Printer Friendly

Characterization and plant growth promoting aspects of a novel phosphate solubilizing brown sarson endophyte Pseudomonas fluorescens strain smppsap5 isolated from Northern Himalayas of India.

The liaison of plants with microbes that do not subdue or even stimulate their growth and development has attracted the attention of scientists, not only as a subject to study with respect to the fundamentals of the simultaneity and interaction of different organisms but because of their probable expanding role in the global sustainable agriculture production systems (Chebotar et al, 2015). It is an unwavering fact that bacterial endophytes can offer a growth stimulatory effect on host plants, specifically growth promotion and protection against various pathogens; and that under diverse ecological niches bacterial endophytes are able to communicate and interact with the host more efficiently than the counterpart plant growth promoting bacteria of same abilities (Coutinho et al., 2015). Most of the plant nutrients are abundant in soil but are unavailable to the plants, due to a vast number of reasons like in their complex forms or the poor soil conditions. Same is the case with phosphorus the second most important nutrient of plants next to nitrogen. It exists in soil in the form of mineral salts or immobilized into organic compounds. Despite being abundant in soil these phosphorus compounds are not available to the plants due to their insolubility (Miller et al, 2010). Plants have need of nearly 30 [micro]mol/L of phosphorus for maximum productivity, but there is only about 1 [micro]mol/L available in most of the soils. Therefore, the non-availability of phosphorus in many soils has been witnessed to be a major growth limiting factor in agricultural and horticultural systems (Daniels et al., 2009). This obliges the application of soluble forms of phosphorus in the form of phosphate fertilizers, which too has problem of getting immobilized to insoluble forms rapidly as a result of its reaction with aluminum and iron minerals and as such the efficiency of applied phosphorus rarely exceeds 30 percent due to its fixation in soil (Sharma et al., 2013). In addition the phosphorus fertilizers are derived from phosphate rock, which is nonrenewable resource and current global reserves are already under threat of getting completely perished in 50-100 years (Cordell et al., 2009). Therefore, exploring the alternative forms of agriculture, where nutrient conservation is key, is of vital importance and with this in mind to explore the native endophytic bacterial microflora for phosphate solubilization in particular and plant growth promotion in general is one of the reasonable alternative. Endophytic bacteria use a number of mechanisms to bring the solubilization of phosphorus that includes the activity of their enzymatic systems like phosphatases or phosphohydrolases with the processes like acidification, chelation, exchange reactions, but main mechanism in operation is the solubilization through the release of metabolites such as organic acids (Young et al., 2013).

In various studies we have seen a large number of rhizospheric bacteria being used for enhanced crop production and protection but very limited studies on endophytic bacterial isolates are available. Thus the present study carried out to elucidate the effect of Pseudomonas fluorescens strain smppsap5 on growth and yield of brown sarson. Various species of Pseudomonas isolates have been widely reported to be efficient phosphate solubilizes and thus used in a huge number of sustainable agriculture production systems (Oteino et al., 2015). The brown sarson are grown throughout the India and both in tropical and sub-tropical regions of the world besides being major oil seed crop of the Kashmir valley of J&K for the seeds which are used as a spice and for extraction of oil. The reports on Pseudomonas fluorescens as a phosphate solubilizer in brown sarson under temperate conditions is not available. The objectives of present investigation were to determine the adaptability of Pseudomonas fluorescens strain smppsap5 (isolated from root tissues of brown sarson) in various stress conditions and to evaluate their role on plant growth performance by determining the leaf pigment content, yield attributes and soil physiochemical and biological properties. The ecological impact of Pseudomonas inoculants in soil has often been characterized in terms of composition and size of specific microbial groups (Carrol et al., 1995).

MATERIALS AND METHODS

Sampling site

The root samples of brown sarson were collected from three districts of Kashmir valley J&K namely; Anantnag, Srinagar and Baramulla. A total of 60 samples were collected and the sample containing Pseudomonas fluorescens strain smppsap5 was collected from Hutmara Anantnag with co-ordinates 33[degrees] 46' 49. 693 N, 75[degrees] 1 3' 50. 953 E and altitude 5467 ft.

Isolation

The isolation of bacterial isolates was done by washing the root samples vigorously in sterile distilled water for five minutes to remove all the adhered soil particles, surface sterilization was done by keeping the washed samples in 1 percent (wt/vol) active chloride (added as sodium hypochlorite [NaOCl] solution) supplemented with one droplet of Tween 80 per 100 ml solution, and rinsed three times in sterile distilled water. Thereafter, the roots were crushed in sterile petri dishes and a loopful of root sap was streaked on tryptic soy/agar (TSA; Merck Co., Germany) medium plates for bacterial culture and incubated at 30[degrees]C for 48 h. The bacterial colonies were differentiated by their morphology and pigmentation and, re-isolated colonies were separately cultured on fresh TSA medium. For long term preservation, isolated bacterial cultures were stored at 4[degrees]C.

Characterization of Bacterial isolates

Based on the highest solubilization index among 81 isolates, endophytic bacterium Pseudomonas fluorescens strain smppsap5 was selected and characterized on the basis of colony morphology, biochemical characteristics and molecular phylogeny. The morphological and biochemical characteristics of the isolates were examined according to Bergey's manual of determinative Bacteriology (Kumar et al, 2015). 16S rRNA gene amplification and sequencing

Total genomic DNA was isolated by N-Cetyl-N,N-trimethyl-ammonium bromide (CTAB) method (Doyle and Doyle, 1987; Doyle and Dickson, 1987; Cullings, 1992). The forward and reverse primers used for 16S rDNA amplification were: fD 1 (5' AGAGTTTGATCCTGGCTCAG 3 ') and rD1 (5' AAGGAGGTGATCCAGCCGCA 3 ') (Luckow et al., 2000) were used to amplify 1500 bp region of 16S rRNA gene using a thermal cycler (BioRad, USA). Amplification products were resolved by agarose-gel electrophoresis (1.5%), and visualized using a gel documentation system (Alfa Imager, Alfa Innotech Corporation, USA). The amplicons were purified using Genei Pure[TM] quick PCR purification kit (GeNei[TM], Bengaluru, India) and quantified at 260 nm using a spectrophotometer taking calf thymus DNA as control. The purified partial 16S rDNA amplicons were sequenced in an Applied Biosystems 3130 Genetic Analyzer (Applied Biosystems, CA, and USA).

Analysis of 16S rDNA sequences

The partial sequences of nucleotides were compared with available sequences from NCBI database and sequences showing >99% similarity were retrieved by Nucleotide Basic Local Alignment Search Tool (BLAST N) program available at National Center for Biotechnology Information (NCBI) server (www.ncbi.nlm.nih.gov/ BLAST).

PGP traits analysis

Phosphate solubilization

All the isolates were grown in TSA broth. Log phase growing cells of each culture (15pL) were spotted on Pikovskaya's medium plates (Pikovskaya, 1948). These plates were incubated at 28+2[degrees]C for 3-4 days. Zone of solubilization was measured and colony size was also measured to calculate solubilization index by the formula; SI = colony diameter+ halo-zone diameter/colony diameter (Edi-Premono et al., 1996). To carry out the assay for phosphate estimation the method given by Bray and Kartz (1945) was employed. The soluble phosphorus formed was estimated calorimetrically. The optimization was carried out at different incubation periods and nitrogen sources viz. Tryptone, peptone, NaN[O.sub.3], casein, urea.

Indole-3-acetic acid (IAA) production

IAA production was estimated at different levels of L-tryptophan (0.05, 0.1, 0.15, 0.2 and 0.25 mg/mL) and different incubation periods (48, 96 and 144 h) by Salkowski's method (Tang and Borner, 1974). The endophytic bacterial isolate Pseudomonas fluorescens strain smppsap5 was inoculated in 25 mL nutrient broth and incubated at 28+2[degrees]C in a shaking BOD incubator. After different incubations, 2mL of each culture broth was centrifuged at 7,000 rpm for two minutes and then IAA was determined in culture supernatant by adding Salkowski's reagent (1 mL of 0.05 M [Fecl.sub.3] in 50 mL of 35% H[Co.sub.4]) of equal volume. The contents were shook continuously for 30 minutes for pink color development which was estimated calorimetrically at 500 nm using spectrophotometer. Production of ammonia and hydrocyanic acid

The freshly grown culture of Pseudomonas fluorescens strain smppsap5 was inoculated in 10 mL peptone water broth and incubated for 72 h at 30+2[degrees]C. About 0.5 mL Nessler's reagent was added and appearance of yellow/brown color indicated the ammonia production (Cappuccino and Sherman, 2010). Quantitatively ammonia production was analyzed by inoculating the fresh culture into peptone water broth for 72 h at 30+2 oC and then centrifuged for 15 min. at 1000 rpm. The supernatant was collected and 1 mL Nessler's reagent was added to 1 mL of supernatant collected and then final volume was made up to 10 mL by adding distilled water. Brown/ yellow color was developed and absorbance was measured spectrophotometrically at 630 nm. The amount of ammonia was estimated by relating with the standard curve of ammonium sulphate in the range of 0.1-1 mol/mL (Demutskaya and Kalinichenko, 2010). Then nitrogen source peptone was replaced by yeast extract (at 0.5, 1 and 1.5%) and incubations of 48, 96 and 144 h.

For hydrocyanic acid (HCN), the Baker and Schippers (1987) was followed in Kings B medium (King et al., 1954), supplemented with 4.4g/ L of glycine. HCN production was inferred with change in color of the filter paper previously dipped in 2% sodium carbonate prepared in 0.05% picric acid, it was rated visually depending upon the intensity of color change from yellow to dark brown. For quantitative assay by hanging method (sadasivam et al., 1992) the bacteria was grown in King's B broth amended with glycine (4.4 g/L) and uniform strips of filter paper (10 x 0.5 [cm.sup.2]) were soaked in alkaline picrate solution and kept hanging inside the conical flask. After incubation at 28+2 [degrees]C for 48 h, the sodium picrate in the filter paper was reduced to reddish compound in fraction to the amount of HCN evolved. The color evaluation was done by placing the filter paper in a test tube containing 10 mL distilled water and the absorbance of this colored water was read at 625 nm.

Siderophore estimation using Chrome-azurol-S (CAS) liquid assay method (Schwan and Neilands, 1987)

In this method 0.1mL of cell free extract of supernatant was mixed with 0.5 mL Chrome-azurolS (CAS) solution along with 10 [micro]L of shuttle solution (0.2 M 5-Sulfosalicylic acid). It was kept at room temperature for ten minutes and absorbance was recorded at 630 nm. The minimal media was used as a blank and the reference (r) was prepared using exactly the same components except the cell free extract of culture supernatant. The siderophore units were calculated using formula:

Percent Siderophore unit = [A.sub.r]-[A.sub.s]/[A.sub.s] x 100

Where [A.sub.r] is the absorbance at 630 nm reference

[A.sub.s] is the absorbance at 630 nm of the test

Antifungal activity

In order to test the efficacy of Pseudomonas fluorescens strain smppsap5 as a potential antagonist (in vitro) against various root rot pathogens viz. Fusarium oxysporum, Fusarium solani, Fusarium amphidermatum, Dematophora necatrix. The assay for antagonism was performed on PDA on petri dishes by dual culture method (Zivkovic et al., 2010). The mycelial plugs (5 mm diameter) of pathogens and then on the same petri dish a loopful of bacteria was then streaked 3 cm away from the disc of the pathogens individually. Paired cultures were incubated at 25[degrees]C for 7 days. The experiment was repeated twice with four replications of each treatment. The percent growth inhibition was calculated using formula:

PGI (%) = KR-R1/KR x 100

Where KR represents the distance (measured in mm) from point of inoculation to the colony margin on the control dishes, and R1 the distance of fungal growth from the point of inoculation to the colony margin on the treated dishes in the direction of the antagonist.

Stress Tolerance

The bacterial isolate was grown at different temperatures and different PEG concentrations and temperature ranges as per the local climatic conditions to observe its ability to grow in possible extreme conditions of the zone.

Plant growth promoting effect of P. fluorescens strain smppsap5

Brown sarson seeds (variety Gulchan) were collected from seed processing unit SKUAST Kashmir and surface sterilized with NaOCl (5%) and washed by autoclaved distilled water. The sterilized seeds were sown (after dipped in tryptic soy broth containing 3 days old Pseudomonas fluorescens strain smppsap5 culture with 108 cfu/ mL but the control was dipped in TS broth without bacterial culture) in autoclaved plastic pots containing soil in a greenhouse at 23+2[degrees]C. The isolated bacterial strain P. fluorescens strain smppsap5 was inoculated in the pots (with 108 cfu/ mL) after 3 week interval from the date of sowing. The shoot length, root length, plant nutrient status and other yield attributes were measured at the time of harvesting of the crop. The germination percentage and chlorophyll content was determined as per the procedure adopted by Padder et al. (2015).

Effect on soil physio-chemical and biological properties

Various physical and chemical properties of the soil were determined by adopting standard procedures outlined in Jackson (1973), soil nutrient status was determined by adopting various procedures viz. available nitrogen by Subbiah and Asija (1956), available forms of phosphorus, potassium, calcium, magnesium, by Jackson (1973), available Sulphur by Che-Chesnien and Yien (1951), available micronutrients by Lindsay and Norwell (1978).

Soil enzymatic activities

Dehydrogenase activity (DHA) in soil was determined, using the reduction of 2,3,5-triphenyltertrazolium chloride (3%) method (Klein et al, 1971), and the color intensity was measured at 485 nm. The method used for estimating urease activity (URE), involved incubating the soil with an aqueous urea solution (2%), and the residual urea was determined colorimetrically at 527 nm, described by Bremner and Douglas (1971). Phosphatase activity was determined following the method reported by Tabatabai and Bremner (1969), after soil incubation with modified universal buffer, and the produced color intensity was measured colorimetrically at 440 nm. Amidase activity of the inoculated soil was determined by using a modification of the method given by Frankenberger and Tabatabai (1980) in which the inoculated soil was exposed to toluene. Ten milliliters of THAM (tris (hydroxymethyl) amino methane buffer (0.1M pH 8.5) was added to the assay mixture and incubated at 37[degrees]C for 24 hours. Protease activity was determined by the modified method of Ladd and buttler (1972) in which the wet soil was incubated with 0.05M Tris-HCl buffer and 1% casein for a period of 2h. Cellulase activity was determined by the method of Hope and burns (1987), which measures glucose as the final product of cellulose metabolism, which was quantified by dinitrosalicylic acid method (Miller et al., 1960). Xylanase activity was assayed using 1% oat spelt xylan as the substrate as described by Baily et al., (1992) and glucose content was quantified in the same way as in case of cellulase activity determination.

Statistical Analysis

The experiment was arranged in randomized block design and analysis was performed using SPSS software. The mean values were compared at p [less than or equal to] 0.05.

RESULTS AND DISCUSSION

Bacterial endophytes ubiquitously colonize the internal tissues of plants, being found in nearly every plant worldwide and promote the growth of plants (Santoyo et al., 2016). Pseudomonas fluorescens has widely been observed to be an efficient phosphate solubilizer (Yadav et al., 2016). In the current study, the plant growth promoting endophytic bacterial isolate P fluorescens strain smppsap5 was selected among 31 phosphate solubilizers and 81 bacterial endophytes of brown sarson roots. Among all the phosphate solubilizers the solubilization index was observed to be as low as 1.17 in SB39 and as high as 3.19 in strain smppsap5 and phosphate released in liquid assay varied from 37 in SB80 to 313.58 mg/ L in strain smppsap5 (Fig. 1). While documenting the behavior of P fluorescens towards phosphate solubilization Yadav et al. (2016) observed the solubilization index of P fluorescens strain PSM1 to be equivalent to 3.24 but contrary to our findings peak phosphate solubilization in liquid assay was observed to be very less (8 mg/L). But endophytic bacterial strain BC-52 produced 400 mg/L phosphate in liquid assay as reported by Lins et al. (2014) which is almost similar to our findings. Release of P from mineral phosphate is related to the levels of organic acids produced mainly the gluconc acid (Lugtenberg and Kamilova 2009). In fluorescent pseudomonads, gluconic acid production is catalyzed by periplasmic oxidation of glucose by membrane-bound glucose dehydrogenase and its cofactor, pyrroloquinoline quinone (Meyer et al., 2011). Among all the isolates P. fluorescens strain smppsap5 with highest solubilization index of and ability to release phosphate in liquid assay was selected its sequence matched accurately with P. fluorescens. The sequence of smppsap5 was submitted to NCBI GenBank and was assigned Accession No. KU883600. The result of phylogenetic analysis revealed that bacterial isolate smppsap5 was identified as P. fluorescens on the basis of sequence similarity (Fig.a).

Morphological, biochemical and physiological characteristics of P. fluorescens strain smppsap5

The isolate strain smppsap5 was characterized morphologically, biochemically and physiologically based on various tests (Table 1).

Phosphate solubilization at different incubations and various nitrogen sources on phosphate solubilization from tri-calcium phosphate

The endophytic bacterial isolate P. fluorescens strain smppsap5 containing 1* 108 CFU/mL ([much greater than] 625 nm) were inoculated into Pikovskaya's broth with different nitrogen sources (Tryptone, peptone, NaN[O.sub.3], casein, urea and incubated for 24, 48, 72 and 96 h at 28+2 oC. It was observed that P. fluorescens strain smppsap5 caused maximum solubilization at 72 h incubation (Fig. 2) and with casein as nitrogen source (Fig. 3), beyond this incubation period the solubility decreased. Contrary to our findings Yadav et al. (2016) found maximum phosphate solubilization by P. fluorescens at 144 h incubation the possible reason may be that they carried the experiment at different set of pH. But similar to our findings Song et al. (2008) observed the maximum phosphate solubilization at 72 h incubation in Burkholderia cepacia DA23. Effect of nitrogen sources and incubation period on phosphate solubilization has been studied widely. Sagervanshi et al. (2012) observed that among various nitrogen sources the broth with casein as a nitrogen source has the maximum soluble phosphate.

Indole-3-acetic acid (IAA) production

To investigate the effect of incubation period and L-tryptophan concentration on IAA production, the samples were drawn at an interval of 48 h up to 144 h. The data obtained suggests that there was maximum IAA production (27.33 [micro]g/ mL) at 96 h incubation and 28.78 pg/mL at 0.2 mg/ mL L-tryptophan (Fig. 4). Our results are in agreement with the findings of Bharucha et al. (2013) who worked on impact of L-tryptophan concentration and incubation period on IAA production by Pseudomonas putida UB1 and observed that L-tryptophan stimulated the auxin biosynthesis. As per our studies, L-tryptophan concentrations used (ranging from 0.05 to 0.25 mg/ mL) which resulted in increase in IAA production and 0.2 mg/mL L-tryptophan concentration resulted in maximum IAA production.

Production of ammonia and hydrocyanic acid

Ammonia production by P. fluorescens strain smppsap5 was observed to be equivalent to 66.16 [micro]g/mL of ammonia in peptone water containing 1% peptone similar to our findings Nimnoi et al (2010) also reported the production of 20 to 60 mg/mL ammonia by root endophytic bacteria and when peptone was replaced by yeast extract the ammonia produced varied from 41.41, 50.04, and 38.88 [micro]g/mL ammonia at 0.5, 1, 1.5% yeast extract concentrations respectively indicating that yeast extract although at very low concentrations compared to peptone is metabolized by the bacteria to produce ammonia but beyond 1% concentration the yield of the ammonia reduces. When the experiment with yeast extract was conducted at different incubations the isolate produced 36.23, 50.35 and 43.84 [micro]g/mL ammonia at 48, 96 and 144 h incubations respectively (Table 2). Thus with yeast extract as nitrogen source the incubation of 96 h and concentration of 1% produced the highest ammonia ([micro]g/mL). Mishra et al (2010) also observed P. fluorescens to be the efficient ammonia producer. Our findings are also supported by Sharma and Saharan (2015) who also reported highest ammonia production at 96 h incubation, but the optimization with different nitrogen sources is not reported yet.

Hydrocyanic acid (HCN), a volatile metabolite is well known for its role against various pathogens thus plays a vital role in biological control of various plant pathogens and P. fluorescens has widely been observed to produce hydrocyanic acid (Schippers, 1988) and hence exposing plants to the volatile metabolites of antagonism causes a prominent increase in peroxidase activity, which may contribute induction of disease resistance. In quantitative estimation, P. fluorescens strain smppsap5 recorded the absorbance of 0.109. Similar to our findings Lukkani and Reddy (2014) also reported the production of hydrocyanic acid by P. fluorescens in the same absorbance range.

Siderophore production

Siderophores are an important tool of various bacterial isolates by which they bring about the iron starvation of pathogens and as a result is an important tool in the biological control of plant diseases. The root endophyte P. fluorescens strain smppsap5 was recorded to produce a zone of 13.50 mm and percent siderophore produced was recorded to be 10.22%. Shobha and Kumudhini (2012) also reported that Pseudomonas sp. is an efficient siderophore producer and they observed that Bacillus isolate JUMB7 produces 10% siderophores, which is similar to our findings. Pal et al. (2010) also reported that Klebsiella sp. produced 3.22% and 11.99%, which falls under the range of our observations. Kaushal and Kaushal (2013) also reported that isolate MK7 produced the zone of 13.33 mm which is same to our findings.

Antifungal activity

Bacterial plant growth promotion is a well-established and complex phenomenon and is often achieved by various plant growth promoting traits exhibited by the associated bacterium, such as antagonism against phytopathogenic fungi (Haas and Defago 2005). The isolate Pseudomonas fluorescens strain smppsap5 characterized for antifungal activity against various pathogens viz. Fusarium oxysporum, Fusarium solani, Dematophora necatrix and Pythium amphanidermatum. It was observed that the strain smppsap5 showed antifungal activity against Fusarium solani only, the inhibition zone was observed to be 43.25 [+ or -] 0.47 and percent growth inhibition of 37.31 [+ or -] 0.69 (Table 3). Jenifer et al. (2013) also observed that Pseudomonas fluorescens causes an inhibition of Fusarium sp. by 38.1% but not against Aspergillus niger which is similar to our findings. Sagahon et al., (2011) also reported that Pseudomonas fluorescens showed antifungal activity against phytopathogens. Microbial production of extracellular metabolites like HCN has been demonstrated to contribute to biocontrol of root pathogens (Haas and Defago 2005). It has newly been reported that inorganic phosphate solubilization potential of pseudomonads is often combined with the production of other metabolites taking part in the biological control of soil-borne phytopathogens (Jha et al.2009). Our results indicate that the inhibition of the phytopathogens by Pseudomonas fluorescens strain smppsap5 could be as a result of the ammonia toxicity brought about in the fugal pathogen niches by the bacterial isolate as it produces 66.16 pg/mL ammonia under in vitro conditions and even the isolate has considerable siderophore and HCN activity which could also aid it to bring about the iron starvation for pathogenic fungi or their toxicity respectively.

Stress tolerance

As J&K is a geographical area with extreme climatic conditions, both temperature and water are the challenges during harsh climatic conditions, therefore the bio inoculant isolated need to be tolerant to such conditions. With this intention the drought tolerance of Pseudomonas fluorescens strain smppsap5 was observed by recording the absorbance (at 600 nm) at 0, 5, 10, 15, 20 and 25% Polyethylene glycol (PEG 6000) and temperature tolerance was observed by recording the CFU/mL at 15, 25, 35 oC as during the Brown sarson growing season the temperature of the area falls in three ranges. It was observed that the strain smppsap5 tolerated the concentration of PEG up to 15% (Fig. 5) and hence can be classified to be moderately resistant to drought conditions. In the same way the strain smppsap5 grew at all the temperature ranges but showed maximum CFU/mL at 25[degrees]C equaling [Log.sub.10] 7.49 [+ or -] 1.29 with little less in other temperature ranges (Table 4), hence it can be concluded that the strain smppsap5 has better adaptability to a set of temperatures with least impact on CFU/mL.

Similar to our findings Marulanda et al. (2009) observed that various Pseudomonas sp. were resistant to drought stress induced by polyethylene glycol (PEG) although some of the strains showed reduced drought stress tolerance. Michiels et al. (1995) reported an increased synthesis of six heat shock proteins in heat-tolerant bacterial isolates at 45 0C, in context to our findings which may be one of the reason in maintaining the good CFU/mL even at high temperatures of 35 0C by an isolate Pseudomonas fluorescens strain smppsap5 isolated from a temperate climate where temperature usually does not go beyond 30[degrees]C.

Plant growth promoting effect of P. fluorescens strain smppsap5

The brown sarson plants were grown in a greenhouse for the evaluation of inoculation effects of P fluorescens strain smppsap5 on their growth. The uninoculated plants were recorded to have low growth rate compared to the plants inoculated with strain smppsap5 in terms of germination percentage, chlorophyll content, plant nutrient uptake and yield attributes like number of primary/ secondary branches, no. and length of siliqua, no of seeds per siliqua and oil content of the seeds (Table 5).

Ardebili et al. (2011) reported that the beneficial effect of P fluorescens CHAO on plant growth enhancement in tomato and observed that bacterial inoculation caused significant growth compared to control. Endophytic microorganisms are able to enhance plant growth through various mechanisms, such as production of plant hormones and antimicrobial metabolites, as well as to provide the soil with nutrients (Lins et al., 2014). Hoon et al. (2007) reported that the beneficial effect of Pseudomonas sp. on plant growth of pepper and observed an enhanced nutrient uptake and overall yield. Overbeek and Elsas (2008) reported that endophytic bacteria are more often capable of triggering physiological changes that promote the growth and development of the plants. Shi et al. (2009) found significant increase in various plant growth parameters compared with control after inoculating selected endophytic bacterial isolates obtained from beet roots. Supporting our findings, Muthukumar et al. (2010) found increased germination percentage and other yield parameters of chilli when inoculated with bacterial root endophyte P. fluorescens. The bacterial strains of P. fluorescens have been reported to increase the growth, yield and germination percentage in maize (Noumavo et al., 2013) and hence supporting our findings. Similar to our investigation, Padder et al. (2015) reported that Pseudomonas sp. isolates cause increased chlorophyll, carotenoid and other growth parameters. In the same way Jog et al. (2014) also reported the increased no. of yield attributes with respect to uninoculated control upon bacterial inoculation which also testifies our findings. This may be as a result of the secretion of some beneficial metabolites by inoculated bacteria or their impact on changed indigenous microbial population in the soil. In general, plant inoculation with P. fluorescens strain showed positive effects on brown sarson growth and yield. Differences obtained with the control can be attributed to nutrients being available from the insoluble sources. Thus inoculation with phosphate solubilizing P. fluorescens strain smppsap5 made more soluble phosphates available to the growing plants. This may be the reason for improved growth and yield of the host plants. Many bacteria (Rodriguez and Fraga, 1999) are able to promote plant growth by solubilizing sparingly soluble inorganic phosphates in the soil. Moreover P. fluorescens strains are considered to be good plant growth promoters through the production of growth-stimulating hormones (Schorth and Hancock, 1982) and this could be one of the reason to have affected growth, nutrient uptake and finally the yield. Enhancement of yield in numerous crops due to involvement of indirect biocontrol activities of P. fluorescens (ammonia, HCN, siderophore etc.) is well documented (Levenfors et al. 2008; Kumar et al. 2009). Several fluorescent and nonfluorescent strains have been found to increase yield in crops such as potato (Frommel et al. 1991), spring wheat (Kropp et al. 1996) and cereals (Validov et al. 2009). The both micro as well as macro nutrient content of plants increased upon inoculation when compared to uninoculated control. Similarly in comparison to control the available nutrient was high in the soil inoculated with strain smppsap5 (Table 6).

Measurements of soil enzymatic activities has been used as an indicator of the effect of soil manipulations (Naseby and Lynch, 1998) and may be very much important for gaining a better understanding of the nature of the perturbations caused to ecosystem function after microbial inoculations. Soil enzyme assessment has also been used as an indicator carbon leakage from the host plant roots (Naseby et al., 1999). In the present study the soil enzymatic activity increased upon inoculation (Table 7). So, the changes observed in the present study suggest a direct effect of bacterial isolate inoculated, as well as indirect effect through changes in microbial composition in the rhizospheric soil. Rana et al. (2015) reported that endophytic bacterial inoculation increased N, P uptake by plants besides microbial biomass carbon and soil biological properties like dehydrogenase activity, alkaline phosphatase activity etc. over uninoculated control. There may be many reasons behind it but the measure reason seems to be the increase in bacterial population inside the soil as a result of inoculation and hence all the dead organic matter gets metabolized to form cell constituents besides release of minerals from their respective sources. Similarly Dutta and Neog (2015) observed increased phosphatase, dehydrogenase and urease activity besides soil carbon content upon bacterial inoculation. Hassan and Bano (2015) reported that inoculation of Pseudomonas sp. in wheat resulted in increased grain yield, N, P, Ca, and K content availability in soil and total content in plant respectively. The bacterial inoculants of Pseudomonas fluorescent sp. are among the most important plant growth promotors through a number of mechanisms (Glick et al., 2007). Some species are known to provide plants with required nutrients like nitrogen, phosphorus, iron etc. (Sexana and Tilak, 1989). El-Ghany et al. (2010) reported that bacterial inoculations improve the soil physical properties like EC, bulk density, pH etc. are improved by organic matter degradation products, Microbial gums produced (EPS) and root growth promoting substances enhance soil aggregation process, subsequently soil penetrability resistance decreases. The net result is less cohesion relation to adhesion forces between soil particles, which is in complete synchronization with our findings.

CONCLUSIONS

The summarized findings of the present study on P-mobilizing potential and plant growth promoting traits of Pseudomonas fluorescens strain smppsap5 suggests that there are efficient phosphate solubilizers already adapted to agricultural soils and agro-climatic conditions with excellent potential to be used as bio-inoculants. The production of hydrogen cyanide, ammonia and siderophores etc. by the strain prompts us to consider these strains as putative biocontrol agents. These abilities of Pseudomonas fluorescens strain smppsap5 need to be subjected to further studies on the behavior with various carriers and concentration of the formulations to be used under field conditions.

ACKNOWLEDGEMENTS

The facilities and financial assistance by SKUAST Kashmir Srinagar in carrying out this research is highly acknowledged

REFERENCES

(1.) Chebotar, V.K., Malfanova, A., Shcherbakov, A.V., Ahtemova, G.A., Borisov, A.Y., Lugtenberg, B. and Tikhonovich, I.A. Endophytic bacteria in microbial preparations that improve plant development. Applied Biochemistry and Microbiology, 2015; 51(3):271-277.

(2.) Coutinho, B,G., Licastro, D., Mendone, apreviato, L., Camara, M., Venturi, V. Plant influenced gene expression in the rice endophyte Burkholderiakururiensis M130. Molec. Plant Microbe Interact, 2015; 2:10-21.

(3.) Miller, S.H., Browne, P., Prigent-Cambaret, C., Combes-Meynet, E., Morrissey, j.P., and O'Gara. Biochemical and genomic comparison of inorganic phosphate solubilisation in Pseudomonas species. ENVIRON. Mcrobial, 2010; 2:403-411.

(4.) Daniels, C., Michan, C., and Ramos, J.L. New molecular tools for enhancing methane production, explaining thermodynamically limited lifestyles and other important biotechnological issues. Microb. Biotechnol, 2009; 2:533-536.

(5.) Sharma, S.B., Sayyed, R.Z., Trivedi, M.H., and Gobi, T.A. Phosphate solubilizing microbes: sustainable approach for managing phosphorus deficiency in agricultural soils. Springerplus, 2013; 2:587.

(6.) Cordell, D., Drangert, J.O., and White, S. The story of phosphorus: global food security and food for thought. Glob. Environ. Change, 2009; 19:292-305.

(7.) Young, L.S., Hameed A., Peng S.Y., Shan Y.H, Wu S.P., Endophytic establishment of the soil isolate Burkhoderia sp. CC-A174 enhances growth and p-solubilisation rate in maize (Zea mays L.) Applied Soil ecology, 2013; 66: 40-47.

(8.) Oteino, N. Lally RD., Kiwanuka S., Lloyd, A., Ryan D., Germaine KJ., and Dowling DN. plant growth promotion induced by phosphate solubilising endophtyic Pseudomonas isolates. Front Microbial, 2015; 6:745.

(9.) Carroll, H., Moe nne-loccoz, Y, Dowling DN, O'G. F. Mutational disruption of the biosynthesis genes coding for the anti-fungal metabolite 2,4-diacetylphloroglucinol does not influence the ecological fitness of Pseudomonas fluorescens.F 113 in the rhizosphere of sugarbeets. Appl Environ Micrbiol, 1995; 61:3002-3007.

(10.) Kumar, V., Kumar, A., Pandey, K.D., Roy, BK. Isolation and characterization of bacterial endophytes from the roots of Cassia tora L. Ann Microbial, 2015; 65:1391-1399.

(11.) Doyle, J.J., and Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry Bulletin, 1987; 19:11-15.

(12.) Doyle, J.J., and Dickson.E.E. Preservation of plant samples for DNA restriction endonuclease analysis. Taxon, 1987; 36:715-722.

(13.) Culings, K.W. Design and testing of a plant specific PCR primer for ecological and evolutionary studies. Molecular Ecology, 1992; 1:233-240.

(14.) Lukow, T., Dunfield, P.F., and Liesack, W. Use of the t-RFLP technique to assess spatial and temporal changes in the bacterial community structure within an agricultural soil planted with transgenic and non-transgenic potato plants. FEMS Microbial. Ecol, 2000; 32:241-247.

(15.) Pikovskaya R I. Mobilization of phosphorus in soil in connection with the vital activity of some microbial species. Mikrobiologiya, 1948; 7: 362-370.

(16.) Edi-Premono M.A, Moawad and Vleck P.L.G. Effect of phosphate solubilizing Pseudomonas putida on the growth of maize and its survival in the rhizosphere. Indonasian Journal of Crop Science, 1996; 11: 13-23.

(17.) Bray R.H and Kartz L.T. Determination of total organic and available forms of phosphorus in soils. Soil Science, 1945; 59: 39-45.

(18.) Tang, Y.W. and Bonner, J. The enzymatic inactivation of IAA. Some characteristics of the enzyme contained in pea seedlings. Arch. Biochem, 1974; 13: 11-25.

(19.) Cappuccino, J., and Sherman, N., Microbiolgy: A laboratory Manual. Benjamin Cummings Publishing Company, USA, 2010; 560.

(20.) Demutskaya, L.N., and Kalinichenko, I.E., Photometric determination of ammonium nitrogen with the nessler reagent in drinking water after its chlorination. J. Water Chem. Tech, 2010; 32(2):90-94.

(21.) Baker P.D and Schippers. Microbial cyanide production in the rhizosphere in relation to potato yield production and Pseudomonas spp. mediated plant growth stimulation. Soil Biology and Biochemistry, 1987; 9: 451-457.

(22.) King, E.O, Ward, M.K. and Raney, D.E. Two simple media for the demonstration of Pyocyanin and fluorescin. Journal of Laboratory and Clinical Medicine, 1954; 36: 100-102.

(23.) Schwyn, B. and Neilands, J.B. Universal chemical assay for the detection and determination of siderophores. Analytical Biochemistry, 1987; 160: 47-56.

(24.) Zivkovic, V, Stojanovic, Z. and Ivanovic, Z. Screening of antagonistic activity of microorganisms against C. acutatum and C. gloeosporioides. Archeal Biololgical Sciences. 2010; 62(3): 611-623.

(25.) Padder, S.A., Bhat, Z.A., Shakeela, S. and Mukhtar, M. Biochemical Attributes of Efficient PGPR Bioinoculants and their Effect on Growth of Dalbergia sissoo (Roxb.). Journal of Pure and Applied Microbiology, 2015; 9(4):3193-3202.

(26.) Jackson, M.L. Soil chemical analysis. Prentice Hall of India, New Delhi 1967.

(27.) Subbiah, B. and G.L. Asija. A rapid procedure for estimation of available nitrogep in soils. Curr. Sci. 1956; 25(8).

(28.) Che-Chesnin, L. and Yien, C.H. Turbidimetric determination of available sulphate. Soil Science Society of America Proceedings, 1951; 15 : 149-151.

(29.) Lindsay, W.L.; Norvell, W.A. Development of a DTPA soil test for zinc, iron, manganese, and copper. Soil Science Society of America Journal, 1978; 42: 421-428.

(30.) Klein, D.A., Loh, T.C., Goulding, R.L. A rapid procedure to evaluate dehydrogenase activity of soils low in organic matter. Soil Biol. Biochem, 1971; 3, 385-387.

(31.) Bremner J.M, Douglas L.A. Inhibition of urease activity in soil. Soil Biol. Biochem, 1971; 3: 299-307.

(32.) Tabatabai, M.A., Bremner, J.M. Use of pnitrophenol phosphate for assay of soil phosphatase activity. Soil Biol. Biochem, 1969; 1: 301-307.

(33.) Ladd, J.N., Butler, H.A. Short-term assays of soil proteolytic enzyme activities using proteins and dipeptide derivatives as substrates. Soil Biology & Biochemistry, 1972; 4: 19-30.

(34.) Hope, C.F.A .,and Burns, R.G. Activity, origins and location of cellulose in a silt loam soil. Biol.Fert. Soils, 1987; 5:164-170.

(35.) Miller G.,Blum LR., Burton AI. Use of Dinitrosalisylic acid reagent for determination of reducing sugars. Anal Chem, 1960; 31:426-428.

(36.) Bailey, MJ., Bielpy, P., Poutanen, k. Interlaboratory testing of methods for assay of xylanases activity .J.Biotech, 1992; 25:257-270.

(37.) Santoyo, G., Moreno-Hagelsieb, G., Mosqueda, M. C.O. and Glick, B.R. Plant growth promoting bacterial endophytes. Microbiological Research, 2016; 183: 92-99.

(38.) Yadav, A., Kusum Y., Anupam, V. Phosphate solubilising activity of pseudomonas fluorescenes PSMI isolated from wheat rhizophere. Journal of Applied and Natural Science, 2016; 8(1):93-96.

(39.) Lins, M.R.C.R., Fontes J.M, Vasconcelos, N. M., Santos, D.M.S., Ferreira, O.E., Avevedo, J.L., Araujo, J.M., Lima, G.M.S. Plant growth promoting potential of endophytic bacteria isolated from cashew leaves. African journal of biotechnology, 2014; 13(33):3360-3365.

(40.) Lugtenberg, B.,Kamilova, F. Plant growth promoting rhizobacteria. Annu Rev Microbial, 2009; 63:541-556.

(41.) Song, O.R., Lee, S.J., Lee, Y.S., Lee, S.C., Kim, K.K. and Choi, Y.L. Solubilization of insoluble inorganic phosphate by Burkholderia cepacia DA23 isolated from cultivated soil. Brazazilian Journal of Microbiology, 2008; 39(1): 151-156.

(42.) Sagervanshi A, Kumari, P, Nagee, A., and Kumar, A. Media optimisation for inorganic phosphate solubilising bacteria isolated from anand agricultural soil. International journal of life sciences and pharma research, 2012; 2(3).

(43.) Nimnoi, P., Pongsilp, N., Lumyong, S. Endophytic actinomycetes isolated from Aquilaria crassna Pierre ex Lec and screening of plant growth promoter's production. World. Journal of Microbiolgy and Biotechnol, 2010; 26:193-203.

(44.) Mishra, R.K., Prakesh, O., Alam, M., and Dikshit, A. Influence of plant growth promoting rhizobacteria (PGPR) on the productivity of Pelargoniummm graveolens.Herit. Recent research in science and technology, 2010; 2(5), 53-57.

(45.) Sharma, N., and Saharan B.S. Role of Lysinibacillus sphaericus SNCh5. Bacterial strain as Bioinoculant for agriculture practice. Int J. Curr. Microbiol. App. Sci, 2015; 4(12):484-499.

(46.) Schippers, B. Biological control of pathogens with rhizobacteria. Phil. Trans. R. Soc. Lond. B, 1988; 318:283-293.

(47.) Lukani, N.J and Reddy, EC.S. Evaluation of plant growth promoting attributes and biocontrol potential of native fluorescent Pseudomonas spp. against aspergillus niger causing collar rot of ground nut. International journal of plant, animal and environmental sciences, 2014; 4(4):256-262.

(48.) Shoba, G. and Kumudin, B.S. Antagonistic effect of the newly isolated PGPR Bacillus spp. on Fusarium oxysporum. Int. Journal of Applied sciences and Engineering Research, 2012; 1:3.

(49.) Pal, R.B., Gokarn, K. Siderophores and pathogenecity of Microorganisms. J Biosci Tech, 2010; 1(3):127-134.

(50.) Kaushal, M., and Kaushal, R. Screening and characterization of rhizobacterial strains of Bacillus spp. isolated from rhizosphere of cauliflower (Brassica oleracea var. botrytis L.). African Journal of Microbiology Research, 2013; 7(17):1657-1663.

(51.) Haas, D., Defago, G. Biological control of soil-borne pathogens by fluorescent pseudomonads. Nat Rev Microbiol, 2005; 3:307-319.

(52.) Jenifer, M.R.A., Reena, A., Aysha, S.O., Valli, S., Nirmala, P., and Kumar, V.P. Isolation of siderophore producing bacteria from rhizosphere soil and their antagonistic activity against selected fungal plant pathogens. Int. J. Curr. Microbial. App.Sci, 2013; 2(1):59-65.

(53.) Sagahon, I P., Anducho-Reyes, M.A., Silva-Rojas, H.V, Arana-Cuenca, A. Isolation of bacteria with antifungal activity against the Phytopathogenic Fungi Stenocarpell amaydis and Stenocarpella macrospora. International Journal of Molecular Science, 2011; 12:5522-5537.

(54.) Jha B, Gandhi., Pragash, M., Cletus, J., Raman, G., Sakthivel, N. Simultaneous phosphate solubilisation potential and anti fungal activity of new fluorescent pseudomonad strains, Pseudomonas aeruginosa, P.plecossicida and P. mosselii. W J Microbiol Biotech, 2009; 25:573-581.

(55.) Marulanda, A. E., Jose-Miguel, B., A Rosario, Azco'n. Stimulation of plant growth and drought Tolerance by native Microorganisms (AM Fungi ana Bacteria) from Dry Environments: Mechanisms related to Bacterial Effectiveness. J Plant Growth regul, 2009; 28:115-124.

(56.) Michiels, F., Habets, G.G., Stam, J.C., van der Kammen, R.A., & Collard, J.G. A role for Rac in Tiaml-induced membrane ruffling and invasion 1995.

(57.) Ardebili, Z.O., Ardebili, N.O. and Hamdi, S.M.M. Physiological effects of Pseudomonas fluorescens CHA0 on tomato (Lycopersicon esculentum Mill.) plants and its possible impact on Fusarium oxysporum f. sp. Lycopersici. Australian Journal of Crop Science, 2011; 5(12):1631-1638.

(58.) Lins, M.R.C.R., Fontes, J.M., Vasconcelos, N.M., Santos, D.M.S., Azevado, J.L., Araujo, J.M. and Lim, G.M.S. Plant growth promoting potential of endophytic bacteria isolated from cashew leaves.African journal of Biotechnology, 2014; 13(33):3360-3365.

(59.) Hoon, k.s., hyun-soo, C., hoon cheongl, choongmin, R. Two Bacterial Entophytes Eliciting Both Plant Growth Promotion and Plant Defense on Pepper (Capsicum annum L.). J.MIcrobiol. Biotechnol, 2007; 17:96-103.

(60.) Overbeek, L. and Elsas, J.D. Effects of plant genotype and growth stage on the structure of bacterial communities associated with potato (Solanum tuberosum L.). FEMS Microbiol Ecol, 2008; 64:283-96.

(61.) Shi, Y., Lou, K. and Li, C. Promotion of plant growth by phytoharmone-producing endophytic microbes of sugar beet. Biol. Fertil.Soils, 2009; 45:645-653.

(62.) Muthukumar, A., Bhaskaran, R. and Sanjeevkumar, K. Efficiency of endophytic Pseudomonas fluorescens migula against chilli damping-off. Journal of Biopesticides, 2010; 3(1): 105-109.

(63.) Noumavo P.A., Emeric, K., Yedeou, O. D., Adolphe, A., Marcellin, A., Rachidatou, S., Emma W. Gachomo., Simeon, O. K., Lamine, Baba-Moussal. Effect of Different Plant Growth Promoting Rhizobacteria on Maize seed Germination and seedling Development. American journal of plant sciences, 2013; 4:1013-1021.

(64.) Jog. R, M. P., Kumar.N.G., and Shalini Raj kumar. Mechanism of phosphate solubilisation and anti-fungal activity of Streptomyces spp. Isolated from roots and rhizosphere and their application in improving plant growth Microbiology, 2014; 160:778-788.

(65.) Rodriguez, H., Fraga, R. Phosphate solubilising bacteria and their role in plant growth promotion. Biotechnology Advances, 1999; 17:319-339.

(66.) Schroth, MN., Hancock, JG. Diseases suppressive soil and root colonizing bacteria.sci, 1982; 216:1376-1381.

(67.) Levenfors, J.p., Eberhard, T.H., Levenfors, J. J., Gerhardson, B., and Hokeberg, M. Biological control of snow mould (Microdochium nivale) in winter cereals by Pseudomonas brassicacearum, MA 250.Biocontrol, 2008, 53:651-665.

(68.) Kumar, S., Pandey, P., and Maheshwari, D.K. Reduction in dose of chemical fertilizers and growth enhancement of sesame (Sesamum indicum L.) with application of rhizosphere competent Pseudomonas aeruginosa LES4. European J Soil biol, 2009; 45, 334-340.

(69.) Frommel, M.I., Nowal, J., and Lazarovitis, G. Growth enhancement and developmental modifications of invitro grown potato (Solanum tuberosum ssp.tuberosum). Plant physiology, 1991; 96:928-936.

(70.) Kropp, B.R., Thomas, E., Pounder, J.J., and Anderson, A.j. Increased emergence of spring wheat after inoculation with Pseudomonas chlororaphis isolate 2E3 under field and laboratory conditions..Biology and fertility of soils, 1996; 23:200-206.

(71.) Validov, S.Z., Kamilova, F., and Lugtenberg, J.J.B. Pseudomonas putida strain PCL 1760 controls tomato foot and root rot in stone wool under industrial conditions in a certified greenhouse. Biological Control, 2009; 48:6-11.

(72.) Naseby, D.C. and Lynch, J.M. Establishment and impact of Pseudomonas fluorescens genetically modified for lactose utilization and kanamycin resistance in the rhizosphere of pea. J Appl Microbiol, 1998; 84: 169-175.

(73.) Naseby, D.C., Pascual, J., Lynch, J.M. Carbon fractions in the rhizosphere of pea inoculated with 2,4 diacetyl-phloroglucinol producing and non-producing Pseudomonas fluorescens F113. J Appl Microbiol, 1999; 87: 173- 181.

(74.) Rana, M., Chandra, R., and Pareek, N. Coinoculation Effect of endophytic bacteria with Mesorhizobium sp. In Chickpea (Cicer arietinum L.) on Nodulation, yields, Nutrient uptake and soil biological properties, 2015; 63(4).

(75.) Dutta. C.S., and Neog, B. Effects of AM fungi and plant growth-promoting Rhizobacteria on enzymatic activities of soil under turmeric(Curcuma longa L.) Cultivation, 2015; 63(4).

(76.) Hassan, T.U., A, Banol. The stimulatory effects of L-tryptophan and plant growth promoting rhizobacteria (PGPR) on soil health and physiology of wheat. Journal of soil science and plant nutrition, 2015; 15(1):190-201.

(77.) Glick, B.R., Cheng, Z. Czarny, J. and Duan, J. Promotion of plant growth by ACC deaminase-producing soil bacteria. European Journal of Plant Pathology, 2007; 119:329-39.

(78.) Sexanan, A. K. and Tilak, K. V. B. R. Free living nitrogen fixers: their role in crop productivity. p. 25-46. In A. Verma (ed.), Microbes for health wealth and sustainable environment Malhotra. Publishing house, New Delhi, India.

(79.) El-Ghany, B.F., Arafa, A. M. R., El-Rahmany T. A. and El-Shazly, M. M. Effect of some microorganisms on soil properties and wheat production under North Sinsi Condition. Journal of Applied. Scientific Research, 2010; 4(5): 559-579.

Shahid Ahmad Padder, G.H. Dar, F.A. Mohiddin and M.D. Shah

Division of Plant Pathology, SKUAST Srinagar J&K 190025, India.

(Received: 09 May 2016; accepted: 23 July 2016)

* To whom all correspondence should be addressed.

E-mail: aafan.tavkeer@gmail.com

Caption: Fig. 1. Phylogenetic relationship of the endophytic Pseudomonas fluorescens strain smppsap5 isolated from brown sarson roots

Caption: Fig. 1. Phosphate solubilization (mg/l) activity of isolated cultures

Caption: Fig. 2. Phosphate solubilization by P. fluorescens strain smppsap5 at different incubations

Caption: Fig. 3. Effect of various nitrogen sources onphosphate solubilization from tri-calcium phosphate

Caption: Fig. 4. Effect of incubation period (a) and L-tryptophan concentration (b) on IAA production

Caption: Fig. 5. Growth of strain smppsap5 in terms of absorbance at 600 nm
Table 1. Morphological, physiological and biochemical characteristics
Pseudomonas fluorescens strain smppsap5

1. Colony morphology            2. Pigment production
Brown, entire, circular, flat   Negative

5. Bacterial arrangement        6. Endospore position
Singly                          No endospore

9. Voges Proskauer reaction     10. Citrate utilization
Negative                        Positive

13. H2S production              14. Starch hydrolysis
Negative                        Negative

17. Glucose catabolism          18. Galactose catabolism
Positive                        Positive

3. Gram reaction                4. Bacterial morphology
Negative                        Long rods

7. Indole production            8. Methyl red test
Negative                        Negative

11. Oxidase                     12. Catalase
Positive                        Positive

15. Cellulose hydrolysis        16. Acid production
Negative                        Positive

19. Maltose catabolism          20.Glycerol catabolism
Positive                        Positive

Table 2. Effect of yeast extract and incubation period on ammonia
production

Incubation period (hr.)           48      96      144     Mean
Yeast extract concentration (%)   0.5     1.0     1.5     0.5     1.0
Isolates
Strain smppsap5                   31.23   35.13   42.10   45.40   66.36

Incubation period (hr.)
Yeast extract concentration (%)   1.5     0.5     1.0     1.5
Isolates
Strain smppsap5                   39.29   47.61   48.65   35.26   43.44

C.D (p [less than or equal to] 0.05) Incubation period (A): 0.034;
Concentration (B): 0.034; Isolates (C) : 0.075 ; A X B: 0.058; A X C:
0.130; B X C: 0.130; A X B X C: 0.225

Table 3. Antifungal activity of Pseudomonas fluorescens strain
smppsap5 against Fusarium solani using dual culture technique

                            Antifungal activity (% growth inhibition)
Bacterial isolate                        Fusarium solani
Pseudomonas               Inhibition zone (mm)   Percentage inhibition
fluorescensstrain         43.25 [+ or -] 0.47    37.31 [+ or -] 0.69
  smppsap5

Table 4. Effect of Temperature on root endophytic bacterial
strain smppsap5 population dynamics

Microbial population:[Log.sub.10] (cfu/mL)

Pseudomonas                                Temperature
fluorescens strain smppsap5    15[degrees]C         25[degrees]C
                             7.38 [+ or -] 1.4   7.49 [+ or -] 1.29

Microbial population:[Log.sub.10] (cfu/mL)

Pseudomonas                     Temperature
fluorescens strain smppsap5     35[degrees]C
                             7.09 [+ or -] 0.57

Table 5. Plant growth promoting effect of P. fluorescens strain smppsap5

Treatment              Germnation         No. of
                       percentage        primary
                                         branches

Uninoculated control     83.12      2.25 [+ or -] 0.05
Inoculation with         88.32      4.25 [+ or -] 0.25
strain smppsap5
C.D (pd"0.05              2.54             0.71
C.V                       3.55            14.36

Treatment                    No. of               No. of
                           secondary              siliqua
                            branches             per plant

Uninoculated control   5.26 [+ or -] 0.25   201.5 [+ or -] 0.28
Inoculation with       7.25 [+ or -] 0.25   237.5 [+ or -] 0.28
strain smppsap5
C.D (pd"0.05                  0.71                 0.91
C.V                           7.20                 0.28

Treatment                    No. of              Siliqua
                             seeds                length
                          per siliqua              (cm)

Uninoculated control   10.5 [+ or -] 0.28   4.25 [+ or -] 0.29
Inoculation with       15.5 [+ or -] 0.28   5.37 [+ or -] 0.25
strain smppsap5
C.D (pd"0.05                  0.71                 0.07
C.V                           3.50                 0.96

Treatment                      Oil
                             content
                               (%)

Uninoculated control   21.04 [+ or -] 0.01
Inoculation with       27.12 [+ or -] 0.00
strain smppsap5
C.D (pd"0.05                  0.05
C.V                           0.15

Table 6. Effect on plant and soil nutrient status and soil
physiochemical and biological properties

Treatment                          Plant nutrient content (%)
                                  N                      P
Uninoculated control     1.34 [+ or -] 0.06      0.13 [+ or -] 0.01
Inoculation with         1.95 [+ or -] 0.14      0.24 [+ or -] 0.02
strain smppsap5
C.D (p [less than or     0.043                         0.004
  equal to] 0.05
C.V                      1.861                         1.702
Treatment                        Plant nutrient content (ppm)
                                  Zn                     Cu
Uninoculated control     22.38 [+ or -] 0.30     7.78 [+ or -] 0.08
Inoculation with         41.71 [+ or -] 0.18    14.96 [+ or -] 0.13
strain smppsap5
C.D (p [less than or     0.427                         0.266
  equal to] 0.05
C.V                      0.801                         1.369
Treatment                   Available soil nutrient content (ppm)
                                  N                      P
Uninoculated control     176.52 [+ or -] 0.10    6.75 [+ or -] 0.03
Inoculation with         197.40 [+ or -] 0.05   12.25 [+ or -] 0.03
strain smppsap5
C.D (p [less than or     0.164                         0.100
  equal to] 0.05
C.V                      0.060                         0.723

Treatment                      Available soil nutrient content (ppm)
                                  Zn                     Cu
Uninoculated control     1.27  [+ or -]  0.01   1.46  [+ or -]  0.01
Inoculation with         1.71  [+ or -]  0.03   1.85  [+ or -]  0.03
  strain smppsap5
C.D (p [less than or     0.054                         0.059
  equal to] 0.05
C.V                      2.341                         2.365

Treatment                          Plant nutrient content (%)
                                   K                      Ca
Uninoculated control      1.06 [+ or -] 0.00      1.22 [+ or -] 0.05
Inoculation with          1.33 [+ or -] 0.03      1.34 [+ or -] 0.16
strain smppsap5
C.D (p [less than or             0.037                   0.036
  equal to] 0.05
C.V                              2.017                   1.920
Treatment
                                  Fe                      Mn
Uninoculated control      81.59 [+ or -] 0.22     69.50 [+ or -] 0.16
Inoculation with         149.64 [+ or -] 0.23    105.28 [+ or -] 0.02
strain smppsap5
C.D (p [less than or             0.462                   0.521
  equal to] 0.05
C.V                              0.240                   0.380
Treatment                   Available soil nutrient content (ppm)
                                   K                      Ca
Uninoculated control      83.10 [+ or -] 0.07     12.54 [+ or -] 0.12
Inoculation with         102.12 [+ or -] 0.02     18.23 [+ or -] 0.02
strain smppsap5
C.D (p [less than or             0.145                   0.186
  equal to] 0.05
C.V                              0.106                   0.818

Treatment                      Available soil nutrient content (ppm)
                                  Fe                      Mn
Uninoculated control     54.34  [+ or -]  0.15   47.38  [+ or -] 0.25
Inoculation with         97.10  [+ or -]  0.24   84.20  [+ or -]  0.26
  strain smppsap5
C.D (p [less than or             0.064                   0.216
  equal to] 0.05
C.V                              0.056                   0.228

Treatment                          Plant nutrient content (%)
                                   Mg                      S
Uninoculated control       0.12 [+ or -] 0.01      0.21 [+ or -] 0.01
Inoculation with           0.19 [+ or -] 0.01      0.32 [+ or -] 0.01
strain smppsap5
C.D (p [less than or             0.020                   0.040
  equal to] 0.05
C.V                              7.946                   1.923
Treatment

Uninoculated control
Inoculation with
strain smppsap5
C.D (p [less than or
  equal to] 0.05
C.V
Treatment                   Available soil nutrient content (ppm)
                                   Mg                      S
Uninoculated control     1,931.20 [+ or -] 0.49   458.07 [+ or -] 0.45
Inoculation with          2,066.1 [+ or -] 0.0    489.35 [+ or -] 0.13
strain smppsap5
C.D (p [less than or             1.889                   1.137
  equal to] 0.05
C.V                              0.065                   0.165

Treatment

Uninoculated control
Inoculation with
  strain smppsap5
C.D (p [less than or
  equal to] 0.05
C.V

Table 7. Effect of inoculation on soil enzymatic activity

Treatments            Dehydrogenase          Protease
                    ([micro]g of TPF    ([micro]g tyrosine
                       [g.sup.-1]           [g.sup.-1]
                    soil [h.sup.-1]).   soil [h.sup.-1]).

Uninoculated             148.75               17.00
control
Inoculation with         208.00               37.00
strain smppsap5
C.D. (pd"0.05)            1.892               1.701
C.V.                      0.739               4.293

Treatments                 Phosphatase                 Cellulase
                    ([micro]g p-NP [g.sup.-1]   ([micro]g GE [g.sup.-1]
                        soil [h.sup.-1]).         soil 24[h.sup.-1]).

Uninoculated                  83.25                      173.5
control
Inoculation with             162.75                     194.00
strain smppsap5
C.D. (pd"0.05)                1.882                      1.295
C.V.                          1.164                      0.461

Treatments                 Xylanase                    Urease
                    ([micro]g GE [g.sup.-1]   (N[H.sup.4+]-N [g.sup.-1]
                      soil 24[h.sup.-1]).         soil [h.sup.-1]).

Uninoculated                146.25                      0.08
control
Inoculation with            196.00                      0.19
strain smppsap5
C.D. (pd"0.05)               1.713                      0.005
C.V.                         0.688                      2.223

Treatments                   Amidase
                    (N[H.sup.4+]-N [g.sup.-1]
                        soil [h.sup.-1]).

Uninoculated                  0.47
control
Inoculation with              0.95
strain smppsap5
C.D. (pd"0.05)                0.028
C.V.                          2.845
COPYRIGHT 2016 Oriental Scientific Publishing Company
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Padder, Shahid Ahmad; Dar, G.H.; Mohiddin, F.A.; Shah, M.D.
Publication:Journal of Pure and Applied Microbiology
Article Type:Report
Geographic Code:9INDI
Date:Sep 1, 2016
Words:9113
Previous Article:Tillage, irrigation levels and rice straw mulches effects on wheat productivity, soil aggregates and soil organic carbon dynamics after rice in sandy...
Next Article:Implications of genetic heterogeneity among cultivated genotypes for global food security in climate change era.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters