omphisa fuscidentalis. Insect Biochem. Mol. Biol. 38: 788-795.

TEMESVARI, L. A., AND COTTER, D. A. 1997. Trehalase of Dictyostelium discoideum: Inhibition by amino-containing analogs of trehalose and affinity purification. Biochimie 79: 229-239.

WEGENER, G. 1996. Flying insects: Model systems in exercise physiology. Experientia 52: 404-412.

Wegener, G., MACHO, C., SCHLODER, P., KAMP, G., AND ANDO, O. 2010. Long-term effects of the trehalase inhibitor trehazolin on trehalase activity in locust flight muscle. J. Exp. Biol. 213: 3852-3857.

XU, J., BAO, B., ZHANG, Z. F., YI, Y. Z., AND XU, W. H. 2009. Identification of a novel gene encoding the trehalose phosphate synthase in the cotton bollworm, Helicoverpa armigera. Glycobiology 19: 250-257.

ZHANG, Q., LU, D. H., PU, J., WU, M., AND HAN, Z. J. 2012. Cloning and RNA interference effects of trehalase genes in Laodelphax striatellus (Homoptera: Delphacidae). Acta. Entomol. Sin. 55: 911-920.

ZHENG, Y. G., JIN, L. Q., AND SHEN, Y. C. 2004. Resin-catalyzed degradation of validamycin A for production of validoxylamine A. Catal. Commun. 5: 519-525.

YI-FEI XIE, WEN-JIA YANG, WEI DOU AND JIN-JUN WANG *

Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400716, People's Republic of China

* Corresponding author; E-mail: jjwang7008@yahoo.com; wangjinjun@swu.edu.cn.
TABLE 1. PRIMERS USED FOR CLONING THE 3 FRAGMENTS OF BDTEE2.

                               Primers and sequences

Experiments               Sense                  Anti-sense

Specific          BdTre2 SA-F:             BdTre2 SA-R:
  amplification   CACCGACGAGGATAAGGAACAA   GCCCAAGTTCTCCAAACCTCTA

5' RACE           BdTre2-5R1:              NUP:
                  CCGTATCTCCGCCTCGGTTGG    AAGCAGTGGTATCAACGCAGAGT

                  BdTre2-5R2:              UPM:
                  CTTTACCCCGCTCCTCGAAAT    CTAATACGACTCACTATAGGGC

3' RACE           BdTre2-3R1:              NUP:
                  GGGGACATCGCTGGGTGAAAT    AAGCAGTGGTATCAACGCAGAGT

                  BdTre2-3R2:              UPM:
                  TAGAGGTTTGGAGAACTTGGGC   CTAATACGACTCACTATAGGGC

Full-length       BdTre2 Full F:           BdTre2 Full R:
  confirmation    GAACCACGTTCTACTACATTGC   TGCCTTTAAAATGTGTCAGATG

qPCR              Tre-DLL:                 Tre-DLR:
                  AGAATCTCGGCATCTGTGCT     GTCCCCATCGTTCTGACAGT

TABLE 2. THE SPECIES AND GENBANK ACCESSION NUMBERS USED IN THE
PHYLOGENETIC ANALYSIS.

Gene     GenBank Accession Number           Species

AmTre1         XM_393963            Apis mellifera
AmTre2         NM_001112671         Apis mellifera
ApTre1         XP_001950264         Aphis glycines
AaTre2         XM_001660243         Aedes aegypti
AgTre          XM_320471            Anopheles gambiae
BmTre1         D86212               Bombyx mori
BmTre2         NM_001043445         Bombyx mori
CqTre2         XP_001847934         Culex quinquefasciatus
DpTre1         EHJ77355             Danaus plexippus
DpTre2         EHJ67296             Danaus plexippus
DmTre2         DQ864060             Drosophila melanogaster
DsTre2         DQ864075             Drosophila simulans
LsTre1         AFL03409             Laodelphax striatella
LsTre2         AFL03410             Laodelphax striatella
LmTre1         ACP28173             Locustamigratoria
NvTre2         XM_001602129         Nasonia vitripennis
OfTre1         EF426724             Ostrinia furnacalis
OfTre2         EF426723             Ostrinia furnacalis
PhTre1         AJ459958             Pimpla hypochondriaca
SeTre1         EU427311             Spodoptera exigua
SeTre2         EU106080             Spodoptera exigua
TmTre1         D11338               Tenebrio molitor
SfTre1         DQ447188             Spodoptera frugiperda
SfTre2         EU872435             Spodoptera frugiperda
SlTre1         ADA63846             Spodoptera litura
SlTre2         ADA63845             Spodoptera litura
TcTre1         XM_967517            Tribolium castaneum
TcTre2         XM_968826            Tribolium castaneum
NlTre1         ACN85420             Nilaparvata lugensand
NlTre2         EJ790319             Nilaparvata lugensand
CkTre          YP_001452785         Citrobacter koseri
EcTre          ZP_06653159          Escherichia coli
StTre          ZP_09722139          Salmonella typhimurium
PaTre          NP_251106            Pseudomonas aeruginosa
MmTre          NM_021481            Mus musculus
HsTre          NM_007180            Homo sapiens
COPYRIGHT 2013 Florida Entomological Society
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Xie, Yi-Fei; Yang, Wen-Jia; Dou, Wei; Wang, Jin-Jun
Publication:Florida Entomologist
Article Type:Report
Geographic Code:9CHIN
Date:Dec 1, 2013
Words:4861
Previous Article:A Florida defoliator, nystalea ebalea (Lepidoptera: Notodontidae), found feeding on Brazilian peppertree.
Next Article:Monitoring insecticide resistance in Biotype B of Bemisia tabaci (Hemiptera: Aleyrodidae) in Florida.
Topics:

Terms of use | Copyright © 2017 Farlex, Inc. | Feedback | For webmasters