Printer Friendly

Caracterizacion y distribucion de cepas de Escherichia coli potencialmente patogenas aisladas de pollos broiler de explotaciones avicolas en el Peru.

Characterization and Distribution of Potentially Avian Pathogenic Escherichia coli Isolates from Broilers in Peru

Introduccion

La avicultura peruana ha experimentado un crecimiento sostenido en la ultima decada. La venta de pollos de carne en los centros de acopio de Lima Metropolitana y el Callao ha incrementado de 26 329 TM en enero de 2006 a 35 720 TM en enero del 2009, llegando a 40 440 TM en julio del mismo ano (Actualidad Avipecuaria, 2009). Si bien se presenta un crecimiento sostenido de la produccion, aun se tienen limitaciones de tipo sanitario. Dentro de los patogenos bacterianos de mayor importancia se encuentra Escherichia coli, bacilo Gram negativo (Barnes et al., 2008; Lee y Nolan, 2008), causante de la colibacilosis aviar y de cuantiosas perdidas economicas a nivel mundial (Baltzley y Rehberg, 2006).

La colibacilosis es un sindrome complejo caracterizado por lesiones multiorganicas, tales como aerosaculitis asociada a pericarditis, perihepatitis y peritonitis, que resulta en alta morbilidad y mortalidad (Jansen et al., 2003). Este sindrome, causado por cepas patogenicas de E. coli (APEC), puede presentarse tanto de forma local como sistemica (Barnes et al., 2008).

Se sabe que la colibacilosis aviar es una enfermedad secundaria y que el agente etiologico es un oportunista; sin embargo, nuevas evidencias sugieren que cepas APEC pueden actuar como agentes primarios y producir la enfermedad (Ewers et al., 2003; Kariyawasam et al., 2006; Barnes et al.,, 2008) e incluso, las cepas apatogenas, mediante el intercambio de material genetico, podrian tornase patogenas si adquieren codigos geneticos para factores de virulencia especificos (Jansen et al., 2003). Los resultados de Skyberg et al. (2003) y Kariuki et al. (2002) sugieren que cepas intestinales aisladas de aves aparentemente sanas podrian causar enfermedad en huespedes susceptibles, dependiendo de la combinacion de los factores de virulencia que se presenten.

Las cepas patogenas o potencialmente patogenas, ademas de asociarse a causas de mortalidad embrionaria (Jeffrey et al., 2002; Skyberg et al., 2003; Gibbs et al., 2004), pueden ser identificadas por su resistencia al suero aviar debido a la lipoproteina externa de membrana ISS, codificada por el gen iss (Lynne et al., 2005, 2006; Johnson et al., 2002, 2008). El crecimiento bacteriano en suero aviar de cepas mutantes pAPEC-O2-colV iss- se vio notablemente reducido, pero se restituyo al insertar nuevamente el gen iss en el genoma de la cepa mutante, dando a entender la importancia de este factor para la supervivencia de la bacteria en el suero (Lynne et al., 2007).

Otro gen recientemente descubierto es el tsh (hemaglutinina sensible a la temperatura), que codifica una proteina similar a las proteasas de IgA de Haemophilus spp y Neisseria spp. Se postula como parte de la familia de las proteasas autotransportadoras y puede ser vital para la colonizacion del tracto respiratorio superior (Dozois et al., 2000; Ngeleka et al., 2002). Se caracteriza por su capacidad hemoaglutinante en eritrocitos de pollo, no provocar proteolisis de IgA humana o aviar (Stathopoulos et al.,, 1999) y producir lesiones fibrinosas en los sacos aereos; sugiriendo que la proteina Tsh aumenta la tasa de colonizacion y el desarrollo de aerosaculitis (Dozois et al., 2000).

El gen irp2 se encuentra en cepas de enterobacterias altamente patogenas y codifica la sintesis del sideroforo yersiniabactina (Carniel et al., 1992; Bultreys et al., 2006; Barnes et al., 2008). El gen iuc C esta vinculado al ultimo paso de la sintesis del sideroforo conocido como aerobactina, el cual esta relacionado a la captacion y transporte de hierro (Lorenzo et al., 1986; Ngeleka et al., 2002; Barnes et al., 2008). Ambos genes forman parte vital de la supervivencia de la bacteria y se les considera importantes marcadores de virulencia debido a su capacidad de lograr la permanencia del patogeno en ambientes agrestes del huesped, como los carentes de hierro de libre disponibilidad.

El gen cvaC se encuentra dentro del operon ColV y sintetiza a la colicina V, proteina pequena que interfiere con la formacion del potencial de membrana requerido para la produccion de energia (Johnson et al., 2006a,b). Se infiere que la colicina V como tal, no es totalmente relevante para la patogenicidad de las cepas APEC, pero el gen cvaC, al ser considerado un gen estructural del operon ColV y pertenecer al plasmido del mismo nombre (en donde se encuentran el operon aerobactina y los genes iss y tsh), es distinguido como un factor para la determinacion de virulencia (Barnes et al., 2008; Mellata et al., 2009). Adicionalmente, se infiere que la mayor resistencia de las cepas virulentas en el intestino, en comparacion con las avirulentas, se debe a la produccion de colicina V, aunque se desconoce el mecanismo de accion (Goncalvez et al., 2002).

Ngeleka et al. (2002) aislo cepas APEC a partir de brotes clinicos. Las muestras resultaron positivas a genes como tsh e iucC. Adicionalmente, los genes iss, iucC y tsh se encontraban en cepas de ponedoras sanas y enfermas de Francia, Belgica y Espana (Gibert et al., 2006). Otros estudios, asimismo, han demostrado la presencia de irp2, iss, tsh y cvaC, tanto en aislados intestinales de aves sanas como de aves enfermas (Rodriguez-Siek et al., 2005; Trampel et al.,, 2007; Yaguchi et al., 2007). Por otro lado, se ha demostrado que los factores de virulencia Iss, aerobactina y produccion de Colicina V se encuentran en mas del 80% de los aislamientos de colibacilosis (Jeffrey et al., 2002), mientras que en Brasil se encontro el 36.5% de prevalencia del gen estructural de la Colicina V (Goncalves et al., 2002).

Ante la evidencia que las cepas que causan colibacilosis en aves provienen del tracto gastrointestinal y se eliminan a traves de las heces, para luego ser inhaladas por los animales, y la ausencia de informacion en el pais, el objetivo del presente estudio fue caracterizar y evaluar la distribucion geografica de las cepas potencialmente patogenas de Escherichia coli presentes en el tracto gastrointestinal de pollos broiler aparentemente sanos, mediante el estudio de genes portadores de virulencia presentes.

MATERIALES Y METODOS

Lugar de Estudio

Se realizo un estudio de tipo descriptivo en tres explotaciones de pollos de engorde ubicadas en el norte, centro y sur del pais (La Libertad, Lima y Arequipa, respectivamente). El aislamiento e identificacion de las colonias se realizo en el Laboratorio de Investigacion y Desarrollo de la empresa Innova Andina S.A., Lima, y el analisis molecular de las colonias positivas a E. coli se efectuo en los laboratorios de investigacion de Agtech Products Inc, Waukesha, EEUU.

Toma de Muestras

El tamano de la muestra se determino en base a los trabajos de Skyberg et al. (2003), Banach et al. (2004) y Ewers et al. (2005). Se tomaron muestras de 12 pollos de engorde entre 14 y 31 dias de edad, aparentemente sanos, de cada centro avicola, para obtener 108 colonias (tres colonias por ave) sospechosas de E. coli. Se siguieron los criterios establecidos para el aislamiento de la bacteria en aves jovenes (Banach et al., 2003, 2004; Lago et al., 2006). Las aves fueron sacrificadas mediante desarticulacion cervical, minutos antes de la toma de muestras.

Para la coleccion de las porciones de intestino, se tomaron como referencia dos puntos anatomicos: 10 cm a distal desde el piloro y 10 cm a craneal desde la union iliocecal. Las porciones fueron retiradas y lavadas con PBS esteril (0.15 M) hasta eliminar todo residuo intestinal. Ambas secciones fueron colocadas en un frasco de vidrio de 50 mL (Boeco) conteniendo 20 mL de PBS esteril y fueron homogenizadas por 30 s (Banach et al., 2003, 2004; Ewers et al., 2005; Barnes et al., 2008). Se inoculo 1 ml del sobrenadante en un tubo de ensayo conteniendo 10 mL de caldo lactosado (Merck 1.07661.0500).

Procesamiento de Muestras

El procesamiento se realizo en un ambiente libre de contaminacion bacteriana, en una sala de ambiente controlado y dentro de una cabina de bioseguridad clase II (Labconco Corp.), logrando una pureza de aire del 9899%. Los tubos de ensayo con caldo lactosado fueron incubados por 24 h a 37[grados]C y luego fueron inoculados en placas de Agar McConkey (BBL, 6163276) e incubados bajo las mismas condiciones. Seguidamente, de cada placa se escogieron tres colonias lactosa positivas sospechosas de E. coli para su analisis bioquimico y confirmacion del aislamiento. Los medios utilizados fueron SIM o sulfato, indol y movilidad (Criterion, C6941), TSI o agar triple azucar hierro (Merck KGaA, 1.01342.0500), agar lisina-hierro (Merck KGaA, 1.11640.0500), agar citrato Simmons (Merck KGaA, 1.02501.0500) (Barnes et al., 2008; Lee y Nolan, 2008) y Agar EMB Levine (Merck KGaA, 1.01342.0500).

Se escogieron las colonias que resultaron moviles, Indol positivas, negativas a la degradacion del citrato, negativas a sulfuro de hidrogeno, fermentadoras de glucosa, lactosa y sacarosa, positivas a la descarboxilacion de lisina y negativas a la desaminacion de lisina, asi como productoras de gas (Blanco et al., 2002; Jeffrey et al., 2004; Barnes et al., 2008; Lee y Nolan, 2008). Paralelamente, se inocularon las muestras en agar diferencial EMB (Eosina y Azul de metileno) y se contrastaron los resultados obtenidos de las pruebas bioquimicas con las colonias que dieran un tono verde tornasolado.

Las colonias que resultaron positivas a E. coli fueron colocadas en tarjetas FTA clasicas (Whatman Ltda.) y enviadas en condiciones de esterilidad al laboratorio para la determinacion antigenica mediante MULTIPLEX PCR. El DNA fue aislado usando un High Pure PCR Template Preparation Kit (Roche Diagnostics GMBH, Mannheim, Alemania). El procedimiento MULTIPLEX PCR fue realizado segun lo descrito por Banach et al. (2003). Este contenia 5 [micron]l 10x buffer sin Mg[Cl.sub.2], 2 [micron]l 10nM dNTP mix, 0.3 5U/[micron]l Taq Polimerasa Platinum (Invitrogen, Carlsbad, CA), 4 [micron]l 50 mM Mg[Cl.sub.2], 0.5 [micron]l iss cebadores Forward y Reverse, 0.3 [micron]l tsh, iucC, cvaC, irp2 cebadores Forward y Reverse, 31 i l de dH2O esteril y 5 [micron]l de DNA genomico, para tener un volumen final de 50 i l. La secuencia de los cebadores se muestra en el Cuadro 1.

El programa de PCR comenzo con una pre-incubacion de 95[grados]C por 5 min, luego 9 ciclos de 95[grados]C por 59 s, 55[grados]C por 30 s, 72[grados]C por 59 s; 28 ciclos de 94[grados]C por 30 s, 55[grados]C por 30 s, 72[grados]C por 30 s; y se termino con una incubacion a 72[grados]C por 7 min. Los productos del PCR fueron identificados con electroforesis en un gel de agarosa Un-Sieve al 3% (Bio-Rad).

Analisis de Datos

Se determino la frecuencia de genes presentes por zona geografica y se analizo la asociacion entre el tipo de gen encontrado y la zona geografica mediante la prueba de Chi cuadrado.

RESULTADOS

Se obtuvieron 41 colonias positivas (41/ 108) a Escherichia coli, correspondiendo el 39.0, 31.7 y 29.3% a Arequipa, La Libertad y Lima. El gen de mayor presentacion fue el cvaC, encontrandose en el 53.7% de las cepas de E. coli aisladas. La distribucion de este gen, al igual que los genes iucC e irp2 fue estadisticamente similar entre los tres departamentos. Contrariamente, los genes iss y tsh tuvieron una menor presencia en Arequipa (p < 0.05), siendo el tsh el de menor frecuencia (19.5%) en el estudio (Cuadro 2).

El 65.9% (27/41) de colonias positivas a E. coli podria ser considerado patogeno, ya que en su estructura genomica poseen dos o mas genes codificadores de virulencia (Cuadro 3). El patotipo de mayor frecuencia fue la combinacion de genes iss + cvaC (29.6%), la misma que estuvo presente en los tres departamentos; seguido por cvaC + irp2 (22.2%), presente unicamente en Arequipa, y el patotipo que combina los 5 genes (14.5%), hallado solamente en La Libertad (Cuadro 4).

Adicionalmente, el 41.6% de los aislados de aves de 14 dias representan patotipos con marcadores de alta patogenicidad (tsh o irp2), en tanto que solo ocurrio en el 9.1% de los aislados de aves de 25 dias. Por otro lado, los cuatro aislados de aves de 31 dias resultaron ser patogenos y presentaron los cinco genes estudiados.

La presencia del gen cvaC en el 53.7% de los aislados, asi como su relacion con 6 de los 9 patotipos encontrados, puede deberse a que este gen se encuentra ubicado dentro del plasmido ColV, como parte del operon del mismo nombre y codificando a la proteina estructural de la Colicina V (Johnson et al., 2006b). Este plasmido es caracteristico y frecuente en las cepas patogenas, al igual que su producto final, la Colicina V. Otros estudios, asimismo, han demostrado una alta frecuencia de aislamiento de este gen y de otros del mismo operon (Baltzley y Rehberg, 2006; Gebert et al., 2006; Lago et al., 2006).

De igual manera, el gen iss esta fuertemente relacionado al plasmido ColV ya que se ubica dentro de esta seccion del genoma (Lynne et al., 2006). Dada la alta presentacion de este plasmido en los aislamientos, se podria sospechar una incidencia similar del gen iss en conjunto con el gen estructural de la Colicina V, tal como se dio en este estudio. Johnson et al. (2006a) y Lynne et al. (2007) postulan que este gen puede tambien estar contenido en el plasmido ColBM, sugiriendo a este ultimo como una evolucion de su par ColV, lo que explicaria los presentes resultados donde la presencia del gen iss se da en patotipos donde el cvaC no esta presente.

Los genes relacionados con la captacion de hierro (iucC e irp2) tuvieron una similar frecuencia de presentacion (4/9). Esta doble presencia puede ser un indicador de la importancia de los sideroforos para el desarrollo de patogenicidad de la bacteria en ambientes carentes de hierro de libre disponibilidad (Rodriguez-Siek et al., 2005).

Al igual que el iss, el gen iucC esta tambien codificado dentro del operon ColV (Lorenzo et al., 1986; Johnson et al., 2006b); sin embargo, no hay estudios que detallen que este puede ser encontrado en otras partes del genoma bacteriano, lo que dificulta aun mas la determinacion de un patotipo comun o frecuente para todos los APEC y, a la vez, queda sin poder relacionar la presentacion de este gen en los patotipos donde el cvaC estaba ausente.

La presentacion del gen tsh en los aislados se limito al 19.5% y estuvo en solo 3 de los 9 patotipos encontrados. Sin embargo, su relacion con uno o dos de los genes captadores de hierro se dio en todos los casos. Esto podria explicarse debido a que tanto el gen tsh como cualquiera de los codificadores de sideroforos estan presentes solo en las cepas mas patogenas (Carniel et al., 1992; Dozois et al., 2000; Ngeleka et al., 2002; Dozois et al, 2003), lo que implicaria que estas combinaciones serian las que representarian el mayor riesgo para el ave de todos los patotipos encontrados en el tracto gastrointestinal de las aves muestreadas; sobre todo, tomando en cuenta que el gen irp2 es tambien un marcador de alta patogenicidad para especies como Yersinia spp, Pseudomonas spp, e incluso las cepas de E. coli de procedencia humana (Xu et al., 2000; Bultreys et al., 2006).

De acuerdo a los patotipos encontrados, podria inferirse que 3 de los 9 patotipos representan el mayor riesgo para las aves portadoras, debido a que estos poseen las combinaciones que acarrean los genes catalogados como marcadores de alta patogenicidad (irp2, iucC y tsh). La combinacion de genes es perfecta para la invasion de los tejidos, su supervivencia y la evasion a las defensas del huesped (Ngeleka et al., 2002; Mellata et al., 2003; Lynne et al, 2005).

Skyberg et al. (2003) demostraron que aislados gastrointestinales de aves sanas conteniendo los cinco genes lograron matar a la mayoria de embriones en las pruebas de ELA (Prueba de letalidad embrionaria). Esta prueba es considerada (en conjunto con los desafios en aves jovenes) como prueba tradicional para la determinacion de patogenicidad de las cepas aisladas (Lee y Nolan, 2008). El departamento de La Libertad es el unico cuya poblacion de aves presento colonias positivas a los cinco genes en estudio, de alli que las explotaciones avicolas de la zona tendrian un alto mayor riesgo para la enfermedad.

El conocimiento de la presentacion de estos genes en el pais es un buen inicio para el mejor entendimiento del mecanismo de la enfermedad y para desarrollar formas mas eficaces de prevencion y control. Una de las opciones que mejor se perfila es la produccion de vacunas. Las vacunas experimentales estan dirigidas contra serogrupos especificos, muchos de los cuales solo presentan proteccion contra desafios homologos (Kariyawasan et al., 2003; Roland et al., 2004), lo cual es una seria limitacion debido a la variedad tan extensa que poseen los APEC.

Lynne et al. (2006) sugieren la creacion de vacunas contra las estructuras comunes a la mayoria de cepas APEC, como los genes codificadores de virulencia. Sus estudios revelan que la creacion de una vacuna experimental a partir de la proteina Iss, codificada por el gen iss, fue capaz de conferir proteccion ante el desafio heterologo. Esta proteccion conferida por un solo factor de virulencia, podria verse multiplicada en vacunas multivalentes dirigidas contra varios productos de genes especificos marcadores de virulencia, como los descritos en el presente estudio, sobre todo aquellos que sean de mayor presentacion y alta patogenicidad. La edad mas apropiada para la vacunacion, segun los resultados del presente estudio, estaria antes de los 14 dias de edad. A esto se suman los resultados obtenidos por Gomis et al. (2007) que indican que broilers de 10 dias vacunados con bacterina de E. coli mostraron anticuerpos especificos contra esta bacteria a los 30 dias post vacunacion.

CONCLUSIONES

* Se encontraron nueve patotipos de cepas APEC potenciales, de los cuales tres representan combinaciones de genes ideales para la invasion y supervivencia en los tejidos, y evasion a las defensas del huesped.

* Los tres patotipos que contienen los genes irp2, iucC y tsh fueron encontrados en las zonas de La Libertad y Lima.

* Las aves de 14 y 31 dias fueron las que presentaron mayor cantidad de patotipos con marcadores altamente patogenos.

Agradecimientos

Los autores agradecen a la empresa Innova Andina S.A. por las facilidades proporcionadas para el desarrollo del estudio, asi como a las explotaciones avicolas que brindaron las aves de estudio.

LITERATURA CITADA

(1.) Actualidad Avipecuaria. 2009. Estadisticas. Actualidad Avipecuaria, Peru 3(14): 84-86.

(2.) Baltzley T, Rehberg T. 2006. Characterization of avian pathogenic E. coli in a layer production facility. Agtech Products Inc. Waukesha, Wisconsin. [Internet]. Disponible en: http:// www.agtechproducts.com/resources/ 2.PDF

(3.) Banach S, Lago F, Wiard T, Rehberger T. 2004. Molecular typing of avian pathogenic Escherichia coli (APEC) from turkey poults. In: 2004 American Society for Microbiology General Meeting. Idaho, USA.

(4.) Banach C, Lago F, Rehberger T. 2003. Distribution and diversity of pathogenic E. coli in commercial turkey poult production. Agtech Products Inc., Waukesha, WI. [Internet]. Disponible en: http://www.agtechproducts.com/ resources/research_poultry_18.pdf

(5.) Barnes H, Nolan L, Vaillancourt JP. 2008. Colibacillosis. In: Saif Y (ed). Diseases of poultry. 12th ed. Iowa: Blackwell Publishing. p 691-732.

(6.) Blanco J, Blanco M, Blanco J, Mora A, Alonso M, Gonzales E, et al. 2002. Enterobacterias: caracteristicas generales. Genero Escherichia. En: Vadillo S, Duran S, Mateos E (eds). Manual de microbiologia veterinaria. Madrid: McGraw Hill/Interamericana. p 301-325.

(7.) Bultreys A, Gheysen I, Hoffmann E. 2006. Yersiniabactinn production by Pseudomonas syringae and Escherichia coli, and description of a second yersiniabactin locus evolutionary group. Appl Environ Microb 72: 3814-3825.

(8.) Carniel E, Guivoule A, Guilvout I, Mercereau-Puijalon O. 1992. Molecular cloning, iron-regulation and mutagenesis of the irp2 gene encoding HMWP2, a protein specific for the highly pathogenic Yersinia. Mol Microbiol 6: 379-388.

(9.) Dozois C, Daigle F, Curtiss III R. 2003. Identification of pathogen-specific and conserved genes expressed in vivo by an Avian Pathogenic Escherichia coli strain. P Natl Acad Sci USA 100: 247-252.

(10.) Dozois C, Dho-Moulin M, Bree A, Fairbrother J, Desautels C, Curtiss R. 2000. Relationship between the Tsh autotransporter and pathogenicity of avian Escherichia coli and localization and analysis of the tsh genetic region. Infect Immun 68: 4144-4154.

(11.) Ewers C, JanBen T, Kiebling S, Philipp H, Wieler L. 2005. Rapid detection of virulence-associated genes in avian pathogenic Escherichia coli by Multiplex Polymerase Chain Reaction. Avian Dis 49: 269-273.

(12.) Ewers C, Janssen T, Wieler LH. 2003. Avian pathogenic Escherichia coli (APEC). Berl Munch Tierarztl Wochenschr 116: 381-395.

(13.) Gibbs P, Petermann S, Wooley P. 2004. Comparison of several challenge models for studies in avian colibacillosis. Avian Dis 48: 751-758.

(14.) Gebert S, Kromm C, Rehberger T. 2006. Development of a direct fed microbial to control pathogens associated with turkey poult production. In: Poultry Science Association Annual Meeting. Edmonton, Canada.

(15.) Gibert M, Tellez S, Garcia N, Tejedor J, Comeron M, Lopez G, et al. 2006. Caracterizacion molecular de factores de virulencia por PCR y comparacion entre Escherichia coli septicemicos (APEC) y Escherichia coli fecales (AFEC) en gallinas ponedoras. En: XLIII Simposio Cientifico de Avicultura EXPOAVIGA. Barcelona, Espana.

(16.) Gomis S, Babiuk L, Allan B, Willson P, Waters E, Hecker R, et al. 2007. Protection of chickens against a lethal challenge of Escherichia coli by a vaccine containing CpG oligodeoxynucleotides as an adjuvant. Avian Dis 51: 78-83.

(17.) Goncalvez A, Bernardes A, Guimaraes B, Luiz de Souza H, Pontes A, Cristine M. 2002. Virulence factors of avian pathogenic Escherichia coli isolated from broilers from the south of Brazil. Avian Dis 46: 749-753.

(18.) Jansen T, Philipp HC, Voss M, Preisinger R, Wieler L. 2003. Multiplex PCR is the first technique to allow the specific and sensitive detection of avian pathogenic Escherichia coli (APEC). Lohmann Information 28: 1-5.

(19.) Jeffrey J, Nolan L, Tonooka K, Wolfe S, Giddings C, Horne S, et al. 2002. Virulence factors of Escherichia coli from cellulitis or colisepticemia lesions in chickens. Avian Dis 46: 48-52.

(20.) Jeffrey J, Singer R, O'Connor R, Atwill E. 2004. Prevalence of pathogenic Escherichia coli in the broiler house environment. Avian Dis 48: 189-195.

(21.) Johnson T, Giddings C, Horne S, Gibbs P, Wooley R, Skyberg J, et al. 2002. Location of increased Serum Survival gene and selected virulence traits on a conjugative R plasmid in an avian Escherichia coli isolate. Avian Dis 46: 342-352.

(22.) Johnson T, Johnson S, Nolan L. 2006. Complete DNA sequence of a ColBM plasmid from Avian Pathogenic Escherichia coli suggests that it evolved from closely related ColV virulence plasmids. J Bacteriol 188: 5975-5983.

(23.) Johnson T, Siek K, Johnson S, Nolan Lisa. 2006. DNA sequence of a ColV plasmid and prevalence of selected plasmid-encoded virulence genes among avian Escherichia coli strains. J Bacteriol 188: 745-758.

(24.) Johnson T, Wannemuehler Y, Nolan L. 2008. Evolution of the iss gene in Escherichia coli. Appl Environ Microbiol 74: 2360-2369.

(25.) Kariyawasam S, Wilkie B, Gyles C. 2003. Construction, characterization and evaluation of the vaccine potential of three genetically defined mutants of avian pathogenic Escherichia coli. Avian Dis 48: 287-299.

(26.) Kariyawasam S, Johnson T, DebRoy C, Nolan L. 2006. Ocurrence of Pathogenicity Island IAPEC-01 genes among Escherichia coli implicated in avian colibacillosis. Avian Dis 50: 405-410.

(27.) Lago F, Gebert S, Rehberger T. 2006. Diversity and relationship among APEC within the GI tract and APEC of diseased turkey poults. In: Poultry Science Association Annual Meeting. Edmonton, Canada.

(28.) Lee M, Nolan L. 2008. Colibacillosis. In: Dufour-Zavala L, et al. (eds). A laboratory manual for the isolation, identification and characterization of avian pathogens. 5th ed. Jacksonville (FL): American Association of Avian Pathologists. p 10-11.

(29.) Lynne A, Foley S, Nolan L. 2005. Immune response to recombinant Escherichia coli Iss protein in poultry. Avian Dis 50: 273-276.

(30.) Lynne A, Foley S, Nolan L. 2006. Characterization of monoclonal antibodies to Avian Escherichia coli Iss. Avian Dis 50: 445-449.

(31.) LynneA, Skyberg J, Logue C, Doetkott C, Foley S, Nolan L. 2007. Characterization of a series of transconjugant mutants of an Avian Pathogenic Escherichia coli isolate for resistance to serum complement. Avian Dis 51: 771-776.

(32.) Lorenzo V, Bindereif A, Paw B, Neilands J. 1986. Aerobactin biosynthesis and transport genes of plasmid Col V-K30 in Escherichia coli K-12. J Bacteriol 165: 570-578.

(33.) Mellata M, Dho-Moulin M, Dozois C, Curtiss R, Lehoux B, Fairbrother J. 2003. Role of avian pathogenic Escherichia coli virulence factors in bacterial interaction with chicken heterophils and macrophages. Infect Immun 71: 494-503.

(34.) Mellata M, Touchman J, Curtiss R III. 2009. Full sequence and comparative analysis of the plasmid pAPEC-1 of avian pathogenic E. coli x7122 (O78:K80:H9). PLoS ONE 4: e4232. doi:10.1371/journal.pone.0004232

(35.) Ngeleka M, Brereton L, Brown G, Fairbrother J. 2002. Pathotypes of avian Escherichia coli as related to tsh-, pap-, pil-, and iuc- DNA sequences, and antibiotic sensitivity of isolates from internal tissues and the cloacae of broilers. Avian Dis 46: 143-152.

(36.) Roland K, Karaca K, Sizemore D. 2004. Expression of Escherichia coli antigens in Salmonella typhimurium as a vaccine to prevent airsacculitis in chickens. Avian Dis 48: 595-605.

(37.) Rodriguez-Siek K, Giddings W, Doetkott C, Johnson T, Nolan L. 2005. Characterizing the Apec pathotype. Vet Res 36: 241-256.

(38.) Skyberg J, Horne S, Giddings C, Wooley R, Gibbs P, Nolan L. 2003. Characterizing avian Escherichia coli isolates with Multiplex Polymerase Chain Reaction. Avian Dis 47: 1441-1447.

(39.) Stathopoulos C, Provence D, Curtiss III R. 1999. Characterization of the Avian Pathogenic Escherichia coli hemagglutinin Tsh, a member of the immunoglobulin A protease-type family of autotransporters. Infect Immun 67: 772-781.

(40.) Trampel D, Wannemuehler Y, Nolan L. 2007. Characterization of Escherichia coli isolates from peritonitis lesions in commercial laying hens. Avian Dis 51: 840-844.

(41.) Xu J, Cheng B, Wen X, Cui S, Ye C. 2000. High-pathogenicity island of Yersinia sp in Escherichia coli strains isolated from diarrhea patients in China. Clinic Microbiol 38: 4672-4675.

(42.) Yaguchi K, Ogitani T, Osawa R, Kawano M, Kokumai N, Kaneshige T, et al. 2007. Virulence factors of Avian Pathogenic Escherichia coli strains isolated from chickens with colisepticemia in Japan. Avian Dis 51: 656-622.

Claudia Carranza [1,4], Ricardo Leon [1], Nestor Falcon [2], Anthony Neumann [3], Christopher Kromm [3]

[1] Departamento de Direccion Tecnica, Innova Andina S.A., Lima, Peru

[2] Facultad de Veterinaria y Zootecnia, Universidad Peruana Cayetano Heredia, Lima, Peru

[3] Danisco, USA

[4] E-mail: claudia.carranza76@gmail.com
Cuadro 1. Cebadores utilizados en el estudio

Gen    Longitud (pb) (1)             Secuencia

iss           760          Forward   GTGUCGAAAACTAGTAAAACAGC
                           Reverse   CGCCTCGGGGTGGATAA
iucC          541          Forward   CGCCGTGGCTGGGGTAAG
                           Reverse   CAGCCGGTTCACCAAGTATCACTG
tsh           420          Forward   GGGAAATGACCTGAATGCTGG
                           Reverse   CCGCTCATCAGTCAGTACCAC
cvaC          360          Forward   GGGCCTCCTACCCTTCACTCTTG
                           Reverse   ACGCCCTGAAGCACCACCAGAA
irp2          287          Forward   AAGGATTCGCTGTTACCGGAC
                           Reverse   AACTCCTGATACAGGTGGC

Longitud expresada en pares base

Cuadro 2. Muestras positivas de E. coli a
los diferentes genes en estudio, distribuidos
segun procedencia de la muestra

        Lima             Arequipa
Genes   (n = 12)         (n = 16)

        No.      %       No.      %

cvaC     3    25 (a)     10    62.9 (a)
iss      7    58.3 (a)    4    25.0 (b)
irp2     2    16.7 (a)    9    56.3 (a)
iucC     4    33.3 (a)    5    31.3 (a)
tsh      4    33.3 (a)   --     0.0 (b)

        La Libertad            Total
Genes   (n = 13)               (n = 41)

        No.      %       No.      %

cvaC     9    69.2 (a)   22      53.7
iss      9    69.2 (a)   20      48.8
irp2     5    38.5 (a)   16      39.0
iucC     5    38.5 (a)   14      34.1
tsh      4    30.8 (a)    8      19.5

(a,b) Superindices diferentes dentro de filas
indican diferencia estadistica (p < 0.05)

Cuadro 3. Condicion de patogenicidad (1) en cepas
de E. coli de acuerdo a la presentacion de genes
distribuidos segun procedencia

Condicion de    No. de   Lima       Arequipa
patogenicidad   genes    (n = 12)   (n = 16)

No patogeno       0         4          3
                  1         1          2

                Total       5          5

Patogeno          2         3          8
                  3         3          2
                  4         1          1
                  5         --         -
                Total       7         11

Condicion de    No. de   La Libertad   Total
patogenicidad   genes    (n = 13)      (n = 41)

                                       No.     %

No patogeno       0           3         10   24.4
                  1           1          4    9.8

                Total         4         14    34

Patogeno          2           4         15   36.6
                  3           1          6   14.6
                  4          --          2    4.9
                  5           4          4    9.8

                Total         9         27   65.9

(1) Segun criterios senalados por Skyberg et al,
(2003)

Cuadro 4. Combinaciones de genes encontradas en los
aislamientos de Escherichia coli patogenica

Combinaciones de genes            Lima      Arequipa
                                 (n = 12)   (n = 16)

iss   cvaC                          3          1
      cvaC                          --         6
iss   cvaC   tsh   irp2   iucC      --         -iss
tsh          iucC      3          -iss
cvaC                iucC      --         2
                   irp2   iucC      --         1
iss   cvaC         irp2             --         -iss
tsh   irp2   iucC      1          -iss
cvaC         irp2   iucC      --         1

Combinaciones de genes           La Libertad   Total (n = 41)
                                   (n = 3)     No.      %

iss   cvaC                            4         8     29.6
      cvaC                            -         6     22 2
iss   cvaC   tsh   irp2   iucC        4         1     14.8
iss          tsh          iucC       --         3     11.1
iss   cvaC                iucC       --         2      7.4
                   irp2   iucC       --         1      3.7
iss   cvaC         irp2               1         1      3.7
iss          tsh   irp2   iucC       --         1      3.7
iss   cvaC         irp2   iucC       --         1      3.7
COPYRIGHT 2012 Universidad Nacional Mayor de San Marcos
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Carranza, Claudia; Leon, Ricardo; Falcon, Nestor; Neumann, Anthony; Kromm, Christopher
Publication:Revista de Investigaciones Veterinarias del Peru (RIVEP)
Date:Apr 1, 2012
Words:5082
Previous Article:Lesiones anatomo-patologicas en cuyes intoxicados experimentalmente con Pteridium aquilinum como modelo animal para bovinos con hematuria vesical...
Next Article:Respuesta inmune en conejos a dos tamanos de quistes de Sarcocystis aucheniae.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters