Printer Friendly

COX-2 AND BRCA1 HAVE ALTERED EXPRESSION PROFILE IN DIFFERENT CANINE TUMORS.

Byline: H. Sadia, S. Manzoor, A. Wajid, M. Tayyab, S. Firyal, A. S. Hashmi, T. Yaqub, Z. U. Mughal, A. K. Mehmood, A. R. Awan, K. Mahmood, M. Y. Khan and M. Wasim

Abstract

Cancer originates from the unnatural divisions of cells that have constant mutations in the genes which are involved in cell propagation and endurance. Dogs are beloved pet animals and they suffer from many cancers like humans. Mutated BRCA1 and COX-2 abnormal gene expression have been seen in a large number of cancers previously. In this research gene sequencing and gene expression of COX-2 and BRCA1 genes in 22 different canine tumors and 25 normal canine samples were performed. All samples were collected from Punjab Province, Pakistan. The whole coding region of COX-2, comprised of almost 1812bp with ten exons in dog and the hot spot N (1, 2 and 12 exons) and C-terminal (18, 19, 20, 21 and 22 exons) of BRCA1 gene which include 2024bp were included in mutational studies. There was no mutation in the coding region of COX-2 and 5'-and -3' region of BRCA1. The gene expression of COX-2 and BRCA1 in all aforementioned tumors was measured by real time qPCR.

BRCA1 high grade negative expression and COX-2 positive gene expression were observed in this study. About 45% tumors showed up-regulation of COX-2 and four tumors showed highest gene expression, two CTVTs, one head tumor and one mammary tumor with fold changes 942.93, 122.79, 85.95 and 44.49 respectively. All granulomas showed down-regulation of COX-2 gene. It has been observed during this study that the loss of BRCA1 gene expression and up-regulation of the COX-2 gene may have a role in canine tumors. Altered expression of COX-2 gene in tumors may have link with the extent of aggressive tumor types. The mechanism behind the abnormal function of these genes is not clear yet, however, abnormal expression of COX-2 and BRCA1 in tumors may be associated with the most aggressive and poor prognosis of cancer types and further studies are required.

Key words: Tumor, Canine transmissible venereal tumors, gene expression, gene sequencing, fold change, mutation.

INTRODUCTION

Cancer is the first cause of death in cats and dogs while in humans it is the second most cause of death (Jemal et al., 2008). According to an assessment, cancer related deaths in the world are 13% and 70% of these aforementioned deaths are in poor countries (World Health Organization, 2012). Such natural cases of cancers in cats and dogs especially, in dogs offer an opportunity to use the dogs for comparative cancer studies and as an animal model for anticancer drug development (Pawaiya, 2008). In a series of more than 2000 autopsies, it was found that almost forty five percent dogs that lived for ten or more years expired because of cancer (Bronson, 1982). A German pathologist Johannes Muller first time demonstrated that cancer cells were originated from a bud called Blastema instead of normal cells (Kardinal and Yarbro, 1979). There are many exogenous and endogenous risk factors that are involved in caner.

Tumor viruses (Bishop 1980), chemical carcinogens (Loeb et al., 2000), natural chemicals, (Ames et al., 1990), herbicides (Glickman et al., 2004), physical carcinogens like radiation (Upton, 1978) are exogenous factors while inherited genetic defects, immune system (Rosenthal, 1998) and hormonal factors (Rodney, 2001) are among endogenous risk factors. In order to induce cancer the mutations must affect a variety of genes that restrain somatic conflict (Frank and Nowak, 2004). These genes are known as cancer related genes.

BRCA1, a tumor suppressor gene is involved in repairing the DNA double strand breaks and in case of failure; it leads the cells towards apoptosis (Starita, 2003). In canine it is located on chromosome 9, it has 22 exons and it encodes a protein of 1882 amino acids. Many scientists from different research showed that women who have familial mutations in the BRCA1 or BRCA2 (BRCA1/2) genes have increased risk of breast cancer (Struewing et al., 1997). Different mutations were found in BRCA1 of different ethnicities. Genetic analyzer can detect even those mutations of BRCA1, which were not detected by DGCG, HPLC and SSCP (Rassi, 2009). Another gene cyclooxygenase-2 (COX-2) synthesizes prostaglandins which participate in arachidonic acid metabolism resulting in various mechanisms that leads to cancer development. COX-2 is usually absent in normal cells and it has been implicated in carcinogenesis of several neoplasms in companion animals.

It was first isolated from prostate gland that's why it is called as prostaglandin. The extracellular inducible factors of COX-2 include growth factors, tumor promoters, cytokines, hypoxia, ionizing radiation and carcinogens (Singh, 2002; Howe, 2003; Wang, 2004). In canine genome COX-2 is present on chromosome 7; it has 604 amino acids and 10 exons. COX-2 was first reported in 1991 by a group of scientists and they described a viral oncogene or a tumor promoter had induced the COX-2 (Xie et al., 1991). Mutated p53 had also been detected in stronger expression of COX-2 gene in tumors as compared to tumors with non-mutated p53 (Leung et al., 2001). This correlation of COX-2 in cancer development suggests it as a new therapeutic target.

Seven types of tumors were included in this research work, including Mammary tumor, Canine transmissible venereal tumor (CTVT) (This tumor transmits sexually by genitalia of male and female dogs, Perianal adenoma (tumor of glands around the anus of dogs), Lymphoma (tumor of lymph nodes), Granuloma (tumor of granulocytes and macrophages) and Pelvic wart tumor (tumor of squamous cells of pelvic regions).

This research aimed to study the mutations in BRCA1 and COX-2 isolated from tumor samples as compared to normal samples, secondly to find out the gene expression of BRCA1 and COX-2 in the tissues of mammary tumor as compared to normal mammary tissues and thirdly to co-relate the type of mutations with mammary tumors as compared to normal samples.

MATERIALS AND METHODS

Sample Collection: In this research work total twenty two (n=22) tumors and twenty five (n=25) normal samples of dogs (Canis familiaris) were collected from Pet Centre UVAS, Asim Pet Clinic, Lahore and Outdoor Teaching Veterinary Hospital (Layyah Campus), UVAS (Table 1, 2). In dogs normal samples were obtained after autopsy (euthanasia). Samples were collected after proper diagnosis of tumor type and approval of ethical committee of the University of Veterinary and Animal Sciences, Lahore, Pakistan. Tumors of different breeds including German shepherds, Labrador, Rottweiler, English Springer, Sheepdog and non descriptive breeds were collected. These tissue samples were excisional biopsies obtained after surgery. In case of CTVT some flimsy tissues were collected. Tissues were also stored in RNAlater solution for long term storage according to manufacturer protocol (www.lifetechnologies.com).

Histopathological examination: Formalin fixed, paraffin embedded tissues were examined histopathologically. Tissues were placed in 10% formalin solution. The core region of tumortissue was used for Hematoxyline and Eosin staining. The grading and staging of tissues were determined (Lester, 2010) (Figure 1)

DNA isolation and PCR Amplification and Sequencing: DNA was isolated from tumors and normal tissues by using TIANGEN biotech genomic DNA tissue kit (Tiangin Biotech Co., Mainland, Beijing, China) from the tumor tissues according to manufacturer's guidelines and protocols. Total DNA concentrations were measured with NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Pittsburg, PA, USA). The DNA of all samples was brought to equal concentration (50ng/u L). Primers for COX-2 gene (10 exons, all the coding region) and primers for 5' (exon numbers 1, 2 and 12) and 3' region (exon numbers 18, 19, 20, 21 and 22) of BRCA1 gene were designed by primer 3 software. Primer details are given in Table 3 and Table 5. PCR for each primer pair was optimized by using different amounts of MgCl2, dNTPs, buffer, primers and DNA (Table 4 and 6). All reactions were optimized at touchdown PCR conditions having a range of 54C -64C for COX-2 gene and 50 C-65 C for the BRCA1 gene.

The following timings and ranges were used, 1st hold was 95C for 5 minutes, then 94 C for 30 seconds, annealing at 64C for COX-2 and at 65C for BRCA1 for 30 seconds and extension at 72Cfor 45 seconds. The same was repeated for 10 times, with a decrease in 1C with every one cycle (COX-2 gene) while for the BRCA1 primers, this cycle was repeated 15 times, the second hold (2nd) was at 95C for 5 minutes, 94C for 30 seconds, annealing at 54C and extension at 72C for 45 seconds, 2nd hold was repeated 30X times at 54C for COX-2 and 50C for BRCA1 and the final extension at 72C was performed for ten minutes for COX-2 and for 25 minutes for BRCA1. To check the proper size of PCR products, all the PCR products were run on 1.5% agarose gel along with 1Kb Ladder (Fermentas, USA), the gel was stained with ethidium bromide and then it was visualized under ultraviolet radiations.

Each PCR product was purified by QIAGEN PCR purification kit and PCR products were sequenced at ABI 3730 genetic analyzer (Sanger chain termination method).

Total RNA Isolation: RNA was extracted from tumors and normal tissues by thermo scientific Gene Jet RNA purification kit (Boom et al., 1990). RNA was also extracted manually by TRIzole method from those tissues which were in small amounts (Hummon et al., 2007). RNA integrity was determined by agarose gel electrophoresis and concentrations were measured by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Pittsburg, PA, USA) and were equalized to 200ng/u L.

Reverse transcriptase chain reaction for cDNA synthesis: Complementary DNA (cDNA) was prepared by Enzynomics cDNA synthesis kit (www.enzynomics.com). Oligo (dT)18 primers and random Hexamer primers were used simultaneously to produce first strand cDNA. Poly (A) tail of mRNA aneal with oligo (dT) 18 primers to synthesize cDNA while for the rest of RNA population, random primers initiate cDNA synthesis.

TaqMan primer-probe designing and RT-qPCRTaqMan detection chemistry: Pre-designed primers and probes for BRCA1 and COX-2 genes were used (Invitrogen) and for GAPDH (Housekeeping gene) was custom designed by using primer express software available with the Real Time PCR instrument (ABI). The following cat numbers of BRCA1 (cf02625922_m1), COX-2 (cf02625599_g1), GAPDH (cat #4331348 Custom) and reaction mixture (cat #4370048) were used (Table 7). GAPDH is a housekeeping gene and it was used for normalization in this qPCR. BRCA1 and COX-2 primers were FAM dye labeled at 5' end and TAMRA dye labeled at 3' end while GAPDH was labeled with a VIC dye at 5' end and TAMRA dye at 3' end.

RT qPCR Protocol: The qPCR was performed according to the protocol of the manufacturer (Applied Biosystem, USA). Twenty microlitre (20u L) reaction volume was used, which contained 10u L of 2X TaqMan gene expression master mixture, 1u L 20X TaqMan gene expression assay, 4u L of cDNA and 5u L of RNase free DEPC treated water was used in a single reaction.

RT-qPCR Experimental design: Real Time PCR was performed in triplicates according to ABI standard protocols (Both for target gene and control gene in tumors and normal samples as well). Singleplex 2 step qPCR was performed in triplicates according to ABI protocol (https://tools.lifetechnologies.com). Both targets (BRCA1, COX-2) and endogenous control/reference (GAPDH) were amplified in triplicates. Forty cycles of qPCR were performed for better amplification.

Rt qPCR data analysis by Livak Method (DDCt method): Cycle threshold (Ct) values were obtained and gene expression was calculated in fold change. The gene expression was measured in fold changes by using the DDCt method also called as comparative Ct method or relative quantification method (Livak and Schmittgen, 2001). Relative quantification is the most commonly used method of gene expression when target transcript of treatment group and control group is compared. Relative transcript abundance of the genes (BRCA1 and COX-2) was measured as (DCt test=Cttarget - Ctreference) for tumors while normal samples as (DCt calibrator=Cttarget - Ctreference).

Relative changes in tumors and normal samples were measured as DDCt (DDCt=DCttest - DCtcalibrator) and fold change values of tumor were measured by fold change= 2 -DDCt.

RESULTS

Histopathological (Hematoxyline and Eosin stained) slides of mammary tumors were analyzed (Figure-1a). All tumor samples were benign, having no cell at mitosis stageIn the cytoplasm, a large number of collagen fibers and fibroblasts were present. Samples were properly diagnosed by qualified veterinarians and histopathologists. In perianal adenoma, there was no cell in mitotic stage, so it was looking an adenoma not the malignant tumor (Figure-1a) while in one granuloma, multiple granulomas were present, which were surrounded by fibrous connective tissues and were applying pressure on surrounding tissues (Figure-1b). Another granuloma had mononuclear inflammatory cells in the dermis and there was necrosis of epidermal layers and inflammation (Figure-1c). CTVT histochemistry revealed that there were round oval nucleoli, coarsely aggregated chromatin, usually a prominent nucleus and abundant cytoplasm and cells at mitotic stage (Figure - 1d).

Mutational studies: The sequencing of N (5') and C (3') terminal of BRCA1 and whole coding region of COX-2 was done by the Sanger sequencing method. The sequences of reference genes of BRCA1 gene (Ensemble Accession, ENSCAFG00000014600) and COX-2 gene (Ensemble Accession, ENSCAFG00000013762) were used as a query and the sequences of the BRCA1 gene and COX-2 gene obtained by sequencing were aligned together. The complete analysis of sequences was performed manually and by using computational methods (Bio edit and BLAST softwares). All the selected regions of BRCA1 and COX-2 were conserved in all tumors of dogs. The results showed that there was no mutation in the studied regions of these genes.

Gene expression of COX-2 and BRCA1: Cycle threshold (Ct) values of COX-2 were obtained by RT-qPCR method and the fold change was determined by Livak method. Mean DCt (0.75-0.9) of normal tissues was calculated by subtracting mean Ct target (COX-2) from the mean Ct reference/endogenous (GAPDH) of respective normal tissues. Altered gene expression was observed in tumor samples as compared to normal mammary tissues. COX-2 gene expression was positive in all tumor samples (Figure 3). The highest fold changes were observed in four samples, two CTVTs, one head tumor and one mammary tumor of the dog. They have 942.93, 122.79, 85.95 and 44.49 fold change, respectively (Figure 4). These tumor samples were aggressive tumors, having larger sizes as compared to other tumors. There may be co-relation of up-regulation of COX-2 withaggressiveness of tumors.

Table 1. Tissue sample collection, tumors of dogs (age, sex, breed and collection site).

Sr####Animal###Breed###Gender###Age###Location###Type of tumor

01###Dog###German Shepherd###M###7years###Pet Centre, Lahore.###Lymphoma

02###Dog###German Shepherd###F###9 years###Pet Centre, Lahore.###Mammary tumor

03###Dog###English Springer###F###6 years###Pet Centre, Lahore.###CTVT

04###Dog###German Shepherd###F###8 years###Pet Centre, Lahore.###Mammary tumor

05###Dog###German Shepherd###M###8 years###Pet Centre, Lahore.###CTVT

06###Dog###German Shepherd###M###13 years###Asim Pet Clinic, Lahore.###Perianal adenoma

07###Dog###German Shepherd###M###2 years###Asim Pet Clinic, Lahore.###Oral tumor

08###Dog###German Shepherd###F###2 years###Asim Pet Clinic, Lahore.###CTVT

09###Dog###German Shepherd###F###10 years###Asim Pet Clinic, Lahore.###Mammary tumor

10###Dog###German Shepherd###F###11 years###Pet Centre, Lahore.###Mammary tumor

11###Dog###German Shepherd###M###10.5 years###Pet Centre, Lahore.###Peri-anal adenoma

12###Dog###German Shepherd###F###3.5 years###Pet Centre, Lahore.###Peri-anal adenoma

13###Dog###Non descriptive###M###5 years###Pet Centre, Lahore.###Oral tumors

14###Dog###Non descriptive###M###12 years###Pet Centre, Lahore.###Lymphoma

15###Dog###Non descriptive###F###11 years###Pet Centre, Lahore.###Mammary tumor

16###Dog###German Shepherd###F###2.5 years###Pet Centre, Lahore.###CTVT

17###Dog###Rottweiler###F###2 years###Pet Centre, Lahore.###Granuloma

18###Dog###German Shepherd###M###3 years###Pet Centre, Lahore.###Granuloma

19###Dog###German Shepherd###F###2 years###Pet Centre, Lahore.###CTVT

20###Dog###German Shepherd###F###2.5 years###Pet Centre, Lahore.###CTVT

21###Dog###German Shepherd###M###2.5 years###Asim Pet Clinic, Lahore.###Head tumor

22###Dog###German Shepherd###M###2.5 years###Pet Centre, Lahore.###Pelvic wart tumor

Table 2. Tissues sample collection, normal dog samples (age, sex, and breed and collection site).

Sr####Animal###Breed###Gender###Age###Location###Type of tissues

01###Dog###Non descriptive###F###3 years###Surgery Department, (SD),###Mammary tissues

###UVAS, Lahore.

02###Dog###English Springer###F###2years###SD, UVAS, Lahore.###Mammary tissues

03###Dog###Non descriptive###F###1.5years###SD, UVAS, Lahore.###Mammary tissues

04###Dog###German Shepherd###F###4 years###SD, UVAS, Lahore.###Mammary tissues

05###Dog###German Shepherd###F###4 years###SD, UVAS, Lahore.###Mammary tissues

06###Dog###German Shepherd###M###5 years###SD, UVAS, Lahore.###Liver tissues

07###Dog###German Shepherd###F###3 years###SD, UVAS, Lahore.###Vaginal tissues

08###Dog###German Shepherd###F###3 years###SD, UVAS, Lahore.###Vaginal tissues

09###Dog###German Shepherd###F###3 years###SD, UVAS, Lahore.###Vaginal tissues

10###Dog###German Shepherd###M###3 years###SD, UVAS, Lahore.###Penis tissues

11###Dog###German Shepherd###M###3 years###SD, UVAS, Lahore.###Prepuce tissues

12###Dog###German Shepherd###M###3 years###SD, UVAS, Lahore.###Penis tissues

13###Dog###German Shepherd###M###5 years###SD, UVAS, Lahore.###Pelvic tissues

14###Dog###German Shepherd###M###3.5 years###SD, UVAS, Lahore.###Pelvic tissues

15###Dog###German Shepherd###M###3 years###SD, UVAS, Lahore.###Pelvic tissues

16###Dog###English Springer###M###4years###SD, UVAS, Lahore.###Oral tissues

17###Dog###M###4.5 years###SD, UVAS, Lahore.###Oral tissues (Normal)

18###Dog###German Shepherd###F###3 years###Out-Door Teaching Veterinary###Oral tissues (Normal)

###Hospital (TVH) Layyah, Campus,

###UVAS.

19###Dog###Rottweiler###M###3.5 years###TVH, Layyah Campus###Lymph nodes (Normal)

20###Dog###Rottweiler###F###2 years###TVH, Layyah Campus###Lymph nodes

21###Dog###Rottweiler###M###2.5 years###TVH, Layyah Campus###Lymph nodes

22###Dog###German Shepherd###M###5 years###TVH, Layyah Campus###Lung tissues

23###Dog###Rottweiler###M###2 years###TVH, Layyah Campus###Perianal tissues

24###Dog###Rottweiler###M###3 years###TVH, Layyah Campus###Perianal tissues

25###Dog###German Shepherd###M###4 years###TVH, Layyah Campus###Perianal tissues

Table 3. Primers details of COX-2 Gene (Canine).

Primers Name###GU %###Sequence 5'-3'###Primer Lenngth###Tm###Product Length (bp)

COX-2-1F###55###AGGAAGGTTCCGTCCGTTAG###20###60.49###370

COX-2-1R###50###AAACGGTCCAAGCCCTTTAC###20###60.39###370

COX-2-2F###50###TCCCTGGTTGAACGTTGT###18###50.01###412

COX-2-2R###45###ATTTGGAGTGGGTTTCAGGT###20###58.35###412

COX-2-3F###57.89###CACGTAAGTGTGCCCTTGG###19###60.16###382

COX-2-3R###55###CCCCACTCAGGTTCATTCTC###20###59.15###382

COX-2-4F###47.62###TCGGTCTTTAGTGCCACTTTG###21###60.29###376

COX-2-4R###33.33###TTCACAGATATCCTCAAGCAAAAA###24###60.13###376

COX-2-5F###41.47###CAGTTCACACCTTTATTTCTCCTG###24###59.24###416

COX-2-5R###47.62###CAACCCACTCATTTCCTCTCT###21###59.88###416

COX-2-6F###43.48###TTAGTGGTTGTGAGAGAAACGTG###23###59.34###374

COX-2-6R###50###CAAACTGCAGGTGTTCAGGA###20###59.87###374

COX-2-7F###34.78###CAAATATCACCTTCTTCCATTC###23###57.56###395

COX-2-7R###45###GGGGAGAGGGTTTTATTGAA###20###57.97###395

COX-2-8F###38.1###GATTGCATTTCAGTTGCTTGA###21###58.91###399

COX-2-8R###42.86###AAACATCACTTTCCTCCCACA###21###59.73###399

COX-2-9F###40###CCCAAGGAATTTCCTCCCACA###20###59.02###381

COX-2-9R###50###CAGGCCATTTCCTTCTCTCCT###20###58.47###381

COX-2-10F###35###TTGAAACCAATTCACCAAA###19###58.33###555

COX-2-10R###29.15###AATTAAGTTAAAAGGAATCGTCCA###24###57.5###555

Table 4. PCR recipe of individual primers for COX-2 gene (Canine).

Primers###Reagents###Total

###DNA (50ng/u1)###PCR Buffer (2mM) MgCL (2mM)###Primer F (10pM)###Primer R (10pM)###dNTPs (25mM)###Taq Polymerase###Water

###(5u/u1)

###u1###u1###u1###u1###u1###u1###u1###u1###u1

COX-2 1###2###2.5###2###1###1###2.5###0.5###13.5###25

COX-2 2###1###2.5###2.5###1###1###2.5###0.5###14###25

COX-2 3###1###2.5###2.5###0.75###0.75###2.5###0.5###14.5###25

COX-2 4###3###2.5###2.5###0.75###0.75###2###0.5###13###25

COX-2 5###3###2.5###2.5###0.75###0.75###2.5###0.5###12.5###25

COX-2 6###3###2.5###2.5###1###1###2###0.5###12.5###25

COX-2 7###2###2###2###1###1###2###1###14###25

COX-2 8###2###2.5###2.5###1###1###2.5###1###12.5###25

COX-2 9###2###2.5###2###1###1###2.5###0.5###25

COX-2 10###1###2.5###2.5###1###1###2.5###0.5###14###25

In addition, these lower fold change values also showed a positive behavior of COX-2 gene expression which could be co-related with the previously reported gene expression studies based on immunohistochemistry, indicating the positive gene expression as the abnormal function of COX-2 gene. There was up-regulation of 3/6 (50%) CTVTs, 2/5 (40%) mammary tumors of dogs, 1/2 (50%) oral tumors, 2/2 (100%) lymphoma, 1/3 (33%) perianal adenoma, while single cases of head tumor and pelvic wart tumor were studied. Pelvic wart tumor was down regulated with 0.22 fold change and all granulomas 0/2 (0%) were down regulated with fold changes i.e. 0.11 and 0.05, respectively (Figure 3). Gene expression of BRCA1 was negative in all tumors of dogs (Figure 2), which indicated the abnormal behavior of BRCA1 gene expression in all tumors. The BRCA1 gene expression has been found to be down regulated or having no expression in breast cancers in humans, the same pattern was observed in mammary tumors in dogs.

Table 5.BRCA1 selected portion for Sequencing and primers' details.

Primers Names###GC %###Primer Sequence 5'-3'###Base Pairs###Tm###Product Length (bp)

BRCA1-1F5t###40###GACATCTAATGAAACTAGGCTGTTC###25###57.66###358

BRCA1-1R5t###40.91###CCAAAGCTCCTGAGTTAAGAAA###22###57.83###358

BRCA1-2F5t###45###CGCAGCTTAAAGTTGTGCTT###20###58.4###297

BRCA1-2R5t###50###TGGCTTGCTAAGTACTCTGAGG###22###58.81###297

BRCA1-12F5t###47.62###TGATTGTCACAGGTTGCTCCT###21###60.71###473

BRCA1-12R5t###50###CCTGACCTTCAAAAGGGACA###20###60.08###473

BRCA1-18F3t###52.38###CAGCAGCTGAGATACTGGTCA###21###59.2###481

BRCA1-18R3t###45###TTGGGCTTGGTCTCTCAAAT###20###59.67###481

BRCA1-19F3t###50###TCTCTGGGAAGGAGCAGAAA###20###60.07###400

BRCA1-19R3t###55.56###GGGCACAGGGCTGTTTTT###18###61.05###400

BRCA1-20F3t###45###TGTGTTTTGGAGCAAAGACG###20###59.88###374

BRCA1-20R3t###55###ATCCTCCACAGAGGGGAGTT###20###59.93###374

BRCA1-21F3t###55###CTATCCCTCCGACCCTTCAT###20###60.29###382

BRCA1-21R3t###52.38###CCCATCTCTCACAGGCACAT###20###59.93###382

BRCA1-22F3t###55###TTGCACCTACCTGAGGAACC###20###60.11###387

BRCA1-22R3t###42.86###TTCAAAGGGAGACTTGAAGCA###21###59.98###387

Table 6. PCR Reaction compositions for BRCA1 for PCR (Canine)

Primers###Reagents###Total

###DNA (50ng/u1)###PCR Buffer (2mM)###MgCL2 (2mM)###Primer F (10pM)###Primer R (10pM)###dNTPs (25mM)###Taq Polymerase (5u/u1)###Water

###u1###u1###u1###u1###u1###u1###u1###u1###u1

BRCA1-1###1###2.5###2.5###0.75###0.75###2.5###0.5###14.5###25

BRCA1-2###1###2.5###2.5###1###1###2.5###0.5###14###25

BRCA1-12###2###2.5###2###1###1###2.5###0.5###13.5###25

BRCA1-18###3###2.5###2.5###0.75###0.75###2###0.5###13###25

BRCA1-19###3###2.5###2.5###1###1###2###0.5###12.5###25

BRCA1-20###3###2.5###2.5###0.75###0.75###2.5###0.5###12.5###25

BRCA1-21###2###2.5###2.5###1###1###2.5###1###12.5###25

BRCA1-22###2###2###2###1###1###2###1###14###25

Table 7: Primers and probes selected kits 'details of BRCA1, COX-2 and GAPDH genes

Gene###Species###Transcript###Amplicon###Exon###Kit ID###Dye

###length###boundary/Assay

###location

BRCA1###Dog###NM_001013416###65###14-15, 5001###cf02625922_m1###FAM-MGB

COX-2###Dog###NM_001003354.1###105###3-4, 341###cf02625599_g1###FAM-MGB

(PTGS2)

GAPDH###Dog###N2M_00100314###59###655###cat # 4331348 Custom###VIC-MGB

DISCUSSION

In this study the role of BRCA1 and COX-2 genes in different canine tumors was studied. Expression and mutational studies were performed to find out any abnormality in these genes in tumor samples as compared to normal samples. The regulation of cell proliferation, stability of the genome and programmed cell death are important for systemic homeostasis.

Two types of genes are very important in cell cycle, tumor suppressor genes and proto-oncogenes. The proto oncogenes that enhance DNA synthesis, cell division and its growth become cancerous when they are mutated (Adamson, 1987). One important enzyme cyclooxygenase-2 (COX-2) synthesizes prostaglandins which participate in arachidonic acid metabolism resulting in various mechanisms that lead to cancer development.

BRCA1 is a tumor suppressor gene and C (3') and N (5') terminals of BRCA1 gene are considered as hot spot for BRCA1 mutations and mutated or abnormal C and N terminals lead to disturbing many cell signaling processes of cell division. As the role of BRCA1 and COX-2 genes have been studied in human tumorogenesis and oncogenesis. This study was designed to see the role of these genes in canine tumors. COX-2 is not constitutively produced in the cells while it is induced in inflammation and cancer. The extracellular stimuli that induce COX-2 include growth factors, cytokines, tumor promoters, hypoxia, ionizing radiation and carcinogens (Singh, 2002; Howe, 2003; Wang, 2004). Gene sequencing and expression of the 22 different canine tumors and 25 different normal tissues for COX-2 and BRCA1 genes were performed.

Our focus was to study the C (3') and N (5') terminus of BRCA1 and whole coding region of COX-2 for mutational analysis in different tumors of dogs and also the gene expression study of BRCA1 in these tumors as well. The 5' and 3' terminal of BRCA1 gene was sequenced to see variants in it and its comparison to the reference sequence. Exon 1, 2, 12, 18, 19, 20, 21, and 22 of BRCA1gene were selected for mutational analysis but no mutation was found in these exons. Although in humans, the BRCA1 mutations have been strongly related to hereditary breast cancers, however, the types of mutations differ in distribution according to geography and ethnicity. For Ashkenazi Jewish the "hot spot" mutations are present at 5382insC and 185delAG (Abeliovich et al., 1997), whereas in Swedish people 3171ins5 is considered as the highest risk familial mutation (Einbeigi et al., 2001). The prevalence of BRCA1mutations also varies in diverse populations.

For example, the BRCA1mutation frequency in Sweden is 7% (Zelada-Hedman et al., 1997) while Finnish breast cancer patients have 0.4% (Syrjakoski et al., 2000). But in case of dogs, we did not find any mutation in sporadic mammary tumor. There was no variation in the entire coding region of COX-2 as well. There is limited literature about knowledge of mutation of COX-2 in human and in canine tumors. Role of COX-2 and IL-10 SNPs was studied in 290 squamous cell carcinoma of head and neck tumor (SCCHN) of Korean samples and in COX-2, -1329A>G,+1266C>T and +6365 T>C SNPS were found but there was not a significant association between (SCCHN) and the SNPs (Jeong et al., 2010). A group of researchers examined the association between mutation inp53 and COX-2 expression in gastric cancer (Leung et al., 2001). Similarly, different groups showed the mutation of any other gene, which in turn induced the COX-2 gene expression.

Gene Expression of BRCA1 and COX-2 was also measured in canine tumors under this study. In the human BRCA1 role has been studied in different cancers, especially in, ovarian (Matsushima et al.,1995), head and neck (Buchholz et al., 2002), renal form of tumors (Kawakami et al., 2003), lung (Taron et al., 2004), pancreatic (Cybluski, 2007) and skin tumors (Monnerat et al., 2007) but its extensive role was studied in majority of ovarian and breast cancers (both sporadic and hereditary) (Easton et al., 995). As the dogs live in the same environment as that of humans, so the etiology and pathogenesis of dog tumors is considered as the most similar to human tumors (MacEwen, 1990, Vail, 2000; Khanna 2006; Pinho, 2012; Marconato, 2013). In all studied tumor samples we found BRCA1 negative-regulation as compared to normal samples. These results are in line with the findings of Navaraj and colleagues (2009).

They found that the loss of BRCA1 function in knockdown mice showed the angiogenic potential and tumorogenesis (Navaraj et al., 2009). BRCA1 deficiency and haploinsufficiency accelerated tumorogenesis was also determined by karyotyping analysis in knockdown mouse model having deletion of BRCA1 gene (Trilett et al., 2008). So, the loss of BRCA1 gene expression in this research work showed a loss of function of this gene in our tumor samples as well. BRCA1 putative role was also studied in Japanese population. The whole coding region of BRCA1 had no mutation in somatic ovarian cancers however, 4 SNPs, two frame shifts, one nonsense mutation and one intronic substitution of near to exon 22 was observed (Matsushima et al., 1995).

Although BRCA1 is found responsible in the majority of breast cancers in humans with familial history, however, its involvement in sporadic breast cancer (especially of Pakistani population) is an area that requires further research. One group from Pakistan (Malik et al., 2008) studied the N and C terminal of the BRCA1 gene and they found 5 silent and one splice site mutation in the BRCA1 gene. However, most of the BRCA1 region analyzed by this group remained conserved at the genomic level. BRCA1 promoter methylation was reported to be involved in tumor progression. BRCA1 expression is often reduced in sporadic breast cancers, and it has been reported even in the absence of its genetic modifications, but the molecular basis for this is not clear (Gustavo, 2003; Penney, 2010).

COX-2 gene expression was positive in all tumors. All canine tumors showed abnormal expression of COX-2 varying in different fold change values from lowest to highest fold changes. The highest fold change values were observed in 2/6 CTVT tumors that were 122.79 and 942.93 respectively. The second and third one highest fold change values were observed in head tumor and in 1/5 canine mammary tumor i.e. 85.95and 44.65 fold change, respectively. Similar results were obtained by other scientists and one group observed that COX-2 was not expressed in normal tissues, but showed increased expression in benign (24%) and malignant (56%) tumors, indicating a possible role in tumorogenesis (Dore et al., 2003). All tumor samples showed positive gene expression of COX-2, however, the 45% of all tumors studied showed up-regulation as compared to the normal samples studied in this research work.

Molecular studies have revealed that COX-2 is inducible only and either negative or very low expression of COX-2 gene in normal samples has been seen. The up regulation of COX-2 in many types of neoplasms and regular use of nonsteroidal anti-inflammatory drugs reduce the risk of colon cancer (43%), breast cancer (25%), lung cancer (28%) and prostate cancer (27%) (Harris, 2009). Five (n=5) mammary tumors of dogs were included in this study. Out of five, two tumors showed up regulation, MT1 and MT2 with 44.49 and 1.28 fold change values while other three MT3, MT4 and MT5 showed 0.16, 0.3 and 0.75 fold changes, respectively. About 20% canine mammary tumor samples had highest up-regulation and the same percentage was for intermediate up-regulation while remaining 60% showed low positive expression of COX-2 gene. These results co-relate with previously reported gene expression studies based on immunohistochemistry, indicating the positive gene expression as the abnormal function of COX-2 gene.

All six CTVT samples were found to have positive expression for COX-2. Two samples CTVT1 and CTVT6 showed very high expression with 942.93 and 122.29 fold up-regulation respectively. One CTVT showed intermediated up-regulation of COX-2 with fold change 1.12 while other three samples of CTVT i.e 3, 4, 5 showed positive expression for COX-2 with 0.05, 0.03 and 0.19 fold change which was down-regulated as compared to normal samples. Two canine lymphomas were studied in this research work. Both showed intermediate up-regulation and 100% positive COX-2 gene expression with 1.18 and 1.07 fold changes. Scientists investigated that stromal cells of follicular lymphoma produced large amount of prostaglandins and COX-2 inhibitors like celecoxib were used successfully against this tumor (Gallouet et al., 2014).

In another study, the researchers found the correlation of COX-2 with primary effusion lymphoma (PEL) and they identified that nimesulide was acting as an inhibitor of COX-2 in treating primary effusion lymphoma (Paul et al., 2011).

Three perianal adenomas of dogs were examined for COX-2 gene expression. One tumor PA1 had 2.18 fold change in gene expression while PA2 and PA3 had 0.14 and 0.53 fold changes, respectively. So, 33.33% perianal tumors had up-regulation while others 66.66% were positive but did not show up-regulation as compared to normal samples. There are also reports about the role of COX-2 in companion animals. In one study, seventy-six percent (76%) anal sac adenocarcinoma had 50% positive COX-2 immunostaining, so this study also suggested using the cyclooxygenase-2 inhibitors for anal sac adenomas and adenocarcinomas (Knudsen et al., 2013). Two granulomas studied in this research work showed down regulation of COX-2, although both tumors were positive in COX-2 gene expression (0.11 and 0.05 fold change). COX-2 and IL-10 higher expression has been seen in oral pyogenic granuloma (Isaza-Guzman et al., 2012).

The pelvic wart tumor was purposeful for this study as it was a different type of tumor, which was present in the form of boils in the pelvic region of dog. It had very low positive COX-2 expression which was also lower as compared to normal samples. The COX-2 over expression in actinic keratosis, squamous cell carcinoma and inflammatory dermatoses of canine and feline was determined (Bardagi et al., 2012) and COX-2 inhibitors have been used for these tumors (Pestili de Almeida et al., 2001). One head tumor was also considered in this study. This tumor was present on the head and was very aggressive (large sized tumor). This tumor had 85.95 fold-change which was very high fold change as compared to normal samples. The anti-metastatic effect of COX-2 inhibitors has been seen in head and neck tumor of human (Fuiji et al., 2014; Kao et al., 2009). Similarly, two oral tumors were studied.

Both tumors showed positive gene expression with 0.57 and 2.81 fold change values. The latter had moderate up-regulation of COX-2 while the first one was within normal range. Scientists studied the COX-2 gene expression (immunohistochemistry) in oral squamous cell carcinoma; oral lichen planus and normal oral mucosa. The highest gene expression was in oral squamous cell carcinoma, i.e. 68.4%, then oral lichen planus (24.2%) and there was no expression in normal oral mucosa (Li et al., 2013).

Conclusion: These findings support a role of BRCA1 and COX-2 genes in the pathogenesis of these tumors. This is the first study in Pakistan to investigate the role of aforementioned genes in different tumors of dogs. The mechanism behind the loss of function of BRCA1 and up-regulation of COX-2 still needs more research. We did not find any tumor associated mutations, however, our results co-relate with the previous studies of BRCA1 and COX-2 involvement in inflammation and tumorogenesis. There is a dire need to study the other coding as well as non-coding regions of BRCA1 to find out the reasons of abnormal function of BRCA1 and also it is extremity to find out other proto oncogenes which are directly linked in up-regulation of COX-2 gene expression.

Acknowledgements: We are thankful to the veterinarian of Pet Center, Asim Pet Clinic and Outdoor TVH, Layyah Campus (UVAS) for their contribution in sample collection (tumor and normal samples). We pay our gratitude to the whole staff of Molecular Biology and Biotechnology (MBBT), and Quality Operation Lab, UVAS, Lahore. Special thanks to Higher Education Commission Pakistan for providing funds for this research work.

REFERENCES

Abeliovich, D., L. Kaduri, I. Lerer, N. Weinberg, G. Amir, M. Sagi, J. Zlotogora, N. Heching, and T. Peretz (1997). The founder mutations 185delAG and 5382insC in BRCA1 and 6174delT in BRCA2 appear in 60% of ovarian cancer and 30% of early-onset breast cancer patients among Ashkenazi women. ICAN J. Human Genetics.60: 505-514.

Adamson, E.D. (1987). Oncogenes in development. Development.99: 449-471.

Ames, B.N., M. Profet and L.S, GLD (1990). Nature's chemicals and synthetic chemicals: Comparative toxicology. Proceedings of the National Academy of Sciences of the United States of America. 87: 7782-7786.

Bakhle, , Y.S., and R.M. Botting (1996).Cyclooxygenase-2 and its regulation in inflammation. Mediators of Inflammation. 5: 305-23.

Bardagi, M., D. Fondevila, And L. Ferrer (2012). Immunohistochemical detection of COX-2 in feline and canine actinic keratoses and cutaneous squamous cell carcinoma. J. Comparative Pathology. 146: 11-17.

Bishop, J.M. (1980). The molecular biology of RNA tumor viruses: A physician's guide. New England J. Medicine. 303:675-682.

Bronson R.T. (1982). Variation in age at death of dogs of different sexes and breeds. American meningiomas: real time PCR and immunohistochemistry. Appl. Immuno. Histochem. Mol. Morphol. 15(2):187-92.

Buchholz, T.A., X. Wu, A. Hussain, S.L. Tucker, G.B. Mills, B. Haffty, S. Bergh, M. Story F.B. Geara, and W.A. Brock (2002). Evidence of haplotype insufficiency in human cells containing a germline mutation in BRCA1 or BRCA2. Int. J. Cancer.97557-61.

Cybluski, C. (2007). Selected aspects of inherited susceptibility to prostate cancer and tumors of different site of origin. Hereditary Cancer in Clinical Practice. 5:164-79.

Dore, M., I. Lanthier, and J. Sirois (2003). Cyclooxygenase-2 expression in canine mammary tumors. Veterinary Pathology. 40(2):207-12.

Easton, D., D. Ford, And D. Bishop (1995). The Breast Cancer Linkage Consortium.Breast and ovarian cancer incidence in BRCA1-mutation carriers. American J. Human Genetics. 56:265-271.

Einbeigi, Z., J.M. Meis-Kindblom, L.G. Kindblom, A. Wallgren and P. Karlsson (2002).Clustering of individuals with both breast and ovarian cancer--a possible indicator of BRCA founder mutations. Acta Oncolology .41: 153-7.

Frank, S.A. (2007). IN: Dynamics Of Cancer: Incidence, Inheritance, And Evolution (Princeton (NJ).

Gallouet, A.S., M. Travert, L. Bresson-Bepoldin, F. Guilloton, C. Pangault, S. Caulet-Maugendre, T.Lamy, K. Tarte and T. Guillaudeux (2014). COX-2-independent effects of celecoxib sensitize lymphoma B cells to TRAIL-mediated apoptosis. Clinical Cancer Research. 20: 2663-2673.

Gustavo, B., B. Sabrina, B. Barbara, T. Sanjay, P. Francesca, T. Francesco, T., P. Monica Fedele, M. and J.E. Haber (2000).Partners and pathways repairing a double-strand break. Trends in Genetetics., 16: 259HALL, J.M., LEE, M.K., NEWMAN, B., MORROW, J.E., ANDERSON, L.A AND HUEY, B., 1990. Linkage of early onset familial breast cancer 7q21. Science. 250: 1684-1689.

Howe, L.R., and A.J. Dannenberg (2003). J. Mammary Gland Bioloogy and Neoplasia.8: 31-43. Hummon, A.B., S.R. Lim, M.J. Difilippantonio, and T. Ried (2007). Isolation and solubilization of proteins after TRIzolR extraction of RNA and DNA from patient material following prolonged storage. Biotechniques.42:467.

Isaza-Guzman, D.M., C. Teller-Carrero, M.P. Laberry-Bermudez, L.V. Gonzalez-Perez, and S.I. Tobon-Arroyave (2012). Assessment of clinicopathological characteristics and immunoexpression of COX-2 and IL-10 in oral pyogenic granuloma. Archives of Oral Biology. 57: 503-512.

Jeong, S.W., K. Tae, S.H. Lee, K.R. Kim, C.W. Park, B.L. Park and H.D. Shin (2010). Cox-2 and IL-10 polymorphisms and association with squamous cell carcinoma of the head and neck in a Korean sample. J. Korean Med. Sci., 25: 1024-1028.

Kao, J., A.T. Sikora, and S. Fu (2009). Dual EGFR and COX-2 inhibition as a novel approach to targeting head and neck squamous cell carcinoma. Current Cancer Drug Targets. 9: 931-937.

Kardinal, C.G., and J.W. Yarbro (1979). A conceptual history of cancer. Semininars in Oncology.6: 396-408.

Kawakami, T., K. Okamoto, O. Ogawa, and Y. Okada, (2003). Multipoint methylation and expression analysis of tumor suppressor genes in human renal cancer cells. Urology., 61:226-30.

Khanna, C., K. Lindblad-Toh, and D. Vail (2006). The dog as a cancer model. Nature Biotechnology. 24( 9): 1065-1066.

Knudsen, C.S., A. Williams, M. J. Brearley, J.L. Demetriou (2013). COX-2 expression in canine anal sac adenocarcinomas and in non-neoplastic canine anal sacs.Veterinary J. 197: 782-787.

Kroupis, C. and K. Christopoulos (2008). Asymmetric real-time PCR detection of BRCA1 5382insC mutation by melting curve analysis in the Light Cycler. Clinical Chimica Acta. 390 (1-2): 141-144.

Kundu, N., Q. Yang, R. Dorsey, and A.M. Fulton (2001).Int. J.Cancer. 93, 681-686.

Lester, S.C. (2010). Manual of surgical pathology: Elsevier Health Sciences.

Leung, W. K., K.F, To, Y. P. Ng, T. L. Lee, J. Y.W. Lau, F.K.L. Chan, E. K.W. Ng, S. C. S. Chung and J. J. Y. Sung (2001). Association between cyclo-oxygenase-2 overexpression and missense p53 mutations in gastric cancer. British J. Cancer.84 (3): 335-339.

Leung, W.K., K.F. To, Y.P. Ng, T.L. Lee, J.Y.W. Lau, F.K.L. Chan, E. K.W. Ng, S.C.S. Chung, and J.J.Y. Sung (2001). Association between cyclo-oxygenase-2 overexpression and missense p53 mutations in gastric cancer. British J. Cancer. 84(3): 335-339.

Li, T.J. and J. Cui (2013). COX-2, MMP-7 expression in oral lichen planus and oral squamous cell carcinoma. Asian Pacific J. Tropical Medicine. 6: 640-643.

Livak, K.J. And T. D. Schmittgen (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C (T)) Method. Methods., 25: 402-8.

Loeb, K.R. and L.A. Loeb (2000).Significance of multiple mutations in cancer. Carcinogenesis. 21(3): 379-385.

Macewen, E.G. (1990). Spontaneous tumors in dogs and cats: models for the study of cancer biology and treatment. Cancer and Metastasis Reviews. 9(2):125-136.

Malik, F.A., S. Ashraf, M.A. Kayani, W.G. Jiang,Mir, A., M. Ansar, I.A. Baloch, and R. Sadiq (2008). Contribution of BRCA1 germline mutation in patients with sporadic breast cancer. International Seminars in Surgical Oncology. 5: 21.

Marconato, L., M.E. Gelain,and S. Comazzi (2013). The dog as a possible animal model for human non-Hodgkin lymphoma. Hematological Oncology. 31 (1):1-9.

Matsushima, M., K. Kobayashi, M. Emi, H. Saito, J. Saito, K. Suzumori, and Y. Nakamura (1995). Mutation analysis of the BRCA1 gene in 76 Japanese ovarian cancer patients: four germline mutations, but no evidence of somatic mutation. Human Molecular Genetics. 4: 1953-1956.

Matsushima, M., K. Kobayashi, M. Emi, H. Saito, J. Saito, K. Suzumori, and Y. Nakamura (1995). Mutation analysis of the BRCA1 gene in 76 Japanese ovarian ovarian cancer patients: four germline mutations, but no evidence of somatic mutation. Human Molecula Genetics. 4:1953-6.

Miki, Y., J. Swensen, D. Shattuck-Eidens, P.A. Futreal, K. Harshman, S. Tavtigian, Q. Liu, C. Cochran, L.M. Bennett, and Ding, W. (1994). A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science. 266: 66-71.

Monnerat, C., A. Chompret, C. Kannengiesser, M.F. Avril, N. Janin, A. Spatz, J. M. Guinebretiere, C. Marian, Boitier, G. M. Lenoir, and B. Bressac-De Paillerets (2007). Germline mutations in patients with breast cancer and cutaneous melanoma. Familial Cancer. 6:453-61.

Mullins, M.N., S.E. Lana, W.S. Dernell, G. K. Ogilvie, S. J. Withrow and E. J. Ehrhart (2004). Cyclooxygenase-2expression in canine appendicular osteosarcomas. J. Veterinary Int. Med. 18: 859-865.

Navaraj, A., N. Finnberg, D.T. Dicker, W. Yang, Matthew, E.M. and W.S. El-Deiry (2009). Reduced cell death, invasive and angiogenic features conferred by BRCA1-deficiency in mammary epithelial cells transformed with H-Ras. Cancer Biology and Therapy, 8: 2417-2444.

North, S.M. and T.A. Banks (2009). Small Animal Oncology: An Introduction: Saunders/Elsevier. Paul, A.G., N. Sharma-Walia, and B. Chandran (2011).Targeting KSHV/HHV-8 latency with COX-2 selective inhibitor nimesulide: a potential chemotherapeutic modality for primary effusion lymphoma. PLOS One. 6: e24379.

Pawaiyay, R.V.S. (2008). Central Institute for Research on Goats (ICAR). Division of Animal Health.

Penney, M., K. Janna, A. Meredith, N. Johnathon, K. Mawuse, B. Virginia, D. Jonathan, J. Nancy, K.C. Kelvin, L. Alana, D. Michael, L. Barbara and M.W. Valerie (2010). HOXA9 regulates BRCA1 expression to modulate human breast tumor phenotype. J. Clinical Investigation. 120 (5): 1535-1550.

Pestili De Almeida, E.M., C. Piche, J. Sirois, and M. Dore (2001). Expression of cyclo-oxygenase-2 in naturally occurring squamous cell carcinomas in dogs. J. Histochemistry and Cytochemistry. 49: 867-875.

Peters, W.H, M. Lacko, R.H. TeMorsche, A.C. Voogd, M.B. Oude Ophuisand J.J. Manni( 2009). COX-2 polymorphisms and the risk for head and neck cancer in white patients. Head and Neck Oncology. 31: 938-943.

Pinho, B.A., S. Carvalho, J. Cabral, C.A. Reis, and F. Gartner (2012). Canine tumors: a spontaneous animal model of human carcinogenesis. Translational Research.159 (3):165-172.

Rassi, H. (2009). Stem cell therapy for hereditary breast cancer. Tsitol Genetics. 43: 80-8.

Rivera, P., M. Melin,T. Biagi,T. Fall, J. Haggstrom, K. Lindblad-Toh, H. Andvon Euler(2009). Mammary tumor development in dogs is associated with BRCA1 and BRCA2. Cancer Research. 69: 8770-8774.

Rodney, L and M.S. Page (2001).Prognostic factors for canine and feline mammary cancer. In: Proceedings of the Atlantic Coast Veterinary Conference. 9-11.

Ruggeri, R. M., and S. Sciacchitano (2006). Immunoexpression of multidrug-resistance protein 2 and cyclooxygenase 2 in medullary thyroid carcinomas. Archives of Pathology and Laboratory Medicine .130(7): 1014-1019.

Sing, B. and A. Lucca (2002). Role of cyclooxygenase-2 in breast cancer. J. Surgical Research. 108: 173-179.

Starita, L.M. and J.D. Parvin (2003). The multiple nuclear functions of BRCA1: transcription, ubiquitination and DNA repair. Current Opinion in Cell Biology.15: 345-50.

Strazisar, M., T. Rott, and D. Glavac (2008).K-RAS and P53 mutations in association with COX-2 and hTERT expression and clinico-pathological status of NSCLC patients. Disease Markers. 25: 97-106.

Struewing, J.P., P. Hartge, and S. Wacholder (1997). The risk of cancer associated with specific mutations of BRCA1 and BRCA2 among Ashkenazi Jews. New England J. Med. 336:1401-8.

Syrjakoski, K. and P. Vahteristo (2000).Population-based study of BRCA1 and BRCA2 mutations in 1035 unselected Finnish breast cancer patients.J. National Cancer Institute. 92(18): 1529-1531.

Todorova.(2006). Prevalence and etiology of the most common malignant tumours in dogs and cats.Bulgarian J. Veterinary Medicine. 9(2):85-98.

Triplett, A.A., C. Montagna, and K.U. Wagner (2008). A mammary-specific, long-range deletion on mouse chromosome 11 accelerates Brca1-associated mammary tumorigenesis. Neoplasia. 10: 1325-1334.

Wang, S.C. and H.C. Lien (2004). Binding at and transactivation of the COX-2 promoter by nuclear tyrosine kinase receptor ErbB-2. Cancer Cell. 6(3): 251-261.

World Health Organization (2012). Media Centre. Cancer.Fact Sheet.N-297.

Xie, W., J. G. Chipman, D.K. Robertson, R.L. Erikson, and D.L Simmons (1991). Expression of a mitogen-responsive gene encoding prostaglandin synthase is regulated by mRNA splicing. Proceedings of National Academy of Sciences. 88: 2692-2696.

Zelada-Hedman, M., A.L. Borresen-Dale and A. Lindblom (1997).Screening of 229 family cancer patients for a germline estrogen receptor gene (ESR) base mutation. Human Mutatation. 9:289.
COPYRIGHT 2016 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of Animal and Plant Sciences
Geographic Code:9PAKI
Date:Feb 29, 2016
Words:7759
Previous Article:ESTABLISHMENT OF HEMATOLOGICAL REFERENCE VALUES IN BUFFALO POX VIRUS INFECTED BUFFALOES FOR QUICK DIAGNOSIS OF THE DISEASE IN LOCAL LABORATORY...
Next Article:EFFECTS OF CRYOPRESERVATION AND RELATIVE HUMIDITY ON VIABILITY AND NUTRITIONAL COMPOSITION OF SAINFOIN (ONOBRYCHIS VICIIFOLIA SCOP.).
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters