Printer Friendly

Caracterizacion de aislados de Escherichia coli O157:H7 en canales de bovinos y porcinos mediante PCR.

INTRODUCCION

Escherichia coli O157:H7 ha emergido como un patogeno transmitido por alimentos y es considerado de importancia en salud publica, ya que esta implicado en brotes de colitis hemorragica y posible aparicion posterior del sindrome uremico hemolitico (SUH) [19]. Una caracteristica de E. coli O157:H7 es el bajo numero de celulas requeridas para desarrollar la enfermedad de 10 a 100 celulas [11] por lo que la no deteccion por los metodos tradicionales microbiologicos no es certeza ni sinonimo de seguridad del alimento. E. coli O157:H7 puede estar presente en una gran variedad de animales silvestres y domesticos entre los cuales se encuentran bovinos (Bos taurusindicus), porcinos (Sus scrofa domestica) y ovinos (Ovis aries) [18], siendo principalmente los rumiantes y sus heces fecales un reservorio natural de este patogeno [17, 20]. Se ha reportado que la transmision de E. coli O157:H7 a los humanos en forma directa o indirecta puede ser por contaminacion de los alimentos a partir de material fecal, agua contaminada, y contacto con personas o animales enfermos [4]. Por otro lado, microorganismos patogenos para el humano como E. coli O157:H7, que habita naturalmente en el tracto digestivo del ganado bovino, puede eventualmente contaminar la canal durante el proceso de evisceracion o en el manejo posterior de la misma [25]. Aunque el serotipo de E. coli O157:H7 es determinado por los genes rfbE y fliC que codifican respectivamente para la biosintesis del lipopolisacarido O157 y la flagelina, lo que a su vez determina respectivamente los antigenos O y H, la patogenicidad se debe a la expresion de varios genes que codifican para factores de virulencia. Entre estos se encuentran los genes stx1 y stx2 que codifican para las verotoxinas 1 y 2, respectivamente, los cuales se encuentran en un bacteriofago integrado al cromosoma bacteriano y que han sido asociados al desarrollo del SUH, particularmente stx2 [21]. Otro de los genes de virulencia localizado en el locus LEE (locus de efusion en enterocitos) es el gen eaeA que codifica para la intimina y que es necesario para el proceso de la adherencia intima a las celulas epiteliales del intestino humano [12, 20, 22]. En Mexico existen algunos reportes de la presencia de E. coli O157:H7 en muestras comerciales de carne de res, pero no se define si la carne venia contaminada desde el matadero o se contamino en el manejo posterior [6], y siendo Mexico un pais con una produccion promedio en los ultimos cinco anos de 1.473.650 t de carne de bovino y de 1.050.311 t de carne de cerdo [24] y un volumen de exportacion combinado de ambos tipos de carne de 38.677,2 t [23], es importante determinar la calidad sanitaria de la canal al momento de salir del matadero. El objetivo del presente estudio consistio en caracterizar cepas de E. coli del serotipo O157:H7 aisladas de canales de bovinos y porcinos en plantas procesadoras de productos carnicos de la Comarca Lagunera, Mexico.

MATERIALES Y METODOS

Diseno del estudio

El estudio fue de tipo longitudinal prospectivo y el periodo comprendio de febrero a marzo del 2004. Se seleccionaron dos plantas procesadoras de productos carnicos, una de cerdo (I) y una de bovino (II) de la Comarca Lagunera, Mexico. Los muestreos se realizaron en dos fechas para cada planta, 20/02/2004 y 15/03/2004 para la planta I y 02/03/2004 y 24/03/2004 para la planta II. A partir de estos se obtuvieron los aislados de E. coli.

Obtencion de las muestras

La toma y manejo de las muestras se realizo conforme a lo especificado por la Norma Oficial Mexicana NOM-109 SSA1-1994 y con modificaciones a lo propuesto por Gill y Jones [15]. Las canales se muestrearon inmediatamente a su arribo al area de inspeccion y sellado (15 y 10 minutos en promedio despues del inicio del sacrificio del animal hasta la toma de las muestras, respectivamente para canal de bovino y cerdo). En cada planta procesadora se procedio a la seleccion de 15 canales al azar, para el analisis de superficies vivas, de las cuales se recolectaron las muestras con esponja esteril NASCO [R], Whirl-Pak, Speci-Sponge, B01324WA (5x10x1 cm) (Nasco EUA) en tres sitios diferentes: falda (sitio A), costado (sitio B) y cuello (sitio C), para un total de 45 muestras por planta. De las 15 muestras de cada sitio de la canal (A, B, C) se formaron tres grupos de cinco muestras cada uno, para tener nueve muestras compuestas por planta, lo que dio un tamano final de 18 muestras compuestas.

Aislamiento y confirmacion de E. coli O157:H7 en muestras compuestas

Cada muestra compuesta se paso a enriquecimiento en caldo Reveal (NEOGEN[R], EUA) y se incubo durante 8 h a 42[grados]C, luego de este tiempo se tomaron 120 [micron]L y se depositaron sobre la placa de lectura del kit. Despues de 15 minutos se realizaron las lecturas y de las muestras presuntivas se tomo una asada y se estrio en medio cromogenico CHROmagar[R] O157 (CHROmagar, Francia). Las colonias caracteristicas se confirmaron con pruebas bioquimicas utilizando el API[R] 20 E (Biomereux, Francia) y el serotipo utilizando un kit de serologia Difco[TM] E. coli Antiserum (DIFCO, EUA). En las muestras que se confirmo la presencia de E. coli O157:H7 se procedio a realizar la obtencion de ADN para la caracterizacion molecular mediante la Reaccion en Cadena de la Polimerasa (PCR).

Cepa de referencia, condiciones y medio de cultivo

La cepa de referencia de E. coli O157:H7 que se uso como control positivo en los ensayos de PCR fue proporcionada por el Centro para el Control y la Prevencion de Enfermedades (CDC) a traves del Centro Nacional de Servicios de Constatacion en Salud Animal (CENAPA), Mexico. La cepa fue activada en caldo infusion cerebro corazon a 35[grados]C por 24 h.

Extraccion del ADN

Los aislados de E. coli O157:H7 se incubaron en caldo infusion cerebro corazon por 24 h a 37[grados]C. Despues de la incubacion y a partir de este medio se tomo tres veces 1 mL y se centrifugo a 3000 rpm durante 1 min (Centrifuga Sigma 1-15K, Alemania) para formar una pastilla en tubos Eppendorf de 1,5 mL y hacer la extraccion de ADN con el metodo CTAB [7] pero omitiendo el uso de polivinilpirrolidona y 2[beta]-mercaptoetanol.

Reacciones de PCR

Las reacciones de PCR se realizaron utilizando los oligonucleotidos mencionados en la TABLA I. Primero se realizo una reaccion para amplificar simultaneamente dos fragmentos correspondientes a los genes rfbE y fliC [5, 13]. En los aislados que resultaron positivos para los genes anteriores, se realizaron reacciones por separado para amplificar un fragmento en cada uno de los siguientes genes: stx1, stx2 y eaeA [1, 14]. Las reacciones de PCR se realizaron en volumenes de 25 [micron]L, utilizando 1 [micron]L (25 pmoles) de cada uno de los oligonucleotidos, 2,5 [micron]L de los dNTP's (200 [micron]M) (GIBCO-BRL), 0,5 [micron]L de MgCl2 (1,5 mM), 2,5 [micron]L de buffer para PCR (10X) (200 mM Tris-HCl pH 8,0, 500 mM KCl), 2,5 unidades de la enzima Taq-DNA polimerasa (Bioline) y 1 [micron]L de ADN (100 ng). El control negativo de la PCR tenia los mismos ingredientes, excepto el ADN, sustituyendose este volumen con agua miliQ esteril. La amplificacion se llevo a cabo en un termociclador PCR Express (ThermoHybaid, Reino Unido) y las condiciones de corrida para los genes rfbE y fliC fueron de un ciclo de 1 min a 95[grados]C, seguido de 35 ciclos de tres pasos: desnaturalizacion a 95[grados]C por 30 s, alineamiento a 66[grados]C por 30 s y una extension a 72[grados]C por 75 s, con una extension final de 10 min a 72[grados]C. Para los genes stx1 y stx2 se modifico el paso de alineamiento a 58[grados]C durante 30 s. Para el gen eaeA se modifico el paso de alineamiento a 64[grados]C por 30 s. Las demas temperaturas y tiempos fueron iguales. Los productos de PCR fueron visualizados en geles de agarosa al 1,5% tenidos con bromuro de etidio (0,5 [micron]g mL-1), y visualizados en un transiluminador de luz UV (Spectroline, EUA). Posteriormente fueron fotografiados con una camara polaroid (pelicula A667, EUA) adaptada con filtro para luz ultravioleta.

Prueba estadistica

Se uso la prueba de Ji cuadrado [3] para probar si las diferencias observadas en el numero de canales positivas al patogeno de cerdo y de bovino eran estadisticamente significativas.

RESULTADOS Y DISCUSION

De un total de 18 muestras (nueve de cerdo y nueve de res), seis de cerdo (66,66%) y seis de bovino (66,66%) fueron positivas por PCR para la presencia de E. coli serotipo O157:H7, demostrandose asi que este patogeno puede estar presente en ambos tipos de canal (TABLA II y FIG. 1). E. coli O157:H7 se ha encontrado en una gran variedad de alimentos, tanto de origen vegetal como animal, pero se ha asociado particularmente a la carne del ganado bovino, ya que esta especie se ha considerado como un reservorio natural de este patogeno. Sin embargo existen reportes que mencionan su presencia en otras especies animales como cerdos, ovejas, caballos (Equs caballus), venados, perros (Canis familiaris) y aves [2, 8, 16]. En relacion con la planta I, en su primera fecha de muestreo (20/02/2004) se encontro que, si bien dos aislados resultaron positivos para los genes que codifican para los antigenos O157 y H7, estos no eran portadores de ninguno de los dos genes que codifican para las verotoxinas; sin embargo, en la segunda fecha de muestreo (15/03/2004), de cuatro aislados positivos para los genes rfbE y fliC, tres fueron positivos para los genes de las verotoxinas 1 y 2 y el de la intimina. Es importante mencionar que cada uno de estos tres aislados fueron encontrados en cada uno de los tres diferentes sitios de muestreo en la canal, es decir, uno en la cadera, otro en el costado y otro en el cuello, lo que plantea la posibilidad que se tratara de un mismo animal, o bien de animales diferentes pero procedentes de una misma granja o lugar y en la cual existe la presencia de E. coli O157:H7 enterohemorragica.

[FIGURA 1 OMITIR]

Respecto a los seis aislados que fueron encontrados en la planta II y que amplificaron por PCR para los genes que codifican para los antigenos O157 y H7, cuatro fueron portadores del gen de la verotoxina 1, y de estos solo uno fue portador del gen de verotoxina 2 y el de intimina, y fue obtenido del cuello del animal.

Si bien lo anterior senala el riesgo de encontrar a este patogeno en ambos tipos de canal y representa un riesgo para la salud, no necesariamente implica que el animal sea el portador, sino que pone de manifiesto la ineficiencia de las buenas practicas higienicas en el manejo de la canal, puesto que un animal sano puede portar el patogeno en su pelo, piel y tracto intestinal [2]; o bien la canal contaminada en el proceso de sacrificio contamine a otras canales debido a un deficiente proceso de evisceracion. A pesar que el proceso de sacrificio del ganado bovino y porcino es diferente, las diferencias observadas entre el numero de canales positivas de cerdo y bovino para cualquiera de los genes no fueron significativas estadisticamente (TABLA III), lo que sugiere la posibilidad de encontrar a E. coli O157:H7 enterohemorragica indistintamente en ambos tipos de canal, sin embargo, estos datos deben considerarse con reserva, dado el tamano de muestras analizadas a pesar que se tiene concordancia con otros autores [4] quienes mencionan la posibilidad que los cerdos sean hospederos biologicamente competentes para E. coli O157:H7 y otras cepas de E. coli verotoxigenicas.

En algunos paises como Estados Unidos de Norteamerica, la presencia del serotipo O157:H7 en los alimentos, no importa si es o no verotoxigenica, es motivo de preocupacion por el riesgo que ello implica en la salud de los consumidores. Por lo tanto, ademas de determinar la presencia de E. coli O157:H7 en los alimentos es muy importante caracterizarlos en relacion con otros factores de patogenicidad. La importancia clinica que tiene E. coli O157:H7 como patogeno radica en el hecho que puede ser portadora de uno o ambos genes que codifican para las verotoxinas, asi como el gen de la intimina lo que determina que la cepa sea considerada enterohemorragica [19]. La FIG. 2 muestra los productos de PCR a partir del gen stx1 de aislados que fueron positivos para los genes rfbE y fliC. Se observa que no todos los aislados presentaron este gen, solo siete de ellos, correspondiendo cuatro a aislados obtenidos a partir de canales de bovino y tres a partir de canales de cerdo. Puesto que los genes stx1 y stx2 se encuentran cada uno en un bacteriofago temperado lisogenico, los cuales integran su ADN al cromosoma de E. coli O157:H7 [26], se puede explicar porque algunas de las cepas de E. coli O157:H7 expresaron solo una o ambas verotoxinas, lo cual ya ha sido documentado [22].

En otro estudio [10] sobre la presencia de E. coli O157:H7 en cerdos, se encontro ademas del genotipo O157:H7 portador de los genes stx1, stx2 y eaeA, la presencia del genotipo portador de stx1 y los genes de virulencia eaeA y hly, o bien, genotipos portadores de eaeA, stx1 y stx2, pero no con los cuatro genes stx1, stx2, eaeA y hly. Asi mismo otros autores reportaron en canales de bovino, un aislado de E. coli O157:H7 que fue negativa por PCR para los genes stx pero positiva para los genes de virulencia ehx y eaeA [9]. De los aislados que fueron caracterizados como portadores del gen stx1, cuatro fueron portadores del gen stx2, siendo tres de los aislados obtenidos de canales de cerdo y uno de canal de bovino (FIG. 3). No obstante se ha reportado una mayor proporcion de cepas portadoras del gen stx2 que del gen stx1 [9], en el presente trabajo no se encontro la misma proporcion, pero si hubo coincidencia con otros reportes [16] donde mencionan que la mayoria de las cepas portadoras del gen stx2, tambien lo son para el gen eaeA, ya que los cuatro aislados portadores del gen stx2 tambien fueron portadores del gen eaeA (FIG. 4).

[FIGURA 2 OMITIR]

[FIGURA 3 OMITIR]

CONCLUSIONES

Las canales de bovino y las de cerdo pueden ser portadoras de E. coli O157:H7, lo que refleja la habilidad de este patogeno para colonizar tambien a la especie porcina. Los resultados obtenidos en este trabajo a traves de la PCR constituyen un aporte valioso en materia de inocuidad alimentaria y salud publica al demostrar la presencia de E. coli O157:H7 enterohemorragica en estos tipos de alimentos. De gran utilidad resulto la PCR para determinar el grado de virulencia de los aislados ya que permitio identificar los que fueron portadores de los genes de virulencia verotoxinas 1 y 2 y del gen de la intimina, siendo ademas muy importante desde el punto de vista epidemiologico el hecho de haber encontrado cepas portadoras de los factores de virulencia por ser consideradas patogenas al humano. Debido a que no se obtuvieron muestras ambientales, ni de los trabajadores dentro de los mataderos, asi como de las herramientas de corte que ellos utilizan, seran necesarios estudios posteriores para descartar la existencia de fuentes externas de contaminacion, asi como la posibilidad de contaminacion cruzada al momento de la evisceracion. De acuerdo con los resultados encontrados, se abre la posibilidad para realizar estudios mas a fondo del destino que tendrian el tipo de cepas de E. coli O157:H7 sobre la incidencia de enfermedades transmitidas por los alimentos, o si bien, el proceso de coccion es suficiente para eliminar el riesgo de contaminacion al momento del consumo de la carne contaminada con dicha bacteria.

[FIGURA 4 OMITIR]

REFERENCIAS BIBLIOGRAFICAS

[1] BLANCO, M.; BLANCO, J.E.; MORA, A.; REY, J.; ALONSO, M.; HERMOSO, J.; ALONSO, M.P.; DHABI, G.; GONZALEZ, E.A.; BERNARDEZ, M.I.; BLANCO, J. Serotypes, virulence genes and intimin types of shiga toxins (verotoxin)-producing Escherichia coli isolates from healthy sheep in Spain. J. Clin. Microbiol. 41: 1351-1356. 2003.

[2] BOUVET, J.; BAVAI, C.; ROSSEL, R.; LE ROUX, A.; MONTET, M.P.; RAY-GUENIOT, S.; MAZUY, C.; ARQUILLIE 'RE, C.; VERNOZY-ROZAND, C. Prevalence of verotoxin-producing Escherichia coli and E. coli O157:H7 in pig carcasses from three French slaughterhouses. Int. J. Food Microbiol. 71: 249-255. 2001.

[3] CHRISTENSEN, H. B. Datos categoricos y sus pruebas. Novena unidad. En: Houghton Mifflin Co. (Ed) Estadistica paso a paso. 2a. Ed. Trillas, Mexico. Pp 459-477. 1989.

[4] CORNICK, N.A.; HELGERSON, A.F. Transmission and Infectious Dose of Escherichia coli O157:H7 in Swine. Appl Environ Microbiol. 70: 5331-5335. 2004.

[5] DESMARCHELIER, P.M.; BILGE, S.S.; FEGAN, N.; MILLS, L.; VARY JR, J.C.; TARR, P.I. A PCR specific for Escherichia coli O157:H7 based on the rfb locus encoding O157 lipopolisaccharide. J Clin Microbiol. 36: 1801-1804. 1998.

[6] DIAZ-CINCO, M.E.; GARCIA, A.; ACEDO, E.; GASTELUM, A. Recuperacion e Incidencia de Escherichia coli O157:H7 en carne molida expendida en el mercado local de la ciudad de Hermosillo, Sonora. In: Resumenes de trabajos libres: microbiologia y toxicologia. V Congreso del Noroeste, I Nacional, en Ciencias Alimentarias y Biotecnologia. Centro de las Artes de la Universidad de Sonora Hermosillo, Sonora. Mexico. 7-12 de noviembre del 2005. En linea: http://www.dipa.uson.mx/wb2/dipa/dipa_congresodelnoroeste. 10/02/2006.

[7] DOYLE, J.J.; DOYLE, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19:11-15. 1987.

[8] DOYLE, M.P. Escherichia coli O157:H7 and its significance in foods. International J. Food Microbiol. 12: 289-301. 1991.

[9] ELDER, R.O.; KEEN, J.E.; SIRAGEUA, G.R.; BARKOCY-GALLAGHER, G.A.; KOOHMARAIE, M.; LAEGREID, W.W. Correlation of enterohemorrhagic Escherichia coli O157 prevalence in feces, hides, and carcasses of beef cattle during processing. Proceedings of the National Academic of Sciences. 97: 2999-3003. 2000.

[10] FEDER, I.; MORGAN, F.; GRAY, J.T.; FRATAMICO, P.; FEDORKA-CRAY, P.J.; PEARCE, R.A.; CALL, J.E.; PERRINE, R.; LUCHANSKY, J.B. Isolation of Escherichia coli O157:H7 from Intact Colon Fecal Samples of Swine. Emerg. Infect. Dis. 9: 380-383. 2003.

[11] FENG, P.; WEAGANT, S.D. Diarrheagenic Escherichia coli. 2002. Bacteriological Analytical Manual. Chapter 4a. U.S. Food and Drug Administration. Center for Food Safety and Applied Nutrition. U.S.A. Online: http://www.cfsan.fda.gov/~ebam/bam-4a.html#fn1. 05/01/2006.

[12] FRATAMICO, P.; SACKITEY, S.K.; WIEDMANN, M.; DENG, M.Y. Detection of Escherichia coli O157:H7 by multiplex PCR. J. Clin. Microbiol. 33: 2188-2191. 1995.

[13] GANNON, V.P.J.; D'SOUZA,S.; GRAHAM, T.; KING, R.K.; RAHN, K.; READ, S. Use of the Flagellar H7 Gene as a Target in Multiplex PCR Assays and Improved Specificity in Identification of Enterohemorrhagic Escherichia coli Strains. J. Clin. Microbiol. 35: 656-662. 1997.

[14] GANNON, V.P.J.; RASHED, M.; KING, R.K.; GOSTEYN, E.J. Detection and Characterization of the eae Gene of Shiga-Like Toxin-Producing Escherichia coli Using Polymerase Chain Reaction. J. Clin. Microbiol. 31: 1268-1274. 1993.

[15] GILL, C.O.; JONES T. Microbiological sampling of carcasses by excision or swabbing. J. Food Prot. 63: 167-173. 2000.

[16] HEUVELINK, A.E.; SWARTKRUIS-NAHUIS, J.T.; BEUMER, R.R. DE BOER, E. Occurrence and survival of verocytotoxin-producing Escherichia coli O157 in meats obtained from retail outlets in The Netherlands. J. Food Protec. 62: 1115-1122. 1999.

[17] HEUVELINK, A.E.; VAN DEN BIGGELAAR, F.L.A.M.; ZWARTKRUIS.NAHUIS, J.T.M.; HERBES, R.G.; HUYBEN, R.; NAGELKERKE, N.; MELCHERS, W.J.G.; MONNENS, L.A.H.; DE BOER, E. Occurrence of verocytotoxin-producing Escherichia coli O157 on Dutch dairy farms. J. Clin. Microbiol. 36: 3480-3487. 1998.

[18] HUTCHISON, M.L.; NICHOLSON, F.A.; SMITH, K.A.; KEEVIL, C.W.; MOORE, A. A study on farm manure applications to agricultural land and an assessment of the risks of pathogen transfer into the food chain. HMSO: MAFF Publications. U.K. Pp. 1-192. 2000.

[19] MEAD, P.S.; GRIFFIN, P.M. Escherichia coli O157:H7. Lancet 352: 1207-1212. 1998.

[20] NATARO, J P.; KAPER, J. B. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11: 142-201. 1998.

[21] PATON, A.W.; PATON, J.C. Detection and Characterization of Shiga Toxigenic Escherichia coli by Using Multiplex PCR Assays for stx1, stx2, eaeA, Enterohemorrhagic E. coli hlyA, [rfb.sub.O111] and [rfb.sub.O157]. J. Clin. Microbiol. 36: 598-602. 1998

[22] ROGERIE, F.A.; MARECAT, A.; GAMBADE, S.; DUPOND, F.; BEAUBOIS, P.; LANGE, M. Characterization of Shiga toxin producing E. coli and O157 serotype E. coli isolated in France from healthy domestic cattle. Internat. J. Food Microbiol. 63: 217-223. 2001.

[23] SAGARPA (SECRETARIA DE AGRICULTURA, GANADERIA, DESARROLLO RURAL, PESCA Y ALIMENTACION). Exportaciones mexicanas de carnes frescas, refrigeradas o congeladas (toneladas). 2002. Mexico. En linea: http://www.sagarpa.gob.mx/Dgg/expocar.htm.21/02/2006.

[24] SAGARPA (SECRETARIA DE AGRICULTURA, GANADERIA, DESARROLLO RURAL, PESCA Y ALIMENTACION). Estimacion del Consumo Nacional Aparente 1990-2004. Mexico. 2005. En linea: http://www.sagarpa.gob.mx/Dgg/ganind3.htm. 21/02/2006.

[25] SCHROEDER, C.M.; WHITE, D.G.; GE, B.; ZHANG, Y.; MCDERMOTT, P.F.; AYERS, S.; ZHAO, S.; MENG, J. Isolation of antimicrobial-resistant Escherichia coli from retail meats purchased in Greater Washington, DC, EUA. Internat. J. Food Microbiol. 85: 197-202. 2003.

[26] SHAIKH, N.; TARR, P.I. Escherichia coli O157:H7 Shiga Toxin-Encoding Bacteriophages: Integrations, Excisions, Truncations, and Evolutionary Implications. J. Bacteriol. 185: 3596-3605. 2003.

Miguel Gallegos (1), Alberto Morales (2)*, Genoveva Alvarez (2), Jesus Vasquez (3), Lilia Morales (4), Irma Martinez (4) y Jesus Maldonado (5)

(1) Facultad de Agricultura y Zootecnia, Universidad Juarez del Estado de Durango.

(2) Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias (INIFAP) hasta 31 de diciembre del 2007, actualmente Consorcio Tecnico del Noreste, A. C. UGRNL. Telefono y Fax: 01 81 83674487 Ext. 132. Km 4.5 carretera a Reynosa, Guadalupe, N. L. Mexico.

(3) Facultad de Ciencias Quimicas, UJED. (4) Facultad de Ciencias Biologicas, UANL. (5) Laboratorio de Diagnostico Molecular, Nucleo "Hector Ochoa Zuleta", Universidad Centroccidental "Lisandro Alvarado", Venezuela.

* E-mail: alberto.morales@labmty-cfppnl.org.mx
TABLA I

INICIADORES USADOS EN LAS REACCIONES DE PCR PARA LA IDENTIFICACION
Y CARACTERIZACION MOLECULAR DE E. coli O157:H7 / PRIMERS USED IN
THE PCR REACTIONS FOR THE IDENTIFICATION AND MOLECULAR
CHARACTERIZATION OF E. coli O157:H7

Gen    Secuencia                    Tamano (pb)

       5'[flecha diestra] 3'

rfbE   AAGATTGCGCTGAAGCCTTTG        497
       CATTGGCATCGTGTGGACAG

fliC   GCGCTGTCGAGTTCTATCGAGC       625
       CAACGGTGACTTTATCGCCATTCC

stx1   CGCTGAATGTCATTCGCTCTGC       302
       CGTGGTATAGCTACTGTCACC

stx2   CTTCGGTATCCTATTCCC (a)       518
       CTGCTGTGACAGTGACAAAACG (b)

eaeA   CAGGTCGTCGTGTCTGCTAAA        1087
       TCAGCGTGGTTGGATCAACCT

(a) Se eliminaron dos guaninas en el extremo 3'.

(b) Se elimino una citosina en el extremo 3'.

TABLA II

RESUMEN DE LA CARACTERIZACION DE AISLADOS DE E. coli / SUMMARY OF
THE CHARACTERIZATION OF E. coli ISOLATES

                             Sitio de
Aislado   Especie   Planta   muestreo      Fecha de
                             en la canal   muestreo

 1.1      Cerdo     I        B             20/02/2004
 2.1      Cerdo     I        B             20/02/2004
 3.1      Cerdo     I        C             20/02/2004
 4.1      Cerdo     I        C             20/02/2004
 5.1      Bovino    II       B              2/3/2004
 6.1      Bovino    II       C              2/3/2004
 7.1      Bovino    II       A              2/3/2004
 8.1      Bovino    II       B              2/3/2004
10.1      Cerdo     I        A             15/03/2004
11.1      Cerdo     I        B             15/03/2004
12.1      Cerdo     I        C             15/03/2004
13.1      Cerdo     I        C             15/03/2004
14.1      Bovino    II       B             24/03/2004
15.1      Bovino    II       C             24/03/2004

Aislado   Genotipo

          rfbE   fliC   stx1   stx2   eaeA

 1.1      -      -      -      -      -
 2.1      -      -      -      -      -
 3.1      +      +      -      -      -
 4.1      +      +      -      -      -
 5.1      +      +      +      -      -
 6.1      +      +      +      +      +
 7.1      +      +      +      -      -
 8.1      +      +      +      -      -
10.1      +      +      +      +      +
11.1      +      +      +      +      +
12.1      +      +      -      -      -
13.1      +      +      +      +      +
14.1      +      +      -      -      -
15.1      +      +      -      -      -

A = falda. B = costado. C = cuello. + y - = respectivamente
portadores y no portadores del gen en cuestion.

TABLA III

FRECUENCIA DE AISLADOS DE E. coli O157:H7 PORTADORES DE CADA UNO
DE LOS GENES rfbE, fliC, stx1, stx2, eaeA, Y DE LOS CINCO GENES
POR TIPO DE CANAL / FREQUENCY OF E. coli O157:H7 ISOLATES HARBORING
EACH OF THE GENES rfbE, fliC, stx1, stx2, eaeA, AND THE FIVE GENES
BY KIND OF CARCASS

Tipo de canal   rfbE          fliC          stx1

Bovino          6/9 = 0,666   6/9 = 0,666   4/9 = 0,444

Cerdo           6/9 = 0,666   6/9 = 0,666   3/9 = 0,333

Significancia   NS            NS            NS

Tipo de canal   stx2          eaeA          Cinco genes

Bovino          1/9 = 0,111   1/9 = 0,111   1/9 = 0,1111

Cerdo           3/9 = 0,333   3/9 = 0,333   3/9 = 0,3333

Significancia   NS            NS            NS

NS = diferencia no significativa (P mayor que o igual a] 0,05).
COPYRIGHT 2009 Universidad del Zulia, Facultad de Ciencias Veterinarias
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2009 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Gallegos, Miguel; Morales, Alberto; Alvarez, Genoveva; Vasquez, Jesus; Morales, Lilia; Martinez, Irm
Publication:Revista Cientifica de la Facultad de Ciencias Veterinarias
Date:Mar 1, 2009
Words:4358
Previous Article:Caracterizacion anatomica y fisica de los musculos del conejo.
Next Article:Prevencion de enfermedades podales mediante el recorte fuctional de la pezuna al momento del secado en vacas lecheras confinadas en el tropico.

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters