Printer Friendly

Characterization and analysis of the genetic variability of sweet passion fruit (Passiflora ligularis Juss.) in Colombia using microsatellite markers/Caracterizacion y analisis de la variabilidad genetica de la granadilla (Passiflora ligularis Juss.) en Colombia empleando marcadores microsatelites.

INTRODUCCION

La granadilla {Passiflora ligularis Juss.) es la segunda especie en importancia economica del genero Passiflora por poseer un fruto comestible y comercializado en mercados nacionales e internacionales. Esta especie es originaria de los Andes tropicales, desde Bolivia a Venezuela entre los 1.500 a 2.600m.s.n.m. (OCAMPO et al., 2007a), e introducida a otros paises como Mexico, Costa Rica, Kenia, Australia y Nueva Zelanda. La especie es diploide (2n=18) con flores hermafroditas y una polinizacion prevalentemente alogama (Snow; MACDOUGAL, 1992). El tipo de polinizacion es favorecida por la posicion de las anteras debajo del estigma y es realizada principalmente por abejorros de los generos Xylocopa sp. y Epicharis sp. (FRANCO et al., 2007). La abundancia de los polinizadores en los cultivos de granadilla puede incrementar la productividad y la variacion genetica debido al constante intercambio de polen entre plantas.

El principal productor a nivel mundial de granadilla es Colombia con 4.500 has cultivadas y una produccion aproximada de 55.000 t/ano, concentradas en los departamentos del Huila, Cundinamarcay Boyaca. El cultivo es grangenerador de empleos rurales (210jornales/h/ano)y contribuye sustancialmente a la economia campesina por su constante produccion y rentabilidad. Sin embargo, un factor limitante en el desarrollo del cultivo es el gran numero de plagas y enfermedades, con considerables efectos negativos sobre la produccion. Ademas, los parametros fitosanitarios en la produccion de material de siembra por parte de los viveros colombianos no son controlados y estrictos en su mayoria. Otro problema es la falta de programas de fitomejoramiento que pueden ofrecer a los productores cultivares de mayor calidad genetica y responder a los problemas adversos que afectan los cultivos de granadilla, como precocidad, rendimiento, y resistencia a plagas y enfermedades (Dasiops sp., Fusarium sp., y virus SMV).

La diversidad morfologica en formas y colores de las especies del genero Passiflora es muy amplia, tanto en las silvestres como las cultivadas (Ocampo et al., 2007a). En las especies comercializadas, como la granadilla, el maracuya (P. edulis f. flavicarpa Degener) y la gulupa (P. edulis f. edulis Sims) los productores llevan a cabo la seleccion masal o fenotipica de los mejores frutos de dos o tres plantas de alto rendimiento para establecer o renovar los nuevos cultivos en funcion de sus observaciones de un ideotipo impuesto por el mercado local o internacional (Ocampo et al., 2013). Esta practica de seleccion, puede contribuir con la reduccion de la variabilidad en los cultivos por depresion endogamica en las generaciones futuras. Sin embargo, el fenomeno de alogamia presente en la especie, la amplia distribucion geografica de los cultivos y el intercambio de semillas entre productores mantienenuna considerable variabilidad genetica en los materiales cultivados en Colombia. Por otro lado, el conocimiento de la diversidad genetica es de capital importancia para definir el valor potencial de los recursos geneticos, que permita implementar estrategias para el aprovechamiento, la conservacion y la utilizacion de la variabilidad intra e interespecifica de las poblaciones.

Los marcadores moleculares son una herramienta que permiten estudiar el polimorfismo o la variabilidad genetica en diferentes organismos, ya que pueden acceder directamente al genoma, permitiendo caracterizar y estimar las relaciones geneticas entre grupos de interes (SAMAGN et al., 2006). Los primeros estudios sobre variabilidad en Passiflora se llevaron a cabo con el uso de marcadores RAPD (FAJARDO et al., 1998; CROCHEMORE et al., 2003) y RFLPcpDNA (SANCHEZ et al., 1999) en especies de los subgeneros Passifiora, Tacsonia, Decaloba y Distephana. Sin embargo, el tamano y composicion de la muestra no permitieron una interpretacion a nivel inter e intraespecifica en los individuos. En contraste, Segura et al. (2002) y Ocampo et al. (2004) reportaron una alta variabilidad genetica entre y dentro de las principales especies cultivadas de Passiflora (P. edulis f. flavicarpa, P. ligularis, P. edulis f. edulis, P. tarminaiana Coppens & Barney, P. tripartitavar. mollissima Holm-Nielsen & Jorgensen, P. quadrangularis L., P. maliformis L. y P. alata Curtis) con el uso de marcadores AFLP, sugiriendo la existencia de una fuente de genes de interes en los genotipos evaluados.

Por otro lado, los marcadores microsatelites son considerados por diversos autores como la herramienta mas poderosa para estudios de genetica de poblaciones (BILLOTTE et al., 1999; KALIA et al., 2011) e identification de individuos estrechamente emparentados (OCAMPO et al., 2007b; GONCALVES-VIDIGAL; BENCHIMOL, 2011), ya que son muy polimorficos, presentan herencia mendeliana, son codominantes, faciles de analizar, repetitivos y altamente automatizables. A pesar de estas ventajas, existen pocos estudios sobre la diversidad en Passiflora con este tipo de marcadores y solo en las especies P. edulis f. flavicarpa (OLIVEIRA et al., 2005; SANTOS et al., 2011), P. alata (PADUA et al., 2005) y P. edulis f. edulis (ORTIZ et al., 2012) se han implementado. El uso de los microsatelites en la granadilla no han sido reportados, y los estudios con otros tipos de marcadores como AFLP (Ocampo et al., 2004), RAPD (AUKAR et al., 2004) y ncpGs (YOCKTENG et al., 2004) se han realizado especificamente para establecer las relaciones interespecificas en el genero Passiflora. Estos resultados no revelan con claridad una estructura genetica en la granadilla, debido a que los genotipos evaluados provienen de un mismo origen geografico y el tamano de la muestra limita la interpretacion a nivel intraespecifico.

En general, la informacion disponible sobre la variabilidad genetica en la granadilla es incipiente y no permite determinar las relaciones entre y dentro de accesiones de diferentes origenes. Ademas, el desconocimiento de la estructura genetica en la especie dificulta establecer las bases de un programa de seleccion y mejoramiento para la obtencion de cultivares mas productivos y tolerantes a problemas fitosanitarios. Por estas razones, esta investigacion tuvo como objetivo caracterizar y estudiar el nivel de variabilidad genetica presente en genotipos cultivados de granadilla (P. ligularis) provenientes de 10 departamentos colombianos mediante el uso de marcadores microsatelites.

MATERIALES Y METODOS

Material vegetal

Un total de 82 individuos representados por 41 accesiones provenientes de 10 departamentos fueron colectados en fincas de productores y presentados en la Tabla 1. La Coleccion Nacional de Granadilla esta localizada en la granja Tesorito de la Universidad de Caldas a 2.280 m.s.n.m (Manizales, Caldas) y cada accesion esta constituida por cinco individuos provenientes de semilla de polinizacion abierta de cultivos comerciales.

Extraccion de ADN

El ADN se extrajo de hojas jovenes provenientes de plantas de 24 meses de edad y empleando el metodo de extraccion vegetal reportado por Doyle y Doyle (1991). La cuantificacion se realizo por comparacion visual con ADN estandar de concentracion conocida (Hyperladder V Bioline, California U.S.A.), despues de una electroforesis en gel de agarosa al 1% (empleando un transiluminador UV.) y tenido conbromuro de etidio.

Amplification por PCR y electroforesis

El estudio fue llevado acabo con 10 microsatelites polimorficos aislados y caracterizados en el maracuya (P. edulis i.flavicarpa) por Oliveira et al. (2005). Igualmente, las condiciones de amplificacion via PCR fueron las reportadas para el maracuya por el mismo autor, con algunas modificaciones realizadas en la concentracion del Mg[Cl.sub.2], la Taq Polimerasa y las temperaturas de anillamiento. La PCR se realizo enuntermociclador de bloque TC9600-G MultiGene Gradient Thermal Cycler (Edison, NJ, USA) en un volumen final de 15 [micro]l. La mezcla de reaccion incluyo: 1X Tampon de PCR, 2 mM de Mg[Cl.sub.2], 0,2 [micro]M de dNTP's, 0,2 [micro]M de cada uno de los oligonulceotidos-primers, una unidad de Taq ADN polimerasa y 10 ng de ADN. El programa de la PCR incluyo una denaturacion de 5 min a 93[degrees]C, y seguidamente se realizaron 36 ciclos de 40 s a 94[degrees]C, 40 s a la temperatura de anillamiento de cada primer, entre 5256[degrees]C (Tabla 2) y 50 s de extension a 72[degrees]C, finalizando con una extension a 72[degrees]C por 5 min. Las amplificaciones se revelaron en una electroforesis de agarosa al 2,5% tenidos con bromuro de etidio, y los fragmentos posteriormente confirmados se revelaron en una electroforesis en geles de poliacrilamida al 8% y tenidos con nitrato de plata. Finalmente, los fragmentos revelados en los geles fueron registrados con la ayuda de una lampara de luz blanca (Hoefer Macro Vue Vis_45) y fotografiados con una camara digital (Nikon Coolpix S550, 10.0 Mp).

Analisis de datos

Las imagenes de los geles fueron codificadas como alelos (fragmentos) y el numero y peso se determinaron con la ayuda del software Vision Works LS. La riqueza alelica, frecuencia, heterocigosidad esperada (He) y observada (Ho), el contenido de informacion polimorfica (PIC) y el test de equilibrio de Hardy-Weinberg (HW) fueron calculados y ejecutados con el programa Genetix 4.05. Las relaciones entre individuos y la distancia genetica fueron estimadas con el coeficiente de Dice (1945) para cada locus. La matriz de similaridad fue empleada para el analisis factorial de correspondencia multiple (AFCM) y la construccion del dendograma por el metodo del vecino mas proximo neighbor joining (SAITOU y NEI, 1987) con las distancias de Sokal & Michener y valores de bootstrap de 1.000 replicas para evaluar la solidez del arbol. Estos analisis fueron llevados a cabo con la ayuda del programa genetico DARwin 6.

RESULTADOS

Analisis de los microsatelites SSR

El 50% de los marcadores evaluados y reportados por Oliveira et al. (2005) en maracuya presentaron amplificacion en los 82 individuos de granadilla estudiados. Los cinco marcadores seleccionados identificaron 66 alelos, con un rango entre 11 a 16 y un promedio de 12,2 por locus (Tabla 2). Los marcadores con mayor riqueza alelica fueron AY768786 ([(GTTGTG).sub.4]) y AY768785 ([(AG).sub.22]) con 16 y 14 alelos, y el peso promedio de cada alelo fue de 195,5 pares de bases y con rango de 84 a 307 pb. Entre el total de alelos se identificaron 7 unicos y 13 raros (frecuencia [less than or equal to] 0,060) con particular distribucion en las accesiones del Valle del Cauca (ValLig02, ValLig03, ValLig04, ValLig05), Boyaca (BoyLig01, BoyLig05), Caldas (CalLig01, CalLig02, CalLig06, CalLig07), Quindio (QuiLig01, QuiLig02), Tolima (TolLig01), Cundinamarca (CunLig06) y Putumayo (PutLig01).

En cuanto al contenido de informacion polimorfica (PIC), se encontraron valores superiores a 0,74 en cuatro de los cinco marcadores, el valor mas alto lo presento AY768786 con 0,90. El valor general de PIC para los cuatro marcadores mas polimorficos fue 0,84, y de acuerdo con Botstein et al. (1980) estos son altamente informativos ([greater than or equal to] 0,50). Por otra lado, el marcador AY768790 ((GT)7) presento el valor de PIC mas bajo (0,74), debido a que uno de los 11 alelos observados (151 pb) esta presente enla mayoria de los individuos de la poblacion con una frecuencia de 0,354.

Los indices de diversidad genetica evidencian un alto polimorfismo observado para los microsatetiles evaluados (Tabla 1). La heterocigocidad observada (Ho) y esperada (He) promedio fue de 0,98 y 0,96, y en la mayoria de los marcadores Ho fue superior, lo que sugiere un exceso de heterocigotos observados en la poblacion bajo condiciones de equilibrio de HardyWeinberg (HW). Por el contrario, en los marcadores AY768786 y AY768787 ([(TG).sub.8] T[(TA).sub.5]) la Ho es igual e inferior a la He, indicando que las frecuencias alelicas son estables de una generacion a otra o que hay una tendencia a la endogamia, respectivamente.

Por otro lado, los marcadores no presentaron diferencias significativas respecto a los valores de He segun las proporciones de HW. Las similitudes pueden estar asociadas al fenomeno de alogamia presente en la especie y podrian estar contribuyendo al aumento de variabilidad genetica en las poblaciones evaluadas.

Diversidad Genetica

El valor promedio de distancia genetica (DICE, 1945) total entre y dentro de la poblacion fue de 0,735, con valores que oscilaron desde 0,368 hasta 0,871 (Tabla 3). Las menores distancias se presentaron entre individuos de un mismo departamento, como es el caso de Putumayo (0,368) y Tolima (0,372). Encontraste, los departamentos que mostraron mayores distancias entre sus individuos fueron el Valle del Cauca (0,655) y Cundinamarca (0,595), a pesar de la poca distancia entre los cultivos. A nivel inter departamento, la distancia promedio alcanzo 0,741, y los menos similares con los demas fueron las accesiones de Boyaca (0,800), Valle de Cauca (0,790) y Putumayo (0,788). El nivel de distancia entre los individuos de cada departamento es mayor que dentro de ellos, lo que sugiere una elevada heterogeneidad y confirman la existencia de una alta variabilidad intraespecifica en la granadilla cultivada en Colombia.

Analisis de clasificacion--neighbor joining

Las accesiones se clasificaron por el metodo del vecino mas proximo y con distancias euclidianas, a partir de los cinco marcadores microsatelites polimorficos seleccionados. El arbol de clasificacion mostro tres grandes grupos principales mal soportados (bootstrap <50%), con una leve estructuracion geografica y una alta diferenciacion entre los individuos de una misma accesion (Figura 1). El primer grupo reune el mayor numero de individuos y esta compuesto por dos ramas principales, donde se encuentran las accesiones de Tolima (TolLig), Valle del Cauca (ValLig), Antioquia (AntLig), Huila (HuiLig) y Putumayo (PutLig) de manera dispersa. El grupo dos esta representado por dos ramas bien definidas y constituidas esencialmente por la mayoria de las accesiones de Caldas (CalLig) y Cundinamarca (CunLig) y algunos individuos de los departamentos de Risaralda (RisLig) y Huila (HuiLig). El grupo tres con 14 individuos es el mas pequeno y al igual que los otros aparecen dos ramas definidas, con prevalencia de las accesiones de Boyaca (BoyLig) y Quindio (QuiLig). Aunque muchas de las accesiones que se encuentran relativamente asociadas dentro de los grupos, los individuos que las componen pueden estar en ramas diferentes y a una distancia considerable entre ellas. En general, los marcadores microsatelites empleados permiten identificar una gran variabilidad genetica en las accesiones de granadilla estudiadas, la cual se ve reflejada por las diferencias entre las plantas de cada accesion. Ademas, la poca estructuracion geografica encontrada es el resultado de intercambio de semillas entre productores de diferentes departamentos y al tipo de reproduccion cruzada presente en la granadilla.

Analisis factorial de correspondencia multiple (AFCM)

En el desarrollo del AFCM fueron excluidos los alelos unicos y raros para evitar una mayor dispersion de los individuos que los poseen. Un total de cinco factores fueron identificados por el AFCM con un 39,17% de inercia total. La Figura 2 muestra la distribucion espacial de las accesiones en el plano principal y representa el 18,60% de inercial total. El analisis revela una fuerte dispersion de las accesiones y menos estructurada que el generado con el arbol de clasificacion (neighbor joining). Las pocas accesiones agrupadas que se pueden identificar se entre mezclan con otros departamentos, como es el caso de Tolima (TolLig), Antioquia (AntLig), Boyaca (BoyLig) y Valle del Cauca (ValLig). Las 41 accesiones de granadilla evaluadas se ubicaron de una forma dispersa en el plano principal sin estructuracion o agrupacion evidente entre los individuos de acuerdo al origen geografico. Estos resultados, dificultan la identificacion de grupos de genotipos diferenciados y al igual que la clasificacion arborea la distancia entre los individuos de una misma accesion es superior que entre ellas.

DISCUSION

Un set de cinco de diez marcadores microsatelites aislados y caracterizados en maracuya por Oliveira et al. (2005) presentaron polimorfismo en las 41 accesiones de granadilla evaluadas (Tabla 2). La efectividad de los marcadores alcanzo el 50% de transferibilidad en la granadilla y el numero de alelos observados fue superior (66) a los reportados en maracuya (35). Por el contrario, en Gulupa la transferibilidad de estos microsatelites fue del 47%, pero los alelos observados fueron monomorficos y no mostraron polimorfismo en los 60 individuos evaluados (ORTIZ et al., 2011). Las diferencias entre estos resultados, puede explicarse debido a que la granadilla presenta un grado de domesticacion mas incipiente que el maracuya y ademas la mayoria de los cultivos en Colombia han sido establecidos con semillas provenientes de plantas silvestre en las zonas donde se iniciaron los sistemas productivos como en Antioquia (Urrao) y el Quindio (Genova). Lo anterior sugiere que la granadilla cultivada presente un sindrome de domesticacion parcial, tal como ocurre en muchos frutales andinos (eg. mora, Rubus glaucus Benth; uchuva Physalis peruviana L; y tomate de arbol, Solanum betaceum Cav.), ya que la mayoria de estos pasaron de ser silvestres a cultivados en unos pocos anos (GEPTS, 2002).

La riqueza, frecuencia y el contenido de informacion polimorfica (PIC) de la mayoria de los alelos confirman que los marcadores evaluados son altamente informativos de acuerdo a los criterios de Botstein et al. (1980), el cual considera que debe tener valores superiores a 0,50. Ademas, el aumento de PIC esta relacionado con la distribucion y equilibrio de las frecuencias alelicas enlapoblacion (MISSIO et al., 2010), lo cual permite afirmar que los marcadores seleccionados son confiablesy efectivos para detectar diversidad genetica en genotipos de granadilla.

Los valores de heterocigosidad promedio observada (Ho= 0,98) y esperada (He= 0,96) muestran que el germoplasma evaluado de granadilla posee una elevada riqueza genetica (Tabla 2). Ademas, la presencia de 7 alelos unicos y de una serie de 13 alelos con baja frecuencia ([less than or equal to] 0,060), pueden considerarse como marcadores interesantes para la seleccion, caracterizaciony conservacion de genotipos diferenciados de granadilla. Porotro lado, el alto grado de alogamia asociado a la heterocigosis podria ser un mecanismo de supervivencia y adaptabilidad a condiciones ambientales cambiantes en los entornos naturales donde la especie es cultivada (LOBO, 2006), como el cambio climatico que esta afectando la agricultura mundial (VERMEULEN et al., 2012). Adicionalmente, esta variabilidad genetica observada se apoya en la plasticidad fenotipica de la especie, ya que tiene la capacidad de producir fenotipos diferentes para desarrollarse en nichos ecologicos especificos, como una respuesta de estabilidad en la interaccion genotipo x ambiente.

Estructura de la diversidad

El valor promedio de distancia genetica total en la poblacion fue de 0,735 y confirma una alta diversidad genetica en las 41 accesiones de granadilla evaluadas con poca estructura (Tabla 3). La clasificacion arborea (neighbor joining) muestra tres grandes grupos (Figura 1) con los valores de bootstrap bajos, indicando que la estructuracion de los grupos detectados no estan consolidados y pueden variar (EFRON, 1979). Por el contrario, las ramas internas estanbien soportadas (bootstrap [greater than or equal to] 50) y ratifican las agrupaciones entre algunas accesiones de un mismo departamento (eg. ValLig, TolLig y PutLig). Las relaciones entre los individuos en su mayoria es leve y no sigue un patron geografico de acuerdo al origen de cada accesion, lo cual se debe a que la distribucion de los alelos no es sistematica jerarquizada, a excepcion de las accesiones que presentan alelos unicos y raros. Esta inestabilidad, en la mayoria de los casos ocurre cuando algunos individuos en el momento de la agrupacion presentan valores de similaridad intermedia respecto a otros grupos, de modo que no son asignados a uno especifico y pueden pertenecer a varias ramas conformada (LAURENTIN, 2009).

El analisis factorial de correspondencia multiple (AFCM) presento resultados similares a los arrojados por la clasificacion arborea, pero en el primero las accesiones se localizan mas dispersas y no se evidencio un claro agrupamiento por regiones, con excepcion del departamento de Putumayo y algunas del Valle del Cauca (Figura 2). El conjunto de resultados de ambos analisis evidencian que las accesiones analizadas son muy heterogeneas geneticamente e indican que hay poca correspondencia con la distribucion geografica de las accesiones. En contraste, Ortiz et al., (2012) reportaron una alta homogeneidad genetica en materiales cultivados de gulupa (P. edulis f. edulis) en Colombia con marcadores AFLP, y sin una concordancia con la procedencia de las muestras analizadas por departamento o localidad.

En relacion a lo anterior, las accesiones de granadilla cultivadas en Colombia no han sido sometidas a un plan adecuado de seleccion, ya que los agricultores inconscientemente escogen los mejores frutos en cada cosecha sin tener en cuenta la polinizacion cruzada. Este tipo de seleccion fenotipica, solo permite conocer los atributos de los plantas madres, puesto que las semillas de los frutos cosechados constituyen familias de hermanos medios. En consecuencia, los cultivos presentan una degeneracion genetica de la diversidad en terminos de estructuracion y de una mayor susceptibilidad a problemas fitosanitarios, como la Mosca del Ovario (Dasiops sp.), la Secadera (Fusarium sp.) y la Virosis (Virus del mosaico de la soya--SMV) que cada vez estan afectando mas los cultivos e imponen tratamientos quimicos para su proteccion.

La variabilidad genetica encontrada en este estudio puede explicarse por la diferenciacion geografica de las accesiones de granadilla evaluadas, el flujo de polen entre diferentes genotipos de poblaciones cercanas y por la introduccion de materiales de otras localidades por parte de los agricultores. Esto concuerda con los resultados en otros frutales andinos por Morillo et al. (2005) en plantas de mora (Rubus glaucus), y lo reportado por Bonilla et al. (2008) enuchuva (Physalis peruviana), quienes argumentan que el polimorfismo genetico puede estar asociado con la naturaleza alogama de la especie, la cual tiende a favorecer la conservacion de un alto porcentaje de genotipos heterocigotos. Los resultados anteriores indican que los marcadores microsatelites son una herramienta poderosa para detectar variabilidad genetica respecto a los demas marcadores de ADN estudiados en granadilla.

Implicaciones en el mejoramiento genetico

Este estudio establece una alta variabilidad intraespecifica en los materiales cultivados de granadilla en Colombia. La informacion generada en esta investigacion es de fundamental importancia para los fitomejoradores, ya que establece la estructura genetica y diversidad en la granadilla cultivada como base para labusqueda de genotipos mas productivos y resistentes a problemas fitosanitarios (ZHOU et al., 2002). Para desarrollar una estrategia de mejoramiento genetico en la granadilla es necesario complementar la informacion de los marcadores moleculares con datos agromorfologicos de cada accesion, que permitan establecer la verdadera relacion entre las variantes fenotipicas y genotipicas. Ademas, las accesiones conciertas caracteristicas de calidad del fruto son fuente de clones y deben ser propuestas como base para la seleccion de genotipos superiores en la obtencion de cultivares mas precoces y productivos (LOBO, 2006), partiendo de procesos selectivos en poblaciones locales, con un enfoque en la participacion directa de los agricultores. El punto de partida en la estrategia de mejoramiento en la granadilla son las accesiones CunLig01, CunLig03, CunLig05, HuiLig07, QuiLig02, RisLig04 y TolLig02 (Tabla 1), ya que estas cumplen con los parametros fisicoquimicos requeridos por el mercado, como el peso fruto ([greater than or equal to] 120 g), el porcentaje de pulpa ([greater than or equal to] 50%) y los Brix ([greater than or equal to] 14,5). Sin embargo, estas accesiones deben ser evaluadas en campo y realizar ciclos de seleccion para fijar los caracteres de interes por medio de polinizaciones controladas para evitar el flujo de genes con genotipos no deseados. Adicionalmente, es importante incluir aquellos individuos que posean alelos unicos y raros para enriquecer el acervo genetico primario de las accesiones cultivadas como una estrategia para la conservacion y mejoramiento de los recursos geneticos en la especie. Lo anterior permitira la seleccion asistida por marcadores (SAM) de parentales con amplia distancia genetica cuantitativapara el desarrollo de hibridos per se con una alta heterosis en la generacion [F.sub.1]. Finalmente, este es el primer estudio de diversidad genetica en granadilla con el uso de marcadores microsatelites y propone esta tecnica como una herramienta eficaz en la caracterizacion de germoplasma de la especie, la cual debe ser complementada con estudios agromorfologicos que permitan establecer el grado variabilidad total.

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

CONCLUSIONES

La caracterizacion molecular con el uso de marcadores microsatelites permitio establecer que el germoplasma de granadilla evaluado en esta investigacion presento un alto grado de variabilidad genetica (0,735). Sin embargo, la distribucion de los individuos en los analisis de clasificacion arborea y factorial no siguenun parametro geografico definido en la mayoria de las accesiones.

El conjunto de resultados sugieren que los procesos de seleccion de los materiales de siembra, la polinizacion cruzada presente, el intercambio de semillas entre productores y una domesticacion incipiente han contribuido con la escaza estructuracion genetica de las accesiones evaluadas, reflej ada en la variabilidad intraespecifica detectada en los materiales cultivados de granadilla en Colombia.

http://dx.doi.org/10.1590/0100-2945-251/13

AGRADECIMIENTOS

Los autores agradecen el Ministerio de Agricultura y Desarrollo Rural de la Republica de Colombia (MADR) por el financiamiento de proyecto "Aprovechamiento de la diversidad del maracuya amarillo (P. edulis i.flavicarpa Degener), la gulupa (P. edulis f. edulis Sims) y la granadilla (P. ligularis Juss.) para mejorar y diversificar los sistemas de produccionen Colombia 074-2008L6772-3447". Ala direccionde Investigacion, Creatividad e Innovacion de la Universidad Jorge Tadeo Lozano por el apoyo en el desarrollo del Proyecto.

REFERENCIAS

BILLOTTE, N.; LAGODA, P.J.L.; RISTERUCCI, A.M.; BAURENS, C. Microsatellite-enriched libraries: applied methodology for the development of SSR markers in tropical crops. Fruits, Paris, v. 54, p.277-288, 1999.

BONILLA, M.L.; ESPINOSA, K.; POSSO, A.M.; VASQUEZ, HD.; MUNOZ, J.E. Caracterizacion molecular de 43 accesiones de uchuva de seis departamentos de Colombia. Acta Agronomica, Palmira, v.57, n.2, p. 109-115, 2008.

BOTSTEIN, D.; WHITE, L.; SKOLMICK, H.; DAVIS, W. Construction of a genetic linkage map in man using restriction fragment length polymorphism. American Journal of Human Genetics, Chicago, v.32, p.314331, 1980.

CROCHEMORE, M.; CORREA, H.; ESTEVEZ, L. Genetic Diversity in Passion Fruit {Passiflora spp.) evaluated by RAPD markers. Brazilian Archives of Biology and Technology, Curitiba, v.46, n.4, p. 521-527, 2003.

DICE, L. Measures of the amount of ecological association beetwen species. Ecology, Durdham, v.26, p.297-302, 1945.

DOYLE, J.J.; DOYLE, J.L. Isolation of plant DNA from fresh tissue. Focus, Rockville, v.1, p. 13-15. 1991.

EFRON, B. Bootstrap methods: another look at the jackknife. Annals Statistics, Hayward, v.7, n. p.126, 1979.

FAJARDO, D.; ANGEL F.; GRUM, M.; TOHME, J.; LOBO, M.; ROCA, W.; SANCHEZ, I. Genetic variation analysis of the genus Passiflora L. using RAPD markers. Euphytica, Wagenigen, v.101, p.341-347, 1998.

FRANCO, Y.; ALZATE, F.; PELAEZ, J.M. Factores ambientales incidentes en la poblacion de Xylocopa y su efecto en el cultivo de granadilla entres veredas del municipio de Guarne (Colombia). Revista Universidad Catolica de Oriente, Medellin, n.24, p.73-88, 2007. GEPTS, P. A comparison between crop domestication, classical plant breeding and genetic engineering. Crop Science, Madison, v.42, p. 1780-1790, 2002

GONCALVES-VIDIGAL, M.C.; BENCHIMOL, L. Development and application of microsatellites in plant breeding. Crop Breeding and Applied Biotechnology, Londrina, v.11, p.66-72, 2011.

KALI A, R.K.; RAI, M.K.; KALIA, S.; SINGH, R.; DHAWAN, A.K. Microsatellite markers: an overview of the recent progress in plants. Euphytica, Wageningen, v.177, p.309-334, 2011.

LAURENTIN, H. Data analysis for molecular characterization of plant genetic resources. Genetic Resources and Crop Evolution, Dordrecht, v.56, p.277-292, 2009.

LOBO, M. Recursos geneticos y mejoramiento de frutales andinos: una vision conceptual. Revista Corpoica Ciencia y Tecnologia Agropecuaria, Bogota, v.7, n.2, p.40-54, 2006.

MISSIO, R.F.; TEIXERA, E.; ZAMBOLIM, E.M.; ZAMBOLIM, L.; CRUZ, C.M.; SUSSUMU, N. Polymorphic information content of SSR markers for Coffea spp. Crop Breeding and Applied Biotechnology, Londrina, v.10, p.89-94, 2010.

MORILLO, A.; MORILLO, Y.; MUNOZ, J.E.; VASQUEZ, H.D.; ZAMORANO, A. Caracterizacion molecular con microsatelites aleatorios RAMs de la coleccion de mora, Rubus spp. de la Universidad Nacional de Colombia sede Palmira. Acta Agronomica, Palmira, v.54, n.2, p. 15-24, 2005.

OCAMPO, J.; COPPENS D'EECKENBRUGGE, G.; OLANO, C.; SCHNELL, R. AFLP analysis for the study of genetic relationships among cultivated Passiflora species of the subgenera Passiflora and Tacsonia. Proceedings of the Interamerican Society for Tropical Horticulture, Miami, v.47, p.72-76, 2004.

OCAMPO, J.A.; COPPENS D'EECKENBRUGGE, G.; RESTREPO, M.; SALAZAR, M.; JARVIS, A. Diversity of Colombian Passifloraceae: biogeography and an updated list for conservation. Biota Colombiana, Colombia, v.8, n.1, p. 145, 2007a.

OCAMPO, J.; COPPENS D'EECKENBRUGGE, G.; RISTERUCCI, A-M.; DAMBIER, D.; OLLITRAULT, P. Papaya genetic diversity assessed with microsatellite markers in germplasm from the Caribbean region. Acta Horticulturae, The Hague, v.740, p.93-102, 2007b.

OCAMPO, J.; URREA, R.; WYCKHUYS, K.; SALAZAR, M. Aprovechamiento de lavariabilidad genetica del maracuya (Passiflora edulis f. flavicarpa Degener) como base para un programa de fitomejoramiento en Colombia. Acta Agronomica, Palmira, v.62, n.4, p.352-360, 2013.

OLIVEIRA, J.; PADUA, G.; ZUCCHI, I.; CAMARGO, A.; FUNGARO, M.H.P.; VIEIRA M.L. C. Development and characterization of microsatellite markers from the yellow passion fruit {Passiflora edulis f. flavicarpa). Molecular Ecology Notes, Oxford, v.5, p.331-333, 2005.

ORTIZ, D.; BOHORQUEZ, A.; DUQUE, M.C.; TOHME, J.; CUELLAR, D.; MOSQUERA, T. Evaluating purple passion fruit {Passiflora edulis Sims f. edulis) genetic variability in individuals from commercial plantations in Colombia. Genetic Resources and Crop Evolution, Dordrecht, v.59, n.6, p. 1089-1099, 2012.

PADUA, J.G.; OLIVEIRA, E.J.; ZUCCHI, M.I.; OLIVEIRA, G.C.X.; CAMARGO, LEA.; VIEIRA, M.L.C. Isolation and characterization of microsatellite markers from the sweet passion fruit {Passiflora alata Curtis: Passifloraceae). Molecular Ecology Notes, Oxford, v.5, p.863-865, 2005.

SAITOU, N.; NEI, M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution,Chicago, v.44, p.406-425, 1987.

SANCHEZ, I.; FAJARDO, A.; GRUM, M.; DUQUE, M.; LOBO, M.; TOHME, J.; ROCA, W. Variability of chloroplast DNA in the genus Passiflora L. Euphytica, Wageningen, v.106, p. 15-26, 1999.

SANTOS, L.F.; OLIVEIRA, E.J.; SANTOS, A.; MORAES, F.; LELES, J.; PADUA, J. ISSR markers as a tool for the assessment of genetic diversity in Passiflora. Biochemical Genetic, Dordrecht, v.49, p.540-554,2011.

SEGURA, S.; COPPENS D'EECKENBRUGGE, G.; BOHORQUEZ, A.; OLLITRAULT, P.; TOHMe, J. An AFLP study of the genus Passiflora focusing on subgenus Tacsonia. Genetic Resources and Crop Evolution, Dordrecht, v.9, p. 111-123, 2002.

SEMAGN, K.; BJORNSTAD, A.; NDJIONDJOP, M.N. An overview of molecular marker methods for plants. African Journal of Biotechnology, Nigeria, v.5, n.25, p.2540-2568, 2006.

SNOW, N.; MACDOUGAL, J.M. New chromosome reports in Passiflora (Passifloraceae). Systematic Botany, Kent, v.18, n.2, p.261-273, 1993.

VERMEULEN, S.; ZOUGMORE, R.; WOLLENBERG, E.; THORNTON, P.; NELSON, G.; KRISTJANSON, P.; KINYANGI4, J.; JARVIS, A.; HANSEN, J.; CHALLINOR, C.; CAMPBELL, B.; AGGARWAL, P. Climate change, agriculture and food security: a global partnership to link research and action for low-income agricultural producers and consumers. Current Opinion in Environmental Sustainability, Bloomington v.4, n.1, p.128-133, 2012.

YOCKTENG, R.; NADOT, S. Phylogenetic relationships among Passiflora species based on the glutamine synthetase nuclear gene expressed in chloroplast (ncpGS). Molecular Phylogenetics and Evolution, Orlando, v.31, p.379-396, 2004.

ZHOU, X.; CARTER, T.E.; CUI, Z.; MIYAZAKI, S.; BURTON, J. Genetic diversity patterns in Japanese soybean cultivars based on coefficient of parentage. Crop Science, Madison, v.42, p. 1331-1342, 2002.

NATHALIA BERNAL-PARRA (2), JOHN OCAMPO-PEREZ (3), JAVIER HERNANDEZ- FERNANDEZ (4)

(1) (Trabalho 251-13). Recebido em: 01-08-2013). Aceito para publicacao em: 04-05-2014.

(2) Estudiante de tesis de pregrado en Biologia.

(3) Docente investigador, Univ. Nacional de Colombia sede Palmira, Facultad de Ciencias Agropecuarias, Carrera 32 No 12-00 Chapinero, Via Candelaria // Centro Internacional de Agricultura Tropical--CIAT-DAPA, A.A 6713, CIAT/Cali, Colombia. Email: jaocampop@unal.edu.co

(4) Docente investigador, Univ. Jorge Tadeo Lozano, Facultad de Ciencias Naturales e Ingenieria, Dep.de Ciencias Naturales y Ambientales, Cra. 4 No 22-61, Bogota, D.C., Colombia. Email: javier.hernandez@utadeo.edu.co
TABLA 1--Lista de accesiones de granadilla evaluadas en el
estudio con el uso de marcadores microsatelites. Caracteristicas
del fruto (PF: peso del fruto (g); %Pulpa: porcentaje de pulpa;
Brix: Solidos solubles totales).

No.   Accesion    Departamento     Municipio    PF / %Pulpa / Brix

1     AntLig01      Antioquia        Jardin     107,0 / 49,1 / 15,8
2     AntLig02      Antioquia        Urrao      113,7 / 51,0 / 15,1
3     AntLig03      Antioquia        Urrao      155,8 / 52,3 / 14,1
4     BoyLig01       Boyaca        Buenavista   133,7 / 42,8 / 15,3
5     BoyLig02       Boyaca        Buenavista   115,3 / 50,6 / 16,0
6     BoyLig03       Boyaca        Buenavista   118,1 / 52,7 / 16,2
7     BoyLig04       Boyaca          Tibana     83,8 / 30,2 / 15,0
8     BoyLig05       Boyaca        Somondoco    80,0 / 44,7 / 17,1
9     CalLig01       Caldas         Aranzazu    94,9 / 54,1 / 15,0
10    CalLig02       Caldas         Salamina    93,1 / 50,4 / 16,3
11    CalLig03       Caldas         Salamina    125,8 / 47,2 / 15,7
12    CalLig04       Caldas         Aranzazu    113,6 / 52,6 / 16,0
13    CalLig05       Caldas         Anserma     125,5 / 48,9 / 15,4
14    CalLig06       Caldas         Anserma     105,6 / 55,2 / 16,3
15    CalLig07       Caldas          Neira      90,0 / 54,2 / 15,3
16    CunLig01    Cundinamarca      Venecia     134,3 / 50,9 / 15,8
17    CunLig02    Cundinamarca      Arbelaez    118,4 / 61,0 / 14,5
18    CunLig03    Cundinamarca     Fusagasuga   119,6 / 53,7 / 16,3
19    CunLig04    Cundinamarca       Pasca      117,1 / 49,1 / 15,2
20    CunLig05    Cundinamarca      Silvania    128,4 / 50,2 / 16,1
21    CunLig06    Cundinamarca      Choachi     113,2 / 53,9 / 16,1
22    HuiLig03        Huila        La Argentina 147,2 / 50,6 / 13,9
23    HuiLig06        Huila         Pitalito    114,5 / 51,1 / 15,1
24    HuiLig07        Huila          Garzon     132,0 / 49,1 / 15,0
25    PutLig01      Putumayo        Sibundoy    76,8 / 47,3 / 15,3
26    QuiLig01       Quindio         Genova     118,3 / 50,9 / 15,8
27    QuiLig02       Quindio         Genova     124,4 / 50,1 / 14,7
28    QuiLig05       Quindio        Salento     79,2 / 37,5 / 15,2
29    RisLig02      Risaralda      Santa Rosa   131,4 / 46,2 / 14,3
30    RisLig03      Risaralda         Apia      140,0 / 42,2 / 16,2
31    RisLig04      Risaralda         Apia      134,1 / 49,0 / 15,3
32    TolLig01       Tolima        Cajamarca    116,4 / 48,0 / 17,1
33    TolLig02       Tolima        Cajamarca    137,4 / 49,0 / 15,7
34    TolLig03       Tolima          Ibague     97,8 / 54,5 / 14,7
35    ValLig01   Valle del Cauca     Yotoco     96,0 / 44,0 / 15,8
36    ValLig02   Valle del Cauca    Restrepo    102,2 / 53,0 / 15,2
37    ValLig03   Valle del Cauca     Tulua      109,3 / 47,1 / 14,6
38    ValLig04   Valle del Cauca    Ginebra     171,2 / 50,9 / 15,7
39    ValLig05   Valle del Cauca   Versalles    118,6 / 45,7 / 15,0
40    ValLig06   Valle del Cauca   Versalles    103,8 / 45,3 / 14,9
41    ValLig07   Valle del Cauca   El Cerrito   96,4 / 49,0 / 15,9

TABLA 2--Secuencia de los primers (F, primer directo; R, primer
reverso), microsatelite, temperatura de anillamiento ([T.sub.a]),
numero ([N.sub.a]), composicion alelica y tamano de alelo (pb),
heterocigocidades ([H.sub.0], [H.sub.e]) y el contenido
infonnacion polimorfica (PIC) para los diferentes primers
evaluados en granadilla.

No.         Secuencia del primer           Microsatelite
Accesion           (5'-3')
GenBank

AY768786   F: TCTAATGAGCGGAGGAAAGC        [(GTTGTG).sub.4]
            R: CCGGATACCCACGCATTA
AY768785   F: TGCTCATTGATGGTGCTTG          [(AG).sub.22]
           R: TCGTCTCTTCTCCTCCTTCA
AY768781    F: GCAGCGAGGGAAGAAAAA    [(GA).sub.4]AA[(GA).sub.4]
            R: TGAGACATCGTGCGTGAA          G[(GA).sub.2]
AY768787   F: GGGCCTTTATCCATGTTTGA   [(TG).sub.8]T[(TA).sub.5]
           R: GGAAATCCGAAAACTGGTTG
AY768790   F: CAGGATAGCAGCAGCAATGA          [(GT).sub.7]
           R: AGCCAAATGTCAAACTGAAC
Promedio

No.         [T.sub.a]     [N.sub.a]   Composicion alelica
Accesion   ([degrees]C)
GenBank                               Unico   Raro   Comun

AY768786        55           16         1      4      11

AY768785        52           14         2      72      9
                                               3
AY768781        55           13                3      10

AY768787        56           12                3       9

AY768790        55           11         4      --      7

Promedio                    12,2

No.        Tamano
Accesion    alelo    [H.sub.0]   [H.sub.e]   PIC
GenBank     (pb)

AY768786   168-307     0,98        0,98      0,90

AY768785   84-115      0,95        0,93      0,86

AY768781   86-156      1,00        0,98      0,88

AY768787   167-258     0,95        0,97      0,86

AY768790   96-169      1,00        0,94      0,74

Promedio    195,5      0,98        0,96      0,84

TABLA 3--Distancias geneticas (Dice, 1945) dentro y entre
las 41 accesiones de granadilla evaluadas provenientes
de 10 departamentos de colombianos.

Departamento       Ant     Boy     Cal     Cun     Hui

Antioquia         0,411
Boyaca            0,777   0,526
Caldas            0,811   0,798   0,589
Cundinamarca      0,815   0,826   0,722   0,595
Huila             0,656   0,795   0,778   0,784   0,515
Putumayo          0,771   0,789   0,871   0,849   0,632
Qu indio          0,685   0,735   0,759   0,745   0,650
Risaralda         0,665   0,765   0,739   0,734   0,638
Tolima            0,650   0,812   0,742   0,724   0,705
Valle del Cauca   0,771   0,883   0,791   0,804   0,805

Departamento       Put     Qui     Ris     Tol     Val

Antioquia
Boyaca
Caldas
Cundinamarca
Huila
Putumayo          0,368
Qu indio          0,750   0,438
Risaralda         0,718   0,633   0,585
Tolima            0,813   0,658   0,647   0,372
Valle del Cauca   0,870   0,743   0,759   0,683   0,655
COPYRIGHT 2014 Sociedade Brasileira de Fruticultura
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Bernal-Parra, Nathalia; Ocampo-Perez, John; Hernandez-Fernandez, Javier
Publication:Revista Brasileira de Fruticultura
Date:Sep 1, 2014
Words:6081
Previous Article:Fertility and carbon and nitrogen reserves in buds of 'Cabernet Sauvignon' and 'Nebbiolo' grapevine shoots/ Fertilidade e reservas de carbono e...
Next Article:Agronomic performance of banana genotypes in the reconcavo of Bahia/Desempenho agronomico de genotipos de bananeira no reconcavo da Bahia.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |