Printer Friendly

Characterization of Mating Type Genes in Aspergillus flavus Populations from Two Locations in Kenya.

1. Introduction

Aspergillus spp. belongs to phylum Ascomycota and family Trichocomaceae. Species in the fungus genus' section Flavi have potential to infect maize, peanuts, cotton, and tree nuts among other crops and may contaminate with aflatoxins, which are Group 1 carcinogens according to International Centre for Cancer Research [1, 2]. The growth of A. flavus is usually favored by hot dry conditions with optimum temperature of 37[degrees]C, but the fungus readily grows between temperatures of 25 and 42[degrees]C and will even grow at temperatures from 12 to 48[degrees] C. Its ability to grow at such high temperatures contributes to its pathogenicity in humans [2, 3].

Many fungi have the potential to reproduce both sexually and asexually. Successful sexual reproduction requires the presence of functional and compatible mating type genes (MAT1-1 and MAT1-2 genes). In homothallic fungi, self-fertility is possible when both mating type genes are present and functional within the same organism, either on different chromosomes or adjacent to the same chromosome. In heterothallism, only one mating type gene is present in a strain, so it is considered self-infertile and requires the presence of a compatible strain having a functional gene representative of the opposite mating type [4, 5] (Horn et al., 2013). Aspergillus flavus is considered functionally heterothallic, and it is uncommon for strains to contain both MAT genes. Horn et al. [6] reported A. nomius strain that contained both MAT genes, which were self-infertile but functionally bisexual, meaning they could mate with both MAT1-1 and MAT1-2 strains.

Since 1981, yearly cases of aflatoxicosis have been reported in the Eastern parts of Kenya following consumption of maize contaminated with A. flavus and aflatoxins. Agriculture is the economic backbone in Rift Valley and Eastern Kenya with maize being the staple food, although aflatoxicosis has not yet been reported in the Rift Valley. Makueni is one of the areas in Eastern Kenya that has reported history of aflatoxicosis [2, 7-9]. Despite Nandi being a maize growing area, cases of aflatoxicosis have not been recorded, although oesophageal cancer cases have been reported [7, 8]. In young children, between 0 and 5 years of age, Kangethe et al. [8] reported high aflatoxin levels in Makueni compared to Nandi. Aflatoxin exposure through milk for children younger than 5 years was 4 x [10.sup.-4] and 1 x [10.sup.-4] [micro]g/kg per day in Makueni and Nandi, respectively; the exposure of nursing children through breast milk was 6 x [10.sup.-3] and 1 x [10.sup.-6] [micro]g/kg per day in Makueni and Nandi, respectively. Children below 30 months of age in Makueni had 1.4 times higher aflatoxin levels in their urine than those of the same age in Nandi.

The use of biological control method is presently the most favorable strategy for lowering preharvest contamination of cereals, groundnuts, and tree nuts with aflatoxin. Nonaflatoxin producing A. flavus is introduced into the environment and outcompetes naturally occurring aflatoxin producing strains in the soil [10]. The technology is under trial in Kenya in the aflatoxin hot spots [11-13]. However, A. flavus populations show high genetic variations due to its potential to outcross by sexual recombination under special conditions in the soil. When such outcrossing occurs, the biocontrol strain could recombine with the indigenous populations of aflatoxigenic strains and generate offspring that not only inherit the aggressiveness of the non-aflatoxigenic parent, but could also inherit the ability to produce one or more serious mycotoxins, such as aflatoxin B1 or cyclopiazonic acid (CPA) (Horn et al., 2013) [14]. Therefore, there is a need to understand the potential of introduced biocontrol strains to outcross with the existing aflatoxin producing A. flavus in the soil [14]. This study aimed to determine the distribution of MAT genes for A. flavus strains originally isolated from soil and maize samples from Makueni and Nandi as described by Nyongesa et al. [15] and Okoth et al. [16]. This is important to be assessed for two reasons: (1) to ascertain the level of recombination in the field population, which is relative to the proportions of MAT genes present, and (2) to better select a candidate biocontrol strain that will lessen the opportunity for recombining with the indigenous population [17].

2. Materials and Methods

2.1. Source of Fungal Isolates. Forty-four Aspergillus flavus isolates used in this study were originally isolated from maize and soil samples collected from Eastern (Makueni) and Rift Valley (Nandi) regions of Kenya and were recorded to have capacity to produced aflatoxins [15, 16]. The culture collection was maintained at Mycology Laboratory, University of Nairobi, Kenya.

Nandi lies within latitudes 0[degrees] and 0[degrees] 34" North and longitude 34[degrees]44" and 35[degrees]25" East, altitude between 1300 m and 2500 m above sea level. The area receives approximately 1200-2000 mm of rainfall and average temperatures of 20[degrees]C annually. Makueni area is 1218 m above sea level with average annual temperatures of 24[degrees]C and rainfall between 200 and 1200 mm. The rainfall is unreliable with frequent droughts [2, 7-9].

2.2. Molecular Characterization of Aspergillus Isolates

2.2.1. Extraction of DNA. Fungal isolates from Eastern and Rift Valley parts of Kenya, with determined aflatoxin accumulation levels in yeast extract sucrose (YES) according to Okoth et al. 2012 [16] and Nyongesa et al. 2015 [15] (are shown in Table 1), preserved on silica gel beads at 4[degrees]C were used. Two to three silica gel beads were transferred on potato dextrose agar (PDA) plates under sterile conditions. Each A. flavus strain was cultured in replicates. The isolates were grown under 37[degrees]C for 7 days, and DNA was extracted using a Zymo Research fungal/Bacterial DNA Mini Prep Kit (Epigenetics, Hatfield, South Africa) according to the manufacturer's instructions.

2.3. Analysis of Aspergillus flavus Isolates by Mating Type. The MAT genes were established by a diagnostic polymerase chain reaction (PCR) using primers M1F and M1R for the MAT1-1 gene and M2F and M2R for the MAT1-2 gene [18,19] (see Table 2). The PCR was performed in 20 [micro]l reactions, which included of a 1:10 or 1:100 DNA dilution, 1 U REDTaq DNA polymerase (Sigma-Aldrich Company, Milan, Italy), 2 [micro]l REDTaq buffer supplemented with 1.7 [micro]l of 22 mM Mg[Cl.sub.2] for a final concentration of 3.0 mM, 10 mM deoxyribonucleotide triphosphates, 0.5% Bovine Serum Albumin (BSA), and 0.5 [micro]M of each of the 4 primers (M1F, M1R, M2F, and M2R) [18, 19]. Reactions were run in a Mastercycler ep gradient (Bio-Rad, California, USA) with a thermal profile of 5 min at 95[degrees]C followed by 40 cycles of 30 s at 95[degrees]C, 60 s at 54[degrees]C, and 45 s at 72[degrees]C. The amplified DNA was electrophoresed in 1.5% (w/v) Tris-acetate-Ethylenediaminetetraacetic acid (EDTA) agarose gels, and amplicons were designated as MAT1-1 and MAT1-2 using a 100 bp DNA ladder (exACTGene, Fisher Scientific International) as a size standard.

A concentration of 1% agarose gel was made. The agarose was boiled at 100[degrees]C for 5 minutes in a conical flask and left to cool to 55[degrees]C, and 0.3 [micro]l of ethidium bromide was added while swirling the flask to enable the gel mix with ethidium bromide. The mixture was poured into a gel tank with the combs on and left to solidify. Molecular marker (2 [micro]l) was added to one well and DNA (4 [micro]l) to the other wells and the arrangements were noted. The gel was run for 45 minutes at 80 voltage and viewed under gel doc (Bio-Rad, Molecular Imager Gel Doc[TM] XR-CLASS, Imaging System, California, USA).

3. Results and Discussion

Among the 44 isolates, six strains were MAT1-1 (Figures 1, 2, 3, and 5) and 29 strains had MAT1-2 (Figures 3,4 and 5) while nine strains amplified both MAT genes (Figures 1,2, 3,4, and 5). Figures 2,3,4, and 5 are in the supplemental figures.

In this study, sampled A. flavus strains from Makueni and Nandi include those that contain at least fragments of both MAT genes and those that contain a single MAT gene. Fungi that produce functional MAT1-1 and MAT1-2 genes on the same thallus are self-fertilizing while those with a single MAT gene require compatible MAT1-1 or MAT1-2 nuclei from two different individuals. There were 20.45% isolates with fragments of both MAT genes though Nandi had 11.36%, while in Makueni, the percentage was lower (9.09%). In both regions, MAT1-2 isolates frequency was dominant (61.36%), although the frequency in Nandi was higher (75%) than in Makueni (54.17%). The isolates from Nandi had no MAT1-1 genotypes, while in Makueni their percentage was 15.91%.

Laboratory crosses between strains of A. flavus of opposite mating type genes have successfully been applied to induce sexual recombination between MAT1-1 and MAT12 isolates [20-22]. In our study, most of the isolates from Makueni were either MAT1-1 or MAT1-2, indicating that they are likely heterothallic. Four of the isolates sampled in Makueni contained fragments of both MAT genes (Table 3), indicating the potential for a homothallic existence. The nearly equal distribution of single mating types, as well as the presence of isolates exhibiting evidence of two MAT genes, in this region could be an indication that there is active recombination occurring in the fields where these isolates were sampled. Five of the Nandi isolates exhibited evidence for containing both MAT genes. Of the isolates that contained one or the other MAT gene, no MAT1-1 isolates were identified (Table 3). From this we can infer that recombination is not occurring at a rate comparable to Makueni. Mating tests would allow us to confirm or refute the functionality of these loci.

We may be able to infer a correlation between mating type distribution and aflatoxin outbreaks based on our findings. For example, aflatoxin outbreaks in in Makueni (having a more equal distribution of mating types) have been reported since 1981, while no aflatoxin outbreaks have been reported in Nandi, which has a predominance of MAT1-2 genes [7-9] (Okoth et al., 2016). Sexual recombination between toxigenic and non-aflatoxigenic A. flavus strains in the soil is viewed as a major cause of diversity enabling some of the A. flavus progenies to inherit the ability to produce aflatoxin [5,14,17, 20, 23-25].

Currently, biocontrol is the most favorable technique for lowering preharvest aflatoxin contamination. The strategy includes spreading non-aflatoxigenic A. flavus strain spores, which result in greatly reduced levels of aflatoxin. Both aflatoxin and non-aflatoxin producing strains occupy the same niches in the soil [26]. In our study, the 44 A. flavus strains characterized are agricultural isolates [15, 16]. Existence of a nearly equal distribution of MAT genes in Makueni indicates potential for sexual recombination (Table 3). Atoxigenic MAT1-1IVM300566 (0 [micro]g/kg) as biocontrol could outcross with toxigenic MAT1-2 in the two regions which could facilitate recombination. Therefore, it is advisable to search for an atoxigenic MAT1-2 strain as a candidate biocontrol strain. Ehrlich [10] suggests that it is important to test frequency of genetic recombination in agricultural environments where non-aflatoxin producing biocontrol has been introduced. Based on our findings and extrapolation to the field, it is important to assess this distribution for a field prior to release of fertile biocontrol strains that can recombine with the indigenous population. We must also verify the fecundity of strains that contain both MAT genes to determine if they are functionally bisexual as Horn et al. did with A. nomius [6].

4. Conclusion

This study underscores the importance of investigating the mating type distribution in the field, prior to biocontrol selection and release, to minimize the potential for sexual recombination while promoting efficacy of the biocontrol strain. Our findings indicate that A. flavus strains in Kenya have the potential to harbour both MAT genes, although we are uncertain of their functionality. Also, we show that not all fields will have the same distribution of mating types. The Makueni field population may have higher genetic and chemotype diversity, and potential for sexual recombination, due to the observed distribution of mating types. Selection of a naturally infertile atoxigenic strain as biocontrol would be better here. For Nandi, the distribution is less diverse, and if the MAT1-1?2 isolates are incapable of self-fertilizing or outcrossing, then use of MAT1-2 biocontrol strain would be effective. Another characteristic that would be helpful would be to ensure that the biocontrol strain lacks aflatoxin cluster genes since it might be more difficult to inherit the entire cluster during recombination.

Data Availability

The data used to support the findings of this study are included within the article.

https://doi.org/ 10.1155/2018/3095096

Conflicts of Interest

The authors have no conflicts of interest rgarding the publication of this manuscript.

Authors' Contributions

All the authors have contributed to the manuscript from the preparation to the submission stage.

Acknowledgments

This work was funded by Deans Grants Committee, University of Nairobi and Exchange Service (DAAD) In-Country

Scholarship Programme.

Supplementary Materials

Mating types for A. flavus strains from Makueni and Nandi. (Supplementary Materials)

References

[1] L. C. Grubisha and P. J. Cotty, "Genetic isolation among sympatric vegetative compatibility groups of the aflatoxinproducing fungus Aspergillus flavus," Molecular Ecology, vol. 19, no. 2, pp. 269-280, 2010.

[2] S. Okoth, "Improving the evidence base on aflatoxin contamination and exposure in Africa. Strengthening the Agriculture-Nutrition Nexus. Review," CTA Working paper 16/13, 2016.

[3] W. Felicia, N. Clarre, T. Marites, and L. Yan, "The health economics of aflatoxin. Global burden of disease," Aflatoxin control, vol. 4, p. 20, 2011.

[4] M. Paoletti, S. Elke, A. David, and D. Paul, "Sex and mating in Aspergillus; asexual or not? Aspergillus and Aspergillosis website," Living with it working with it treating it, 2004.

[5] B. W. Horn, G. G. Moore, and I. Carbone, "Sexual reproduction in Aspergillus flavus" Mycologia, vol. 101, no. 3, pp. 423-429, 2009.

[6] B. W. Horn, G. G. Moore, and I. Carbone, "Sexual reproduction in aflatoxin-producing Aspergillus nomius," Mycologia, vol. 103, no. 1, pp. 174-183, 2011.

[7] A. J. Sirma, E. O. Ouko, G. Murithi et al., "Prevalence of aflatoxin contamination in cereals from Nandi county, Kenya. International journal of agricultural sciences and veterinary medicine," in Proceedings of the Prevalence of aflatoxin contamination in cereals from Nandi county, Kenya. International journal of agricultural sciences and veterinary medicine, pp. 2320-3730, 2015.

[8] E. K. Kang'ethe, M. Gatwiri, A. J. Sirma et al., "Exposure of Kenyan population to aflatoxins in foods with special reference to Nandi and Makueni counties," Food Quality and Safety, vol. 1, no. 2, pp. 131-137, 2017.

[9] S. Okoth, L. J. Rose, A. Ouko et al., "Field evaluation of resistance to aflatoxin accumulation in maize inbred lines in Kenya and South Africa," Journal of Crop Improvement, vol. 31, no. 6, pp. 862-878, 2017.

[10] K. C. Ehrlich, "Non-aflatoxigenic Aspergillus flavus to prevent aflatoxin contamination in crops: Advantages and limitations," Frontiers in Microbiology, vol. 5, 2014.

[11] T. Ogunbayo, K. Callicott, C. Probst, and P. Cotty, "An atoxigenic vegetative compatibility group of Aspergillus flavuswidely adapted to maize production in Africa and North America," Phytopathology, vol. 103, pp. 105-106, 2013.

[12] J. Atehnkeng, P. S. Ojiambo, M. Donner et al., "Distribution and toxigenicity of Aspergillus species isolated from maize kernels from three agro-ecological zones in Nigeria," International Journal of Food Microbiology, vol. 122, no. 1-2, pp. 74-84, 2008.

[13] K. Hell, P. Fandohan, R. Bandyopadhyay et al., "Pre- and postharvest management of aflatoxin in maize," in Mycotoxins: Detection Methods, Management, Public Health and Agricultural Trade, J. F. Leslie, R. Bandyopadhyay, and A. Visconti, Eds., CABI, Wallingford, UK, 2008.

[14] K. C. Ehrlich, G. G. Moore, J. E. Mellon, and D. Bhatnagar, "Challenges facing the biological control strategy for eliminating aflatoxin contamination," World Mycotoxin Journal, vol. 8, no. 2, pp. 225-233, 2014.

[15] B. W. Nyongesa, S. Okoth, and V. Ayugi, "Identification Key for <i>Aspergillus</i> Species Isolated from Maize and Soil of Nandi County, Kenya," Advances in Microbiology, vol. 5, no. 4, pp. 205-229, 2015.

[16] S. Okoth, B. Nyongesa, V. Ayugi, E. Kangethe, H. Korhonen, and V. Joutsjoki, "Toxigenic potential of Aspergillusspecies occurring on maize kernels from two Agro-Ecological zones in Kenya," Toxins, vol. 4, no. 11, pp. 991-1007,2012.

[17] G. G. Moore, J. L. Elliott, R. Singh et al., "Sexuality Generates Diversity in the Aflatoxin Gene Cluster: Evidence on a Global Scale," PLoS Pathogens, vol. 9, no. 8, 2013.

[18] J. H. Ramirez-Prado, G. G. Moore, B. W. Horn, and I. Carbone, "Characterization and population analysis of the mating-type genes in Aspergillus flavus and Aspergillus parasiticus" Fungal Genetics and Biology, vol. 45, no. 9, pp. 1292-1299, 2008.

[19] R. Wada, J.-I. Maruyama, H. Yamaguchi et al., "Presence and functionality of mating type genes in the supposedly asexual filamentous fungus Aspergillus oryzae," Applied and Environmental Microbiology, vol. 78, no. 8, pp. 2819-2829, 2012.

[20] B. W. Horn, R. B. Sorensen, M. C. Lamb et al., "Sexual reproduction in aspergillus flavus sclerotia naturally produced in corn," Journal of Phytopathology, vol. 104, no. 1, pp. 75-85, 2014.

[21] J. Varga, G. Szigeti, N. Baranyi, S. Kocsube, C. M. O'Gorman, and P. S. Dyer, "Aspergillus: Sex and Recombination," Mycopathologia, vol. 178, no. 5-6, pp. 349-362, 2014.

[22] B. W. Horn, R. M. Gell, R. Singh, R. B. Sorensen, and I. Carbone, "Sexual reproduction in aspergillus flavus sclerotia: Acquisition of novel alleles from soil populations and uniparental mitochondrial inheritance," PLoS ONE, vol. 11, no. 1, 2016.

[23] R. A. Olarte, B. W. Horn, J. W. Dorner et al., "Effect of sexual recombination on population diversity in aflatoxin production by Aspergillus flavus and evidence for cryptic heterokaryosis," Molecular Ecology, vol. 21, no. 6, pp. 1453-1476, 2012.

[24] M. L. Paret, G. E. Vallad, D. R. Averett, J. B. Jones, and S. M. Olson, "Photocatalysis: effect of light-activated nanoscale formulations of Ti[O.sub.2] on Xanthomonas perforans and control of bacterial spot of tomato," Journal of Phytopathology, vol. 103, no. 3, pp. 228-236, 2013.

[25] J. Chepsergon, E. K. Kiprop, and L. A. Mwamburi, "Biocontrol of aflatoxins in corn using atoxigenic Aspergillus flavus," in Proceedings of the International Journal of Science and research, vol. 12, pp. 1954-1958, 2014.

[26] Y. Yin, L. Yan, J. Jiang, and Z. Ma, "Biological control of aflatoxin contamination of crops," Journal of Zhejiang University, Science B, vol. 9, no. 10, pp. 787-792,2008.

Ouko Abigael,(1) Okoth Sheila ID), (1) Amugune Nelson, (1) and Vesa Joutsjoki (2)

(1) School of Biological Sciences, University of Nairobi, P.O. Box 30197-00100, Nairobi, Kenya

(2) Natural Resources Institute Finland, FIN-31600, Jokioinen, Finland

Correspondence should be addressed to Ouko Abigael; abbykongete@uonbi.ac.ke

Received 31 July 2018; Revised 10 September 2018; Accepted 2 October 2018; Published 18 November 2018

Academic Editor: Tibor Janda

Caption: Figure 1: Mating types for A. flavus strains from Makueni and Nandi; L: molecular weight marker, Lane 1: IVM201365, 2: IVM100095,3: IVM100130.
Table 1: Aspergillus flavus isolates from Makueni and Nandi.

Strain identity      Location   Aflatoxin level ([micro]g/kg)

40245BMIG             Nandi                 116666
40041BM38Y6           Nandi                 80664
60801BSIYG            Nandi                 23883
40224BSIYG            Nandi                 22203
40296BSY              Nandi                 12803
60756                 Nandi                 11292
50400BM2YG            Nandi                  247
40243BMIB             Nandi                  151
40013BM126            Nandi                  145
40267BSIYG            Nandi                   96
60661BMIYG            Nandi                   91
504820BMIYG           Nandi                   77
50536BMIYG            Nandi                   77
60690BMIYG            Nandi                   57
40143BM112G           Nandi                   46
60572 BM2Y            Nandi                   46
60795BM8BJ            Nandi                   22
40025BSIYG            Nandi                   22
50444BSIYG            Nandi                   0
1VM201365            Makueni                152965
1VM40018             Makueni                97184
1VM100095            Makueni                92249
1VM100130            Makueni                88878
2M2002LG             Makueni                74367
2M1983G              Makueni                67350
1VM250WY             Makueni                47653
2VM964               Makueni                29484
1VM132G              Makueni                23069
2VM882G              Makueni                19038
1VM414               Makueni                13574
1VM100957            Makueni                11971
1VM201122            Makueni                11292
1VM130LG             Makueni                10199
1VM100079            Makueni                 9089
1VM350G              Makueni                 2912
3VM566G              Makueni                 1850
2M1983DG             Makueni                 1165
2M1002LG             Makueni                 962
1VM195               Makueni                 785
1VM131LG             Makueni                 602
3VM566               Makueni                 332
1VM201204            Makueni                  22
1VM300566            Makueni                  0

Table 2: Sequences of nucleotide primers used in the study.

Primer code    Target gene      Primer sequence       PCR product size
M1F              MAT1-1       ATTGCCCATTTGGCCTTGAA     396 base pairs
M1R              MAT1-1       TTGATGACCATGCCACCAGA     396 base pairs
M2F              MAT1-2      GCATTCATCCTTTATCGTCAGC    270 base pairs
M2R              MAT1-2      GCTTCTTTTCGGATGGCTTGCG    270 base pairs

Table 3: Mating type distribution for A.flavus isolates sampled
in two counties in Kenya.

Strain identity    Location   Aflatoxin level      Mating type
                               ([micro]g/kg)    identity using PCR
                                                  multiplex assay

1VM201365          Makueni        152965          MAT1-1 & MAT1-2
1VM40018           Makueni         97184          MAT1-1 & MAT1-2
1VM100095          Makueni         92249              MAT1-1
1VM100130          Makueni         88878              MAT1-1
2M2002LG           Makueni         74367              MAT1-2
2M1983G            Makueni         67350              MAT1-1
1VM250WY           Makueni         47653              MAT1-2
2VM964             Makueni         29484              MAT1-2
1VM132G            Makueni         23069              MAT1-2
2VM882G            Makueni         19038              MAT1-2
1VM414             Makueni         13574              MAT1-2
1VM100957          Makueni         11971              MAT1-2
1VM201122          Makueni         11292              MAT1-1
1VM130LG           Makueni         10199              MAT1-1
1VM100079          Makueni         9089               MAT1-2
1VM350G            Makueni         2912           MAT1-1 & MAT1-2
3VM566G            Makueni         1850               MAT1-2
2M1983DG           Makueni         1165               MAT1-2
2M1002LG           Makueni          962               MAT1-2
1VM195             Makueni          785               MAT1-1
1VM131LG           Makueni          602               MAT1-2
3VM566             Makueni          332               MAT1-2
1VM201204          Makueni          22            MAT1-1 & MAT1-2
1VM300566          Makueni           0                MAT1-1
40245BMIG           Nandi         116666              MAT1-2
40041BM38Y6         Nandi          80664              MAT1-2
60801BSIYG          Nandi          23883              MAT1-2
40224BSIYG          Nandi          22203              MAT1-2
40296BSY            Nandi          12803          MAT1-1 & MAT1-2
60756               Nandi          11292              MAT1-2
50400BM2YG          Nandi           247               MAT1-2
40243BMIB           Nandi           151           MAT1-1 & MAT1-2
40013BM126          Nandi           145               MAT1-2
40267BSIYG          Nandi           96                MAT1-2
60661BMIYG          Nandi           91                MAT1-2
504820BMIYG         Nandi           77            MAT1-1 & MAT1-2
50536BMIYG          Nandi           77                MAT1-2
60690BMIYG          Nandi           57                MAT1-2
40143BM112G         Nandi           46            MAT1-1 & MAT1-2
60572 BM2Y          Nandi           46                MAT1-2
60795BM8BJ          Nandi           22                MAT1-2
40025BSIYG          Nandi           22                MAT1-2
50444 BSIYG         Nandi            0            MAT1-1 & MAT1-2
COPYRIGHT 2018 Hindawi Limited
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Abigael, Ouko; Sheila, Okoth; Nelson, Amugune; Joutsjoki, Vesa
Publication:Advances in Agriculture
Date:Jan 1, 2018
Words:3576
Previous Article:Reflectometric System for Continuous and Automated Monitoring of Irrigation in Agriculture.
Next Article:Sensitivity of Colletotrichum gloeosporioides Isolates from Diseased Avocado Fruits to Selected Fungicides in Kenya.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters