Printer Friendly

Box jellyfish Alatina alata has a circumtropical distribution.

Abstract. Species of the box jellyfish (Cubozoa) genus Alatina are notorious for their sting along the beaches of several localities of the Atlantic and Pacific. These species include Alatina alata on the Caribbean Island of Bonaire (the Netherlands), A. moseri in Hawaii, and A. mordens in Australia. Most cubozoans inhabit coastal waters, but Alatina is unusual in that specimens have also been collected in the open ocean at great depths. Alatina is notable in that populations form monthly aggregations for spermcast mating in conjunction with the lunar cycle. Nominal species are difficult to differentiate morphologically, and it has been unclear whether they are distinct or a single species with worldwide distribution. Here we report the results of a population genetic study, using nuclear and mitochondrial sequence data from four geographical localities. Our analyses revealed a general lack of geographic structure among Alatina populations, and slight though significant isolation by distance. These data corroborate morphological and behavioral similarities observed in the geographically disparate localities, and indicate the presence of a single, pantropically distributed species, Alatina alata. While repeated, human-mediated introductions of A. alata could explain the patterns we have observed, it seems more likely that genetic metapopulation cohesion is maintained via dispersal through the swimming medusa stage, and perhaps via dispersal of encysted planulae, which are described here for the first time in Alatina.

Introduction

Life-cycle and life-history characteristics have profound impacts on the basic biology of marine species, affecting geographic ranges and population dynamics. For instance, species possessing both benthic and planktonic life stages may be expected to display lower dispersal abilities and smaller geographic ranges than species lacking benthic stages (Gibbons et al., 2010). Many marine species possess pelagic larval stages that are often thought to be most responsible for dispersal (Bradbury et al., 2008; Bowen et al., 2013), but the mobility of all stages in a life cycle are relevant to determining species ranges (Johannesson, 1988). Species of the phylum Cnidaria exhibit a wide variety of life-cycle plasticity and dispersal capabilities (reviewed in Fautin, 2002). Jellyfish species (of the cnidarian subphylum Medusozoa) typically possess a benthic, sessile stage (polyp) that reproduces asexually by budding new polyps or medusae, the latter of which represent the sexually reproductive stage of the textbook medusozoan life cycle. Short-lived, ciliated larval forms known as planulae usually precede the benthic polyp stage. A sometimes overlooked life stage present in some medusozoans is the podocyst, a resting stage produced by polyps. Podocysts are essentially polyp-derived tissues encysted in a protective layer of perisarc, and are able to withstand extreme salinity changes and desiccation, sometimes for years (Dumont, 1994; Ikeda et al., 2011; Carrette et al., 2014).

For scyphozoan and cubozan species, the medusa stage is usually the life stage chosen for investigating global patterns of abundance, distribution, and diversity (Dawson et al., 2014; Lucas et al., 2014), because the polyp stage is often difficult to locate in the field. Recent focus has been on the sudden or periodic increases in biomass of scyphozoans that often have detrimental impacts on human activities; such increases are commonly known as "jellyfish blooms" (Condon et al., 2013; Dawson et al., 2014). Much debate exists surrounding the identification of the main factors driving jellyfish population dynamics, such as eutrophication, species introductions, and global climate change (for reviews of jellyfish blooms see Graham et al., 2001; Graham and Bayha, 2007; Purcell et al., 2007; Condon et al., 2013; Dawson et al., 2014; Lucas et al., 2014). While "blooms" of scyphozoans have been most heavily studied, the population dynamics of box jellyfish--in spite of their potentially large public health impacts due to their potent venoms and their generally coastal, shallow water distributions--remain poorly understood (Yoshimoto and Yanagihara, 2002; Bentlage et al., 2009; Gershwin et al., 2009). Periodic or seasonal population dynamics of box jellyfish have long been documented in, and associated with, tropical Australia (Barnes, 1966; Fenner, 1998; Fenner and Harrison, 2000), and an apparent increase in box jellyfish abundance on the Mediterranean Coast of Spain has been reported in recent years (Bordehore et al., 2011, 2015; Fontanet, 2014).

In several tropical to subtropical localities, species of the box jellyfish genus Alatina display monthly nearshore aggregations (Thomas et al., 2001; Chiaverano et al., 2013; Lewis et al., 2013; Carrette et al., 2014). Unlike typical jellyfish blooms, which consist of sudden, and often unpredictable, increases in single-species biomass linked to environmental conditions (Condon et al., 2013; Dawson et al., 2014), Alatina swarms are directly correlated with reproductive events related to the lunar cycle; mating aggregations occur 8 to 10 days after the full moon (Alatina moseri Mayer 1906 in Hawaii, A. mordens Gershwin 2005 in Australia, and A. alata (Reynaud, 1830) in Bonaire, the Netherlands). Though the animals are present in large numbers (hundreds to thousands of individuals) during these monthly reproductive swarms, the whereabouts of Alatina medusae in the interim is poorly known. Further, juveniles have been reported only on few occasions (Arneson, 1976; Arneson and Cutress, 1976; Lewis et al., 2013). Medusae of Alatina alata have been recorded swimming at depths greater than 540 m, and collected as deep as 1067 m (Morandini, 2003 as Carybdea alata; Lewis et al., 2013). Reports of box jellyfish at great depths are unusual; cubozoans are generally not thought to disperse across the open ocean (but see Bentlage et al., 2010). In addition, numerous Alatina specimens have been collected from surface waters in the open ocean and from depths as great as 2282 m (Lewis et al., 2013).

Among the eight nominal species of Alatina, A. alata is found in the eastern Atlantic and Caribbean, and displays what appears to be an identical life history to that of two Pacific species, A. moseri and A. mordens (Carrette et al., 2014). Bentlage et al. (2010) found that the two Pacific species share mtDNA (16S) haplotypes, and suggested that they belong to a widespread population from a single species, despite the large geographic distance separating them. In this contribution, we integrated molecular analyses and early development and morphological data to clarify the geographic distribution of Alatina from Bonaire, Hawaii, Saipan, and Australia. We show that Alatina does not follow the current paradigm, which restricts cnidarians with a bentho-pelagic life cycle to relatively narrow geographic ranges (Gibbons et al., 2010). Rather, we propose that they are members of a single, widespread, possibly circumtropical species known as Alatina alata.

Materials and Methods

Sampling and morphology

We sampled Alatina specimens from four localities (Fig. 1): Alatina alata from Karel's Pier (Kralendijk, Bonaire, the Netherlands); Alatina mordens from Osprey Reef (Coral Sea, Queensland, Australia); Alatina moseri from Waikiki (Oahu, Hawaii), and Alatina sp. from Managaha Island (Saipan, Northern Mariana Islands). Medusae were collected individually by hand or by using dip nets at the sea surface from a boat, docks, or the beach. Specimens were preserved in 5%-8% buffered formalin for morphological examination; a piece of tentacle was placed in 95% ethanol (EtOH) for DNA extractions. Other than two specimens from Saipan, which we tentatively identified as Alatina grandis (Agassiz & Mayer, 1902) (Bentlage et al., 2010) (see Results section), all specimens had the same general appearance in the field. The detailed morphology of Alatina samples was examined using the methods outlined in Bentlage and Lewis (2012) and Lewis et al. (2013). Bell height and bell width were measured, and the presence of taxondefining morphological characters was confirmed by consulting the taxonomic keys provided in Gershwin (2005) and the recent redescription of Alatina alata (Lewis et al., 2013). A list of the museum specimens examined is provided in Appendix 1. Photography and videography were used to document the presence of A. alata in nearshore waters of Bonaire, the Netherlands (Fig. 2b), in connection with monthly spermcasting events (see Lewis et al., 2013 and this study). Male and female adults were placed in buckets of seawater and examined over a period of 24 hours. Embryos released from females (following internal fertilization) were photographed, and videos were taken to document developmental stages from blastulae to free-swimming planulae (following methods in Lewis et al., 2013).

[FIGURE 1 OMITTED]

DNA extraction, polymerase chain reaction (PCR), and sequencing

DNA was extracted from tentacle tissue, using DNeasy Tissue kits (Qiagen Inc., Valencia, CA), following the manufacturer's protocol for animal tissues. Cubozoans are unusual in that they have linear mitochondrial genomes consisting of eight chromosomes (Smith et al., 2012). From three separate mitochondrial chromosomes, we amplified and sequenced three markers: 1) a 1005-bp fragment from the region containing two open-reading frames, ORF314 and POLB (ORF-PolB) (see Smith et al., 2012); 2) a 558-bp fragment from the cytochrome c oxidase subunit I (COI); and 3) a ~545-bp fragment from the ribosomal RNA (16S). ORF314 and POLB are present in the mitochondrial genomes of several other medusozoan groups; ORF314 may have DNA-binding properties to help maintain the ends of mitochondrial telomeres, and POLB codes for a putative DNA polymerase beta (Kayal et al., 2012). From the nuclear genome, we obtained a ~558-bp fragment spanning the internal transcribed spacers (ITS), ITS1 and ITS2, of the ribosomal RNA operon, including 5.8S, as well as a 710-bp fragment of the large ribosomal RNA subunit (28S) spanning the expansion regions D1-D3 (Cannone et al., 2002). Polymerase chain reaction protocols followed standard procedures. Thermocycler profiles were conducted with initialization at 94-95 [degrees]C (3-5 min), followed by 36-40 cycles of denaturation at 94-95 [degrees]C (30 s), annealing at 52-54 [degrees]C (30 s), and extension at 72 [degrees]C (1-2 min). The final extension was further executed at 72 [degrees]C (5-10 min). Polymerase chain reaction products were purified by combining 3 [micro]l of 0.75 units (U) of Exonuclease I and 0.5 U of Shrimp Alkaline Phosphatase (ExoSAP; USB Corp., Cleveland, OH) with 8 [micro]l of PCR product, followed by incubation at 37 [degrees]C for 30 min and deactivation at 80 [degrees]C for 20 min. Cycle sequencing was accomplished using the same primers as those used in PCRs (Table 1). Cycle sequencing products with fluorescently labeled dideoxy terminators were visualized after clean up, using Sephadex columns on an Applied Biosystems (Thermo Fisher Scientific, Waltham, MA) 3130xl or 3730xl Genetic Analyzer at the Smithsonian's Laboratory of Analytical Biology (LAB), of the National Museum of Natural History, Washington, D.C.

[FIGURE 2 OMITTED]

Molecular genetic analyses

Sequences were assembled, trimmed, and aligned in Geneious ver. 6.1.8 (Kearse et al., 2012). The number of haplotypes and haplotype and nucleotide diversity were calculated in DnaSP ver. 5.10.1 (Librado and Rozas, 2009). Allelic states of nuclear sequences with more than one heterozygous site were estimated using PHASE 2.1, as implemented in DnaSP, with three runs, each a unique random-number seed, for each dataset. Each of these runs was conducted for 1000 iterations with 1000 burn-in iterations, and all runs returned consistent allele identities. The best-fit models of DNA sequence evolution for each alignment were determined using the Akaike information criterion (AIC) with a correction for finite sample sizes (AICc), as implemented in jModelTest 2.1.7 (Guindon and Gascuel, 2003; Darriba et al., 2012). To evaluate whether multiple species of Alatina were present in our sampling, we obtained all publicly available 16S sequences from non-Alatina cubozoans deposited in GenBank. These were then aligned to sequences generated for the Alatina specimens collected for this study (Appendix 2) using MAFFT with the E-INSi option (Katoh and Standley, 2013). To exclude regions of uncertain homology of 16S across Cubozoa, Gblocks ver. 0.91b (Castresana, 2000; Talavera and Castresana, 2007) was run with standard parameters, except that half the taxa were allowed to be gaps for any position. The maximum likelihood topology (ML) was inferred using PHYML (Guindon et al., 2010), assuming the best-fitting model for this dataset, TIM2+I+G. Node support was assessed by conducting ML searches using 1000 nonparametric bootstrap replicates in PHYML. The resulting alignments used herein, as well as the 16S phylogenetic tree, are available through Figshare (Collins et al., 2016).

Because many sequences of the five markers were obtained from non-overlapping sets of specimens (see Appendix 2), we did not combine markers for analyses. Arlequin ver. 3.5.1.2 (Excoffier et al., 2005) was used to perform an analysis of molecular variance (AMOVA) (Weir and Cockerham, 1984; Excoffier et al., 1992; Weir, 1996) and to estimate population differentiation using pairwise FSTs, both tested with 20,000 nonparametric permutations. AMOVA was used to estimate the proportion of variation explained among groups (FCT), among localities within groups (FSC), and among all localities (FST). To determine the possibility of a correlation between pairwise FSTs and geographic distance, we used the Isolation-by-Distance Web Service with a 10,000-permutations significance test (Jensen et al., 2005). Geographic distances were measured, using Google Earth, "as the crow flies" between known occurrence sites of Alatina worldwide (Fig. 1). For mitochondrial data, these previous analyses were performed with an analogue of Wright's FST ([PHI]ST), which incorporates the model of sequence evolution. The best-fitting model calculated for the alignments was not available in Arlequin; therefore, the TrN was chosen, as it was the model available with the highest best-fit score (lowest AICc). Haplotype networks were constructed in Network ver. 4.6.1.3 (Flux Technology Ltd., Suffolk, England), using the median-joining algorithm (Bandelt et al., 1999). Networks were post-processed using maximum parsimony calculations (Polzin and Daneshmand, 2003) to remove unessential median vectors in the network.

Results

Morphology

We compared the morphology of the specimens in the Alatina moseri (Mayer, 1906) syntype (Hawaii) series in the Smithsonian's National Museum of Natural History collections (items are denoted by catalog reference code beginning USNM; USNM 21800, 22311, 29632, 42112) with the Alatina alata neotype (USNM 1195802; see Lewis et al., 2013). Museum specimens of A. moseri had gonads, and the three medusae ranged from 70-82 mm (bell height; BH) by 22-26 mm (bell width; BW). According to Mayer (1906), live material measured BH = 80 mm by BW= 47 mm. These measurements are consistent with those of the live, gonad-bearing A. alata neotype (70 mm x 40 mm) and additional nontype material from the Atlantic Ocean (see Lewis et al., 2013). Mayer (1906) described the 24 velarial canals of A. moseri medusae as unbranched. However, we examined the syntype series and found that while some velarial canals are simple, many are split into two or three short, secondary branches (similar to A. alata). Further, velarial lappets and corresponding warts characteristic of A. alata are also present, or at least partially visible, although some have sloughed off in the center, leaving just an outline of the wart. The lack of pit eyes noted by Gershwin (2005) is an artefact often seen in long-preserved box jellyfish material (see Bentlage et al., 2010; Lewis et al., 2013; Carrette et al., 2014). Although Gershwin (2005) argued that, in A. mordens, cirri are arranged in pairs rather than in bunches, we noted no differences with the gastric phacellae of the A. moseri syntype series and the A. alata neotype. Carrette et al (2014) also found no morphological differences when comparing adult medusae of A. moseri with those of A. mordens from Osprey Reef, Australia. Furthermore, the cnidome (nematocyst composition) of adult A. alata medusae (see Arneson, 1976; Lewis et al., 2013) is indistinguishable from that of A. mordens and A. moseri (Gershwin, 2005, 2006; Yanagihara et al., 2002 as Carybdea alata) bearing euryteles (in tentacles) and isorhizas (in bell warts, and tentacle base) (Gershwin, 2005; Lewis et al., 2013). During early development, polyps of A. mordens, A. moseri (Carrette et al., 2014), and A. alata (Arneson and Cutress, 1976 as Carybdea alata) bear stenoteles and ovoid, heterotrichous, microbasic euryteles.

In the course of our collections, using pelagic, tethered drift SCUBA dives at night in the Philippine Sea off the west coast of Saipan, we obtained two exemplars of a more distinctive form of Alatina, which we tentatively identified as ripe females of Alatina grandis. Specimens of Carybdea grandis were collected off Fakarava and Anaa Island, in the Tuamotu Archipelago (formerly Paumotu Islands) and described by Agassiz and Mayer (1902). There were no subsequent reports for over a century (see Bentlage, 2010). Measuring 180 mm (bell height) by 46 mm (bell width), approximately twice the size of the average Alatina specimens in our study, these new exemplars share many characters with the original species description, but additional samples (with key morphological characters preserved) are needed to firmly establish its identity. Our phylogenetic analysis confirms our conclusion, that these large specimens are distinct from the remainder of the collected Alatina specimens (see Phylogenetics and population genetics below).

Embryonic development

In this study, we documented that the early ontogeny of Bonaire Alatina alata embryos to the planula stage (Fig. 2, c-e) matched the findings of Arneson (1976) and Arneson and Cutress (1976) for the same species (as Carybdea alata) in Puerto Rico. The subsequent ontogenetic changes of A. alata from polyp to medusa stage (Arneson and Cutress, 1976) are also known to be identical in A. moseri from Hawaii and A. mordens from Australia (Carrette et al., 2014). Additionally, for all putative Alatina species, polyps can revert to a resting podocyst stage under adverse conditions (Carrette et al., 2014). During this study, while examining developing embryos in the lab approximately 24 h after their release into the aquarium water, we discovered multiple cysts (~150 [micro]m in diameter), each containing a single planula bearing characteristic equatorial eye-spots, rotating on its longitudinal axis. During the course of our microscopic examination, one planula successfully bored through the outer, "shell-like" perisarc (within 5-50 min), emerging as swimming planula (Fig. 2, c-e). To our knowledge, this is the first documented occurrence of a planula hatching in a cnidarian. Whether this encysting stage is a form of diapause (i.e., a dormancy stage or delay in development in response to adverse environmental conditions) remains to be examined. Another open question is whether all or just some of maturing embryos develop a perisarc. The mechanisms involved in piercing the membrane were not investigated here, nor was the composition of the perisarc. Our findings resemble, to a certain extent, the "blastocysts" reported in Morbakka virulenta by Toshino et al. (2013), but in the case of M. virulenta, polyps (not zygotes) formed cysts that endured adverse conditions for many months, reemerging as polyps (not planulae).

Phylogenetics and population genetics

The 16S-ML phylogeny shows that specimens of Alatina alata from Bonaire, A. mordens from Australia, A. moseri from Hawaii, and Alatina sp. from Saipan fall into a single, well-supported clade with little differentiation among species and no apparent geographic structuring (Fig. 3). In contrast, the two large specimens that we tentatively identified as Alatina grandis were highly divergent from them (Fig. 3). While the placement of Alatina grandis is ambiguous due to low bootstrap support, it presents >20% sequence divergence from the remainder of Alatina spp., which in turn have <1.31% average sequence divergence in 16S (Table 2).

In light of the 16S-based phylogenetic results, we removed A. grandis and all other cubozoans from further analysis, leaving just the representatives of Alatina alata from Bonaire, A. mordens from Australia, A. moseri from Hawaii, and Alatina sp. from Saipan, for which we realigned full-length sequences to preserve the largest amount of sequence information possible for further analysis. Table 3 provides the number of specimens sequenced per geographic region (N), number of haplotypes (Nh), haplotype diversity (h), and nucleotide diversity ([pi]) for all markers. All mitochondrial markers and ITS had high overall haplotype diversity (h = 0.96-0.99; Table 3), with ORF-PolB and COI being the most diverse (0-6.47% and 0-4.48%, respectively; Table 2), 16S and ITS with intermediate divergence (0-2.02% and 0-2.15%, respectively; Table 2), and 28S the most conserved (0-0.28%; Table 2).

Overall [PHI]STs and FSTs from the mitochondrial markers and nuclear ITS, respectively, indicated significant structure between sampled localities ([PHI]ST = 0.086-0.17, FST = 0.088; Table 4). However, the majority of the overall variance was found within (>80%) rather than among geographic locations (Table 4). Pairwise comparisons across markers (measured by [PHI]ST and FST; Table 5) showed that most of the Pacific sites were significantly different from Bonaire, but not significantly different from each other (samples were grouped by ocean basin: i.e., Pacific containing Saipan, Australia, and Hawaii vs. Atlantic containing Bonaire; see Materials and Methods). In this case, [PHI]ST and FSTs were larger ([PHI]ST = 0.25-0.35, FST = 0.11; Table 4), and variation within populations still explained the majority of the overall variance observed (>60%). ITS was the only marker to demonstrate significant structure within basins (FSC = 0.075; Table 4). We did not find significant evidence for isolation by distance among regions, other than for COI (Table 4).

[FIGURE 3 OMITTED]

Haplotype networks (Fig. 4) show no well-defined geographic structure and each locality shares haplotypes with at least one other locality for one or more markers. Even though some specimens from Bonaire cluster together, others from this locality are more closely related to Pacific specimens. Nevertheless, pairwise [PHI]ST and FST values involving Bonaire were mostly significant (at P < 0.05), with its lower range in the nuclear ITS (FST = 0.075-0.153) and upper range in the mitochondrial COI ([PHI]ST = 0.294-0.403) (Table 5). Conversely, comparisons within the Pacific were primarily not significant, other than Hawaii-Saipan for ITS (FST = 0.186) (Table 5).

Revised systematics

Alatina alata diagnosis (from Lewis et al., 2013, table 1 and figs. 1-6): "Alatina with tall, narrow bell, flared at base, tapering into truncated pyramid at apex; 4 crescentric gastric phacellae at interradial corners of stomach; 3 simple to palmate branching velarial canals per octant, each with a velarial lappet bearing a row of 3 to 4 nematocyst warts; 4 long, wing-like (sensu Reynaud, 1830) pedalia, each with a pink tentacle. Cnidome: heterotrichous microbasic p-euryteles and small birhaploids in tentacles, and large isorhizas in nematocyst warts." For more details on morphology and taxonomic history.

Neotype locality: Bonaire, the Netherlands (Atlantic Ocean).

Neotype specimen: National Museum of Natural History, Smithsonian Institution, Washington D.C.: USNM 1195802, 1 ind, female, BW 40 mm, BH 70 mm (live), BW 30 mm, BH 69 mm (8% formalin-preserved), 24 June 2011, Karel's Pier, Kralendijk, Bonaire, the Netherlands, 12[degrees]09'06.37" N, 68[degrees]16'06.37" W; depth = surface.

Systematics

Phylum Cnidaria Verrill, 1865

Subphylum Medusozoa Peterson, 1979

Class Cubozoa Werner, 1973

Order Carybdeida Gegenbaur, 1857

Family Alatinidae Gershwin, 2005

Genus Alatina Gershwin, 2005

Species Alatina alata (Reynaud, 1830)

Synonymy list

Carybdea (medusa) alata

Reynaud, 1830 (in Lesson, 1830, pl. 33, fig. la)

La Marsupiale aile

Lesson, 1837, p. 9, n. 26

Marsupialis alata

Lesson, 1843, p. 278

Charybdea alata

Haeckel, 1880, p. 441; 1940a, p. 5

Tamoya alata

Agassiz, 1862, p. 174

Carybdea alata

Mayer 1910, p. 508-510; Mayer, 1915, p. 171; Bigelow, 1918, p. 400; 1938, pp. 144-151, text-figs. 11-16; Kramp, 1961, p. 304; Arneson 1976, pp. 36, figs. 1, 2, table 1, 2, pls. I-V; Arneson and Cutress, 1976, pp. 227-236, table 1, pl. I A-G; Cutress, 1971, p. 19, pl. 1; Larson, 1976, pp. 242; Larson et al., 1991, p. 313, table 2; Thomas et al., 2001; Yoshimoto and Yanagihara, 2002; Humann and Deloach, 2002; Morandini, 2003, p. 15-17, fig. 2; Gershwin, 2005, pp. 501-523; Calder, 2009, pp. 12, 13, fig. 1; Bentlage, 2010, p. 52; Bentlage et al., 2010, p. 498; Bentlage and Lewis, 2012, p. 2602; Yanagihara and Shohet, 2012, pp. 1-2

Charybdea moseri

Mayer, 1906, pp. 1135-1136, pl. 1, fig. 2-2c; n. sp., description and illustrations; Bigelow, 1909, pp. 19-20, young stage of C. grandis; Bigelow, 1938, p. 144, junior synonym of C. alata; Chu and Cutress, 1954, p. 9, cause of dermatitis; Kramp, 1961, p. 304, in synonymy of C. alata

Carybdea moseri

Mayer, 1915, p. 171, probably young of C. alata var. grandis; Mayer, 1917, p. 189 [in part], fig. 3, only half-grown stage of C. alata

Carybdea alata var. moseri

Mayer, 1910, p. 512, probably a variety or young stage of C. grandis, probably identical with C. philippina; Light, 1914, p. 196 = Charybdea philippina [Semper 1860]; Mayer, 1915, p. 171, C. moseri is probably only a young of this medusa; Mayer, 1917, p. 189 [in part], fig. 3, only half-grown stage of C. alata; Stiasny, 1919, pp. 34, 37-38, fig. 5; Stiasny, 1940, pp. 5-6; Bigelow, 1938, p. 144, in synonymy of C. alata

Alatina alata

Gershwin, 2005; Gershwin and Gibbons, 2009; Lewis et al., 2013; Yanagihara et al., 2016

Alatina moseri

Gershwin, 2005, 2006; Gershwin et al., 2009, 2013; Bentlage, 2010; Bentlage et al., 2010; Straehler-Pohl, 2011; Straehler-Pohl and Jarms, 2011; Kayal et al., 2012, 2013; Smith et al., 2012; Bentlage and Lewis, 2012; Kingsford et al., 2012; Yanagihara and Shohet, 2012; Chiaverano et al., 2013; Toshino et al., 2013, 2015; Carrette et al., 2014; Crow et al., 2015; Straehler-Pohl and Toshino, 2015

Alatina cf. moseri

Carrette et al., 2014

Alatina mordens

Gershwin, 2005, 2006; Gershwin et al., 2009, 2013; Bentlage, 2010; Bentlage et al., 2010; Straehler-Pohl, 2011; Straehler-Pohl and Jarms, 2011; Bentlage and Lewis, 2012; Chiaverano et al., 2013; Toshino et al., 2013, 2015; Courtney and Seymour, 2013; Carrette et al., 2014; Crow et al., 2015

Alatina nr mordens

Courtney and Seymour, 2013

Alatina sp.

Carrette et al., 2014

Discussion

Historical background of the Alata species group

By the turn of the 19th century, 10 nominal species of the "alata" species group had been described for cubozoans from disparate geographic areas. These were eventually all united under the species name Carybdea alata (Bigelow, 1938; Kramp, 1961; Arneson, 1976). However, more recently Gershwin (2005) established the genus Alatina for all such cubomedusae, characterized by a tall and narrow bell, four crescentric, gastric phacellae, four "wing-like" pedalia, and three to four bifurcating to palmate velarial canals per octant. The taxonomic revision (Gershwin, 2005) resurrected five species of box jellyfish from the Indo-Pacific, previously synonymized under the name Carybdea alata, using the new genus-species combinations Alatina moseri, A. grandis, A. madraspatana, A. pyramis, and A. tetraptera. The revision also described two new Alatina species from Australia, A. mordens and A. rainensis, the former based mainly on medusa size, bell wart size, and an apparent reduced number of eyes per rhopalium (compared with other cubozoans). Lewis et al. (2013) established a neotype for the oldest species in the group, A. alata (Reynaud, 1830), bringing the number of currently recognized species to six. As body size is a factor of development influenced by environmental conditions, rhopalia eye spots are known to fade, and bell warts rub off following specimen preservation, doubts have been raised as to the validity of some of the nominal species, some of which have a single mention in the literature.

Alatina alata species complex

Bentlage et al. (2010) suggested that Alatina mordens from Australia and A. moseri from Hawaii likely represent a single species, and speculated about whether the two populations were connected at present, or were the result of human-mediated introductions. By increasing taxon and marker sampling from different ocean basins, we show that A. moseri and A. mordens from the Pacific, A. sp. from Saipan, as well as A. alata from its neotype locality (Bonaire, the Netherlands, Atlantic), are the same species. All nominal species sampled in this study (excluding A. grandis) form a single clade in our maximum likelihood (ML) analysis, with little divergence among geographic locations and lack of apparent geographic structuring (Fig. 3). Indeed, using several nuclear and mitochondrial markers we found that populations share haplotypes for all markers and lack a well-defined geographic clustering. All of the markers exhibit variability, particularly ORF-PolB and COI, but there are no clear divisions that would suggest the existence of multiple species among our samples (Fig. 4). Nevertheless, more comprehensive sampling of molecular data, especially of specimens from Bonaire and other localities in the Caribbean, could clarify population-level relationships among the distinct localities, to further investigate the possibility of a recent separation between populations in the different ocean basins in contrast to ongoing circumtropical gene flow.

[FIGURE 4 OMITTED]

Using a reverse taxonomic approach, we reevaluated the morphology of each of the nominal species and realized that they cannot be reliably delineated. Thus, in light of the genetic patterns presented and the uniformity in morphology, we conclude that the nominal species investigated herein all correspond to a single species, in spite of the large geographic distances among the populations sampled. Given that A. alata (Reynaud, 1830) is the oldest species described within the genus Alatina, A. moseri and A. mordens are to be considered junior synonyms of A. alata.

At this point, the status of the other nominal Alatina species (see Gershwin, 2005 for an overview) remains uncertain, as type material exists only for A. rainensis, which we have yet to examine or sample. However, we have tentatively identified the two large alatinid specimens from Saipan (USNM 1296954 and USNM 1296955) as A. grandis, a species that had been described from the Tuamotu Archipelago, French Polynesia, more than a century ago (Agassiz and Mayer, 1902), and whose type is badly damaged, making species identification difficult (Bentlage et al., 2010). Molecular data show that the specimens that we identified as A. grandis are distinct from A. alata within the family Alatinidae, and we expect that morphological examination of better-preserved samples will provide clear distinction between this species and A. alata.

Population structure and historical demography

Even though specimens from the different localities sampled share haplotypes in each of the markers analyzed, we detected some geographic structure, as measured by pairwise [PHI]ST and FST. The Atlantic population shows the greatest separation from those of the Pacific localities. Nevertheless, even though Isolation by Distance (IBD) was significant and high for COI, it was not detected for any other marker, and no significant difference was revealed between the ocean basins in our AMOVA. Overall, there is no well-defined geographic structure, although some degree of divergence exists between Atlantic and Pacific specimens. This divergence could be due to lower rates of gene flow among distant localities or incomplete sorting of a large ancestral population.

Based on our findings, we suggest that Alatina alata is a single widespread species, found in several tropical and subtropical locations in the Pacific and Atlantic Oceans. Even though our findings are contrary to other studies of widespread marine invertebrates (Dawson and Jacobs, 2001; Goetze, 2011), similar results have been reported in fishes (Theisen et al., 2008; Lewallen, 2012). Numerous other cnidarian species with a bentho-pelagic life cycle are globally distributed, a phenomenon that is frequently attributed to repeated species introductions, often through commercial shipping activities (Bayha and Graham, 2013). The most likely means of cnidarian species introductions is via transport of polyps or cysts in ballast water or attachment to the hull of ships (Bayha and Graham, 2013). Under a scenario of species introductions, one would assume reduced haplotype diversities in the regions where it occurred due to the bottleneck created by the introduction of a few propagules into a locality. However, we observed very high haplotype diversities in all sampled localities and across markers. Thus, either there have been multiple separate introductions of Alatina alata from unknown source populations or A. alata is indeed capable of maintaining population cohesion across ocean basins. Of note is the observation of Smith et al. (2012), that Alatina alata (as A. moseri) mitochondrial haplotype diversity is nearly the highest of any metazoan species ever measured to date, which could be the result of extremely large, effective population size. What is clear from the literature is that A. alata has been present both in the Atlantic (Lewis et al., 2013) and at Hawaii for more than a century (Chiaverano et al., 2013). This indicates that putative introductions from one ocean basin to the other would have taken place prior to present-day commercial shipping activities. Unfortunately, the history of A. alata in other localities is not well documented, although large aggregations have been reported in Australia since 1999 (see Carrette et al., 2014, as A. mordens).

Do life-history characteristics favor dispersal abilities in Alatina alata?

Box jellyfish differ from the majority of scyphozoan jellyfish that possess a bentho-pelagic life cycle, which is defined by a sessile polyp stage that metamorphoses into one or more free-swimming medusae. In box jellyfish the sessile, asexually reproducing polyp (cubopolyp) generates either a single medusa through complete metamorphosis, or multiple medusae via metamorphosis coupled with transverse fission at the apical end of the polyp (Straehler-Pohl and Jarms, 2005). Conversely, in both scyphozoans and cubozoans sexual reproduction occurs exclusively during the adult medusa stage. In the case of A. alata, reproductive success is achieved by the formation of highly synchronized, monthly inshore spermcasting aggregations, occurring 8-10 days after the full moon, during which males release sperm that is taken up by females for internal fertilization. These aggregations have been documented in several Atlantic and Pacific localities, including Bonaire, Hawaii, and Australia (Bentlage et al., 2010; Chiaverano et al., 2013; Lewis et al., 2013; Carrette et al., 2014). Reports of live A. alata medusae in the interim are rare, limited to a few documented cases in which a remotely operated vehicle (ROV) at ~100 m (USNM 1005621) and a manned submersible at ~540 m (USNM 1195809) were used (Lewis et al., 2013; Fig. 2a); therefore, A. alata is considered a deep-sea box jellyfish species (see Bentlage et al., 2010).

In the present study, we observed free-floating, encysted planulae (Fig. 2, c-e) with a morphology different from previously reported encysted life stages in box jellyfish, such as podocysts, which are sessile, encysted polyps (see Carrette et al., 2014). While the latter provides a good means of protection during bad conditions, and could potentially foul the hull of ships, the inherent ability of free-floating, encysted planulae to be immediately dispersed to the open ocean (by tides and currents) could ensure effective and broad distribution of planulae before their imminent settlement as polyps. That said, planula larvae themselves are short-lived in A. alata, from 2-3 days (Carrette et al., 2014), to 5-6 days (Arneson, 1976), while the lifespan of the encysted planulae newly described herein is unknown. Since the dispersal potential of larvae is generally highly correlated with the duration of its pelagic stage (Scheltema, 1971; Grantham et al., 2003), planulae are unlikely vectors for long-distance dispersal in A. alata.

Medusae of Alatina alata are strong swimmers (Chiaverano et al., 2013) with a potentially long lifespan (~1 year; see Arneson, 1976), and have been reported swimming at great depths and in the open ocean (see Lewis et al., 2013 and Fig. 1). This suggests that adults might contribute to dispersal, such as has been hypothesized for other marine organisms (see Kinlan et al., 2005). The deepwater habit of A. alata appears to be uncommon for box jellyfish, as most are reported, and predicted, to inhabit shallow, nearshore waters (Yoshimoto and Yanagihara, 2002; Bentlage et al., 2009; Gershwin et al., 2009). Recently, a Chironex box jellyfish was reported in waters at depths of around 50 m, which, although comparatively much shallower than the depths at which A. alata has been documented (Lewis et al., 2013), is much deeper than previously documented for Chironex (Keesing et al., 2016). Whether adult medusae, cysts, or a combination of the two provide a natural means for maintaining global population cohesion in A. alata is unclear at this point, although the deep-sea tendencies of A. alata medusae may partly explain how these widespread populations maintain genetic connectivity. Indeed, several deep-sea hydrozoan jellyfish appear to have distributions spanning ocean basins (Collins et al., 2008). In addition, jellyfish species living in the deep sea may also be globally distributed by natural means due to habitat homogeneity (Bentlage et al., 2013). However, these additional examples of widespread species distributions pertain specifically to cnidarians with holopelagic development, in which the benthic polyp stage has been lost.

Concluding Remarks

We conclude that Alatina alata is a single species, comprising multiple nominal species, with a wide geographical distribution. A. mordens and A. moseri should be regarded as junior synonyms of A. alata. Currently, it is impossible to determine with certainty whether the observed widespread distribution of A. alata is a result of natural dispersal mechanisms or repeated anthropogenic introductions occurring as long as 100 years ago. Future studies with increased locus sampling allowed by current sequencing technologies such as the ezRAD (Toonen et al., 2013), are needed to properly address this question. Further, expanding the geographic range to include Alatina samples from intermediate ocean basins, that is, the Indian and eastern Atlantic Oceans, should lead to a better understanding of the dispersal patterns and historical demography of this apparently cosmopolitan species.

Acknowledgments

Geoff Keel and the rest of the collections staff of the Department of Invertebrate Zoology at the Smithsonian NMNH are gratefully acknowledged for assistance in working with specimens. This work would not have been possible without the generous support of Rita Peachey and staff of CIEE Bonaire; citizen scientists Bud Gillan, Johan van Blerk, and Arjen van Dorsten; and the cooperation of the staff of STINAPA Bonaire. We also acknowledge Julia Souza's assistance, from the Marine Biodiversity Lab at UFSC, for phylogeographic analysis. Much of this work was performed using resources of the Laboratories of Analytical Biology at the Smithsonian NMNH. Saipan research was financially supported by the Brigham Young University-Hawaii Student Associateship Research Fund, Yamagata Foundation, and Biology Department Student Mentored Research Fund. Collection support by BYU-Hawaii students include Sheung Ting, Abigail Smith, Haley Sorenson-Pruitt, Tavaiilau Lueli, and Teylon Wilson.

Literature Cited

Agassiz, A. E., and A. G. Mayer. 1902. Reports on the scientific results of the expedition to the tropical Pacific in charge of Alexander Agassiz, by the U.S. Fish Commission steamer "Albatross," from August, 1899, to March, 1900, Commander Jefferson F. Moser, U. S. N., Commanding. III. Medusa. Mem. Mus. Comp. Zool. Harv. Coll. 26: 139-176.

Agassiz, L. 1862. Contributions to the Natural History of the United States of America. Vol. IV. Little, Brown and Co., Boston. [Online]. Available: http://www.biodiversitylibrary.org/item/54510#page/9/mode/1up [2016, Oct. 13].

Arneson, A. C. 1976. Life history of Carybdea alata Reynaud, 1830 (Cubomedusae). Master's thesis, University of Puerto Rico, Mayaguez.

Arneson, A. C, and C. E. Cutress. 1976. Life history of Carybdea alata Reynaud, 1830 (Cubomedusae). Pp. 227-236 in Coelenterate Ecology and Behaviour, G. O. Mackie, ed. Springer, New York.

Bandelt, H. J., P. Forster, and A. Rohl. 1999. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 16: 37-48.

Barnes, J. H. 1966. Studies on three venomous cubomedusae. Symp. Zool. Soc. Lond. 16: 307-332.

Bayha, K. M., and W. M. Graham. 2013. Nonindigenous marine jellyfish: invasiveness, invasibility, and impacts. Pp. 45-77 in Jellyfish Blooms, K. A. Pitt and C. H. Lucas, eds. Springer, New York.

Bentlage, B. 2010. Carybdea alata auct. (Cubozoa): rediscovery of the Alatina grandis type. Zootaxa 2713: 52-54.

Bentlage, B., and C. Lewis. 2012. An illustrated key and synopsis of the families and genera of carybdeid box jellyfishes (Cnidaria: Cubozoa: Carybdeida), with emphasis on the "Irukandji family" (Carukiidae). J. Nat. Hist. 46: 2595-2620.

Bentlage, B., A. T. Peterson, and P. Cartwright. 2009. Inferring distributions of chirodropid box-jellyfishes (Cnidaria: Cubozoa) in geographic and ecological space using ecological niche modeling. Mar. Ecol. Prog. Ser. 384: 121-133.

Bentlage, B., P. Cartwright, A. A. Yanagihara, C. Lewis, G. S. Richards, and A. G. Collins. 2010. Evolution of box jellyfish (Cnidaria: Cubozoa), a group of highly toxic invertebrates. Proc. R. Soc. B Biol. Sci. 211: 493-501.

Bentlage, B., A. T. Peterson, N. Barve, and P. Cartwright. 2013. Plumbing the depths: extending ecological niche modelling and species distribution modelling in three dimensions. Global Ecol. Biogeogr. 22: 952-961.

Bigelow, H. B. 1909. Reports of the scientific results of the Expedition to the Eastern Tropical Pacific, in charge of Alexander Agassiz, by the U. S. Fish Commission Steamer "Albatross," from October, 1904, to March, 1905, Lieut. Commander L. M. Garrett, U.S.N., commanding. XVI. The Medusae. Mem. Mus. Comp. Zool. 37: 1-243.

Bigelow, H. B. 1918. Some Medusae and Siphonophora from the western Atlantic. Bull. Mus. Comp. Zool. Harv. Coll. 62: 363-442.

Bigelow, H. B. 1938. Plankton of Bermuda Oceanographic Expeditions. VIII. Medusae taken during the years 1929 and 1930. Zoologica 23: 99-189.

Bordehore, C, V. L. Fuentes, D. Atienza, C. Barbera, D. Fernandez-Jover, M. Roig, M. J. Acevedo-Dudley, A. J Canepa, and J. M. Gili. 2011. Detection of an unusual presence of the cubozoan Carybdea marsupialis at shallow beaches located near Denia, Spain (south-western Mediterranean). Mar. Biodivers. Rec. 4: e69.

Bordehore, C, V. L. Fuentes, J. G. Segarra, M. Acevedo, A. Canepa, and J. Raventos. 2015. Use of an inverse method for time series to estimate the dynamics of and management strategies for the box jellyfish Carybdea marsupialis. PLoS One 10: e0137272.

Bowen, B. W., L. A. Rocha, R. J. Toonen, S. A. Karl, and the ToBo Laboratory. 2013. The origins of tropical marine biodiversity. Trends Ecol. Evol. 28: 359-366.

Bradbury, I. R., B. Laurel, P. V. R. Snelgrove, P. Bentzen, and S. E. Campana. 2008. Global patterns in marine dispersal estimates: the influence of geography, taxonomic category and life history. Proc. R. Soc. B Biol. Sci. 275: 1803-1809.

Calder, D. R. 2009. Cubozoan and scyphozoan jellyfishes of the Carolinian Biogeographic Province, southeastern USA. R. Ont. Mus. Contrib. Sci. 3: 1-58.

Cannone, J. J., S. Subramanian, M. N. Schnare, J. R. Collett, L. M. D'Souza, Y. Du, B. Feng, N. Lin, L. V. Madabusi, K. M. Muller et al. 2002. The comparative RNA web (CRW) site: an online database of comparative sequence and structure information for ribosomal, intron, and other RNAs. BMC Bioinformatics 3: 2.

Carrette, T., I. Straehler-Pohl, and J. Seymour. 2014. Early life history of Alatina cf. moseri populations from Australia and Hawaii with implications for taxonomy (Cubozoa: Carybdeida, Alatinidae). PLoS One 9: e84377.

Castresana, J. 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol. 17: 540-552.

Chiaverano, L. M., B. S. Holland, G. L. Crow, L. Blair, and A. A. Yanagihara. 2013. Long-term fluctuations in circalunar beach aggregations of the box jellyfish Alatina moseri in Hawaii, with links to environmental variability. PLoS One 8: e77039.

Chombard, C, N. Boury-Esnault, A. Tillier, and J. Vacelet. 1997. Polyphyly of "Sclerosponges" (Porifera, Demospongiae) supported by 28S ribosomal sequences. Biol. Bull. 193: 359-367.

Chu, G. W., and C. E. Cutress. 1954. Human dermatitis caused by marine organisms in Hawaii. Proc. Hawaii Acad. Sci. 9: 1953-54.

Collins, A. G., B. Bentlage, A. Lindner, D. Lindsay, S. H. D. Haddock, G. Jarms, J. L. Norenburg, T. Jankowski, and P. Cartwright. 2008. Phylogenetics of Trachylina (Cnidaria: Hydrozoa) with new insights on the evolution of some problematical taxa. J. Mar. Biol. Assoc. U.K. 88: 1673-1685.

Collins, A. G., J. Lawley, B. Bentlage, E. Kayal, C. A. Lewis, A. Yanagihara, R. Goodwill, and K. Hurwitz. 2016. Genetic data for Alatina alata, a box jellyfish with a circumtropical distribution. Figshare. [Online]. Available: https://figshare.com/articles/Genetic_Data_for_Alatina_alata_a_boxJellyfish_with_a_circumtropical_distribution/3410104 [2016, Feb. 3].

Condon, R. H., C. M. Duarte, K. A. Pitt, K. L. Robinson, C. H. Lucas, K. R. Sutherland, H. W. Mianzan, M. Bogeberg, J. E. Purcell, M. B. Decker et al. 2013. Recurrent jellyfish blooms are a consequence of global oscillations. Proc. Natl. Acad. Sci. USA 110: 1000-1005.

Courtney, R., and J. Seymour. 2013. Seasonality in polyps of a tropical cubozoan: Alatina nr mordens. PLoS One 8: e69369.

Crow, G. L., L. M. Chiaverano, J. Crites, M. A. Khramov, and B. S. Holland. 2015. Box jellyfish (Cubozoa: Carybdeida) in Hawaiian waters, and the first record of Tripedalia cystophora in Hawai'i. Bishop Mus. Bull. Zool. 108: 93-108.

Cutress, C. E. 1971. Investigation of the Biology and Control of Noxious Coelenterates Occurring in the Coastal Waters of Puerto Rico. Second Annual Report (January 1 to December 31, 1970). Jellyfish Project JF 2-6. Department of Agriculture, Commonwealth of Puerto Rico, Mayaguez, P.R.

Darriba, D., G. L. Taboada, R. Doallo, and D. Posada. 2012. jModelTest 2: more models, new heuristics and parallel computing. Nat. Methods 9: 772.

Dawson, M. N., and D. K. Jacobs. 2001. Molecular evidence for cryptic species of Aurelia aurita (Cnidaria, Scyphozoa). Biol. Bull. 200: 92-96.

Dawson, M. N., K. Cieciel, M. B. Decker, G. C. Hays, C. H. Lucas, and K. A. Pitt. 2014. Population-level perspectives on global change: genetic and demographic analyses indicate various scales, timing, and causes of scyphozoan jellyfish blooms. Biol. Invasions 17: 851-867.

Dumont, H. J. 1994. The distribution and ecology of the fresh- and brackish-water medusae of the world. Hydrobiologia 272: 1-12.

Excoffier, L., P. E. Smouse, and J. M. Quattro. 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 131: 479-491.

Excoffier, L., G. Laval, and S. Schneider. 2005. Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evol. Bioinform. Online 1: 47-50.

Fautin, D. G. 2002. Reproduction of Cnidaria. Can. J. Zool. 80: 1735-1754.

Fenner, P. J. 1998. Dangers in the ocean: the traveler and marine envenomation. I. Jellyfish. J. Travel Med. 5: 135-141.

Fenner, P. J., and S. L. Harrison. 2000. Irukandji and Chironex fleckeri jellyfish envenomation in tropical Australia. Wilderness Environ. Med. 11: 233-240.

Folmer, O., M. Black, W. Hoeh, R. Lutz, and R. Vrijenhoek. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3: 294-299.

Fontanet, C. B. 2014. Studies on the ecology of Carybdea marsupialis (Cubozoa) and jellyfish sting risk management. Ph.D. thesis, University of Alicante, Spain.

Gegenbaur, C. 1857. Versuch eines Systemes der Medusen, mit Beschreibung neuer oder wenig gekannter Formen; zugleich ein Beitrag zur Kenntniss der Fauna des Mittelmeeres. Z Wissen. Zool. 8: 202-73, plates vii-x.

Gershwin, L. 2006. Nematocysts of the Cubozoa. Zootaxa 1232: 1-57.

Gershwin, L.-A. 2005. Carybdea alata auct. and Manokia stiasnyi, reclassification to a new family with description of a new genus and two new species. Mem. Qld. Mus. 51: 501-523.

Gershwin, L.-A., and M. J. Gibbons. 2009. Carybdea branchi, sp. nov., a new box jellyfish (Cnidaria: Cubozoa) from South Africa. Zootaxa 2088: 41-50.

Gershwin, L.-A., M. De Nardi, K. D. Winkel, and P. J. Fenner. 2009. Marine stingers: review of an under-recognized global coastal management issue. Coast. Manage. 38: 22-41.

Gershwin, L.-A., A. J. Richardson, K. D. Winkel, P. J. Fenner, J. Lippmann, R. Hore, G. Avila-Soria, D. Brewer, R. J. Kloser, A. Steven, and S. Condie. 2013. Biology and ecology of Irukandji jellyfish (Cnidaria: Cubozoa). Adv. Mar. Biol. 66: 1-85.

Gibbons, M. J., L. A. Janson, A. Ismail, and T. Samaai. 2010. Life cycle strategy, species richness and distribution in marine Hydrozoa (Cnidaria: Medusozoa). J. Biogeogr. 37: 441-448.

Goetze, E. 2011. Population differentiation in the open sea: insights from the pelagic copepod Pleuromamma xiphias. Integr. Comp. Biol. 51: 580-597.

Graham, W. M., and K. M. Bayha. 2007. Biological invasions by marine jellyfish. Pp. 239-255 in Biological Invasions, Ecological Studies, Vol. 193, W. Nentwig, ed. Springer, Berlin.

Graham, W. M., F. Pages, and W. M. Hamner. 2001. A physical context for gelatinous zooplankton aggregations: a review. Hydrobiologia 451: 199-212.

Grantham, B. A., G. L. Eckert, and A. L. Shanks. 2003. Dispersal potential of marine invertebrates in diverse habitats. Ecol. Appl. 13: 108-116.

Guindon, S., and O. Gascuel. 2003. A simple, fast, and accurate algorithm to estimate large phytogenies by maximum likelihood. Syst. Biol. 52: 696-704.

Guindon, S., J. F. Dufayard, V. Lefort, M. Anisimova, W. Hordijk, and O. Gascuel. 2010. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst. Biol. 59: 307-321.

Haeckel, E. 1880. System der Acraspeden - Zweite Halfte des Systems der Medusen. Denkschriften der Medizinisch-Naturwissenschaftlichen Gesellschaft zu Jena, Germany.

Humann, P., and N. Deloach. 2002. Reef Creature Identification: Florida, Caribbean, Bahamas, 2nd Ed. New World Publications, Jacksonville, FL. 420 pp.

Ikeda, H., K. Ohtsu, and S.-I. Uye. 2011. Fine structure, histochemistry, and morphogenesis during excystment of the podocysts of the giant jellyfish Nemopilema nomurai (Scyphozoa, Rhizostomeae). Biol. Bull. 221: 248-60.

Jensen, J. L., A. J. Bohonak, and S. T. Kelley. 2005. Isolation by distance, web service. BMC Genetics 6: 13. v.3.23.

Johannesson, K. 1988. The paradox of Rockall: why is a brooding gastropod (Littorina saxatilis) more widespread than one having a planktonic larval dispersal stage (L. littorea)? Mar. Biol. 99: 507-513.

Katoh, K., and D. M. Standley. 2013. MAFFT Multiple Sequence Alignment Software version 7: improvements in performance and usability. Mol. Biol. Evol. 30: 772-780.

Kayal, E., B. Bentlage, A. G. Collins, M. Kayal, S. Pirro, and D. V. Lavrov. 2012. Evolution of linear mitochondrial genomes in medusozoan cnidarians. Gen. Biol. Evol. 4: 1-12.

Kayal, E., B. Roure, H. Philippe, A. G. Collins, and D. V. Lavrov. 2013. Cnidarian phylogenetic relationships as revealed by mitogenomics. BMC Evol. Biol. 13: 5.

Kearse, M., R. Moir, A. Wilson, S. Stones-Havas, M. Cheung, S. Sturrock, S. Buxton, A. Cooper, S. Markowitz, C. Duran et at 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647-1649.

Keesing, J. K., J. Strzelecki, M. Stowar, M. Wakeford, K. J. Miller, L.-A. Gershwin, and D. Liu. 2016. Abundant box jellyfish, Chironex sp. (Cnidaria: Cubozoa: Chirodropidae), discovered at depths of over 50 m on western Australian coastal reefs. Sci. Rep. 6: 22290.

Kingsford, M. J., J. E. Seymour, and M. D. O'Callaghan. 2012. Abundance patterns of Cubozoans on and near the Great Barrier Reef. Hydrobiologia 690: 257-268.

Kinlan, B. P., S. D. Gaines, and S. E. Lester. 2005. Propagule dispersal and the scales of marine community process. Divers. Distrib. 11: 139-148.

Kramp, P. L. 1961. Synopsis of the medusae of the world. J. Mar. Biol. Assoc. U.K. 40: 7-382.

Larson, R. J. 1976. Marine Flora and Fauna of the Northeastern United States. Cnidaria: Scyphozoa (003). U.S. Dept. of Commerce, National Oceanic and Atmospheric Administration, National Marine Fisheries Service, Seattle.

Larson, R. J., C. E. Mills, and G. R. Harbison. 1991. Western Atlantic midwater hydrozoan and scyphozoan medusae: in situ studies using manned submersibles. Hydrobiologia 216: 311-317.

Lesson, R. P., ed. 1830. Centurie Zoologique, ou, Choix d'Animaux Rares, Nouveaux ou Imparfaitement Connus: enrichi de planches inedites, dessinees d'apres nature par M. Pretre, gravees et coloriees avec le plus grand soin. Chez F. G. Levrault, Paris. 244 pp.

Lesson, R. P. 1837. Prodrome d'une Monographic des Meduses. Extr. d'une Histoire manuscrite des meduses, en 3 vol. 4e avec 200 planches coloriees, ouvrage entierement termine. Rochefort, France. 200 pp.

Lesson, R. P. 1843. Historie Naturelle des Zoophytes. Acalephes. Librairie Encyclopedique de Roret, Paris. 663 pp.

Lewallen, E. A. 2012. Evolution and Ecology of Flyingfishes (Teleostei: Exocoetidae). Ph.D. Thesis, University of Toronto, Canada.

Lewis, C, B. Bentlage, A. Yanagihara, W. Gillan, J. Van Blerk, D. P. Keil, A. E. Bely, and A. G. Collins. 2013. Redescription of Alatina alata (Reynaud, 1830) (Cnidaria: Cubozoa) from Bonaire, Dutch Caribbean. Zootaxa 3737: 473-487.

Librado, P., and J. Rozas. 2009. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 1451-1452.

Light, S. F. 1914. Some Philippine Scyphomedusae, including two new genera, five new species, and one new variety. Philipp. J. Sci. 9: 195-231.

Lucas, C. H., D. O. B. Jones, C. J. Hollyhead, R. H. Condon, C. M. Duarte, W. M. Graham, K. L. Robinson, K. A. Pitt, M. Schildhauer, and J. Regetz. 2014. Gelatinous zooplankton biomass in the global oceans: geographic variation and environmental drivers. Glob. Ecol. Biogeogr. 23: 701-714.

Mayer, A. G. 1906. Medusae of the Hawaiian Islands collected by the steamer Albatross in 1902. Bull. U.S. Fish Comm. 23: 1131-1143.

Mayer, A. G. 1910. Medusae of the World, Vol. III, The Scyphomedusae. Carnegie Inst. Washington Publ. 109: 499-735

Mayer, A. G. 1915. Medusae of the Philippines and of Torres Straits. Being a report on the scyphomedusae collected by the U.S. Fisheries Bureau steamer 'Albatross' in the Philippine Islands and Malay Archipelago, 1907-1910, and upon the medusae collected by the expedition of the Carnegie Institution of Washington to Torres Straits, Australia, in 1913. Pp. 157-202 in Papers from the Department of Marine Biology, Vol. VIII. Carnegie Inst, of Washington, Washington, D.C.

Mayer, A. G. 1917. Report upon the scyphomedusae collected by the United States Bureau of Fisheries steamer "Albatross" in the Philippine Islands and Malay Archipelago. Bull. U.S. Nat. Mus. 100: 175-233.

Medina, M., A. G. Collins, J. D. Silberman, and M. L. Sogin. 2001. Evaluating hypothesis of basal animal phylogeny using complete sequences of large and small subunit rRNA. Proc. Natl. Acad. Sci. USA 98: 9707-9712.

Morandini, A. C. 2003. Deep-sea medusae (Cnidaria: Cubozoa, Hydrozoa and Scyphozoa) from the coast of Bahia (western South Atlantic, Brazil). Mitt. hamb. zool. Mus. Inst. 100: 13-25.

Palumbi, S. R. 1996. Nucleic acids II: the polymerase chain reaction. Pp. 205-247 in Molecular Systematics, D. M. Hillis, C. Moritz, and B. K. Mable, eds. Sinauer, Sunderland, MA.

Petersen, K. W. 1979. Development of coloniality in Hydrozoa. Pp. 105-139 in Biology and Systematics of Colonial Organisms, G. Larwood and B. R. Rosen, eds. Academic Press, London.

Polzin, T., and S. V. Daneshmand. 2003. On Steiner trees and minimum spanning trees in hypergraphs. Oper. Res. Lett. 31: 12-20.

Purcell, J. E., S.-I. Uye, and W.-T. Lo. 2007. Anthropogenic causes of jellyfish blooms and their direct consequences for humans: a review. Mar. Ecol. Prog. Ser. 350: 153-174.

Reynaud, M. 1830. Carybdea alata n. sp. Pp. 95, PI. 33 in Centurie Zoologique, R. P. Lesson, ed. Levrault, Paris.

Scheltema, R. S. 1971. Larval dispersal as a means of genetic exchange between geographically seperated populations of shallow-water benthic marine gastropods. Biol. Bull. 140: 284-322.

Smith, D. R., E. Kayal, A. A. Yanagihara, A. G. Collins, S. Pirro, and P. J. Keeling. 2012. First complete mitochondrial genome sequence from a box jellyfish reveals a highly fragmented linear architecture and insights into telomere evolution. Genome Biol. Evol. 4: 52-58.

Stiasny, G. 1919. Die Scyphomedusen-Sammlung des Naturhistorischen Reichsmuseums in Leiden: Die Carybdeiden (Cubomedusen). Zool. Meded. 5: 33-58.

Stiasny, G. 1940. Die Scyphomedusen. Dana Rep. 18: 1-28, pls. 1-2.

Straehler-Pohl, I. 2011. Biology of the box jellyfish Carybdea sivickisi at Akajima. Midoriishi 22: 8-13. (in Japanese)

Straehler-Pohl, I., and G. Jarms. 2005. Life cycle of Carybdea marsupialis Linnaeus, 1758 (Cubozoa, Carybdeidae) reveals metamorphosis to be a modified strobilation. Mar. Biol. 147: 1271-1277.

Straehler-Pohl, I., and G. Jarms. 2011. Morphology and life cycle of Carybdea morandinii, sp. nov. (Cnidaria), a cubozoan with zooxanthellae and peculiar polyp anatomy. Zootaxa 2755: 36-56.

Straehler-Pohl, I., and S. Toshino. 2015. Carybdea morandinii: New investigations on its life cycle reveal its true genus: Carybdea morandinii Straehler-Pohl & Jarms, 2011 becomes Alatina morandinii (Straehler-Pohl & Jarms, 2011). Plankton Benthos Res. 10: 167-177.

Talavera, G., and J. Castresana. 2007. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol. 56: 564-577.

Theisen, T. C, B. W. Bowen, W. Lanier, and J. D. Baldwin. 2008. High connectivity on a global scale in the pelagic wahoo, Acanthocybium solandri (tuna family Scombridae). Mol. Ecol. 17: 4233-4247.

Thomas, C. S., S. A. Scott, D. J. Galanis, and R. S. Goto. 2001. Box jellyfish (Carybdea alata) in Waikiki: their influx cycle plus the analgesic effect of hot and cold packs on their stings to swimmers at the beach: a randomized, placebo-controlled, clinical trial. Hawaii Med. J. 60: 100-107.

Toonen, R. J., J. B. Puritz, Z. H. Forsman, J. L. Whitney, I. Fernandez-Silva, K. R. Andrews, and C. E. Bird. 2013. ezRAD: a simplified method for genomic genotyping in non-model organisms. PeerJ 1: e203. [Online]. Available: https:/doi.org/10.7717/peerJ. 203 [2016, Feb. 3].

Toshino, S., H. Miyake, S. Ohtsuka, K. Okuizumi, A. Adachi, Y. Hamatsu, M. Urata, K. Nakaguchi, and S. Yamaguchi. 2013. Development and polyp formation of the giant box jellyfish Morbakka virulenta (Kishinouye, 1910) (Cnidaria: Cubozoa) collected from the Seto Inland Sea, western Japan. Plankton Benthos Res. 8: 1-8.

Toshino, S., H. Miyake, and H. Shibata. 2015. Meteorona kishinouyei, a new family, genus and species (Cnidaria, Cubozoa, Chirodropida) from Japanese waters. ZooKeys 503: 1-21.

Verrill, A. E. 1865. Synopsis of the polyps and corals of the North Pacific exploring expedition under Commodore C. Ringgold and Captain John Rodgers, U.S.N. Commun. Essex Inst. 4: 145-152.

Weir, B. S. 1996. Genetic Data Analysis II: Methods for Discrete Population Genetic Data. Sinauer, Sunderland, MA.

Weir, B. S., and C. C. Cockerham. 1984. Estimating F-Statistics for the analysis of population structure. Evolution 38: 1358-1370.

Werner, B. 1973. New investigations on systematics and evolution of the class Scyphozoa and the phylum Cnidaria. Publ. Seto Mar. Biol. Lab. 20: 35-61.

Yanagihara, A. A., and R. V. Shohet. 2012. Cubozoan venom-induced cardiovascular collapse is caused by hyperkalemia and prevented by zinc gluconate in mice. PLoS One 2012: e51368.

Yanagihara, A. A., J. M. Kuroiwa, L. M. Oliver, J. J. Chung, and D. D. Kunkel. 2002. Ultrastructure of a novel eurytele nematocyst of Carybdea alata Reynaud (Cubozoa, Cnidaria). Cell Tissue Res. 308: 307-318.

Yanagihara, A. A., C. Wilcox, R. King, K. Hurwitz, and A. M. Castelfranco. 2016. Experimental assays to assess the efficacy of vinegar and other topical first-aid approaches on Cubozoan (Alatina alata) tentacle firing and venom toxicity. Toxins 8: 19.

Yoshimoto, C. M., and A. A. Yanagihara. 2002. Cnidarian (coelenterate) application envenomations in Hawai'i improve following heat application. Trans. R. Soc. Trop. Med. Hyg. 96: 300-303.
Appendix 1
Alatina alata records from museum collections or the literature


   Species      Described as              Locality            Latitude

Alatina alata  Charybdea alata  Samoa                         -13.83
Alatina alata  Alatina moseri   Hawaii                         25.12
Alatina alata  Charybdea alata  South Pacific Ocean            -7.77
Alatina alata  Carybdea moseri  Hawaii                         21.38
Alatina alata  Alatina alata    Hawaii                         21.59
Alatina alata  Alatina moseri   Hawaii                         21.28


Alatina alata  Alatina moseri   Hawaii                         20.94
Alatina alata  Alatina moseri   South Pacific Ocean           -12.18
Alatina alata  Carybdea alata   French Polynesia              -17.48
Alatina alata  Alatina alata    Mississippi (Gulf of Mexico)   27.64
Alatina alata  Carybdea alata   Belize                         16.79
Alatina alata  Alatina alata    Mississippi (Gulf of Mexico)   29.16
Alatina alata  Alatina alata    Mississippi (Gulf of Mexico)   29.32
Alatina alata  Charybdea alata  Cuba                           22.10
Alatina alata  Charybdea alata  Cuba                           20.13
Alatina alata  Charybdea alata  Cuba                           23.22
Alatina alata  Carybdea alata   Cuba                           23.53
Alatina alata  Carybdea alata   Bahamas                        27.77
Alatina alata  Carybdea alata   Bahamas                        26.06
Alatina alata  Carybdea alata   Bahamas                        25.45
Alatina alata  Carybdea alata   Cuba                           20.00
Alatina alata  Carybdea alata   North Carolina                 35.05
Alatina alata  Carybdea alata   South Carolina                 32.55
Alatina alata  Carybdea alata   Northwest Atlantic             37.35
Alatina alata  Alatina alata    Bonaire                        12.19
Alatina alata  Alatina alata    Bonaire                        12.15


Alatina alata  Carybdea alata   Venezuela                      10.90
Alatina alata  Carybdea alata   Puerto Rico                    18.07
Alatina alata  Carybdea alata   Northwest Atlantic             37.83
Alatina alata  Carybdea alata   Northwest Atlantic             38.31
Alatina alata  Charybdea alata  Virgin Islands                 17.72
Alatina alata  Charybdea alata  Virgin Islands                 17.75
Alatina alata  Carybdea alata   Bermuda                        31.88
Alatina alata  Carybdea alata   Bermuda                        31.93
Alatina alata  Carybdea alata   Bermuda                        32.58
Alatina alata  Carybdea alata   Bermuda                        31.92
Alatina alata  Carybdea alata   Bermuda                        31.93
Alatina alata  Carybdea alata   Antigua and Barbuda            17.00
Alatina alata  Charybdea alata  North Atlantic Ocean           27.03
Alatina alata  Carybdea alata   Brazil                        -14.62
Alatina alata  Charybdea alata  Seychelles                     -5.02
Alatina alata  Charybdea alata  Sri Lanka                       6.60
Alatina alata  Charybdea alata  Sri Lanka                       5.47
Alatina alata  Carybdea alata   Indonesia                      -2.33
Alatina alata  Charybdea alata  Papua                          -1.33
Alatina alata  Alatina alata    Papua New Guinea               -3.38
Alatina alata  Alatina alata    Saipan                         15.24
Alatina alata  Alatina mordens  Australia                     -13.90
Alatina alata  Charybdea alata  New Caledonia                 -23.53

                                      Reference (museum collection
   Species     Longitude  Depth (m)     code no. or literature)

Alatina alata  -171.76        16      Stiasny, 1940
Alatina alata  -170.83        -       USNM 22311
Alatina alata  -167.17       3800     Stiasny, 1940
Alatina alata  -158.32        -       USNM 22309
Alatina alata  -158.11        -       USNM 1245460
Alatina alata  -157.84        -       USNM 1124426-1124451,
                                      1245923, 1245925,
                                      1155723, 42112, 51962
Alatina alata  -157.08        -       USNM 21800, 29632
Alatina alata  -150.00       860      USNM 1195808
Alatina alata  -149.84        0       FLMNH 8380
Alatina alata   -88.35        0       USNM 1131245
Alatina alata   -88.08        -       USNM 58207-58211
Alatina alata   -88.02      98-133    USNM 1131246
Alatina alata   -87.76    96.5-108.7  USNM 1005621
Alatina alata   -84.97        -       Stiasny, 1940
Alatina alata   -82.98        -       Stiasny, 1940
Alatina alata   -82.35        -       Stiasny, 1940
Alatina alata   -81.80        -       USNM 41920
Alatina alata   -78.77        -       USNM 41921
Alatina alata   -77.55     457-610    USNM 1195809
Alatina alata   -77.27        -       USNM 41919
Alatina alata   -75.12        -       USNM 94780
Alatina alata   -74.68     204-228    USNM 53694
Alatina alata   -72.23      0-100     USNM 42017
Alatina alata   -69.17       0-90     USNM 56737
Alatina alata   -68.30        -       USNM 1248604, 1248677
Alatina alata   -68.28        -       USNM 1195801-1195907,
                                      1205447-1205450, 1156074,
                                      1156075
Alatina alata   -67.97        -       USNM 53659
Alatina alata   -67.88        -       USNM 54398, 54472
Alatina alata   -67.42      0-150     USNM 56735
Alatina alata   -66.86       0-50     USNM 56736
Alatina alata   -64.93        -       Stiasny, 1940
Alatina alata   -64.92       950      Stiasny, 1940
Alatina alata   -64.45     327-335    USNM 58691
Alatina alata   -64.42        55      USNM 58692, 58316
Alatina alata   -63.97     550-675    USNM 58655
Alatina alata   -63.95      0-300     USNM 54367
Alatina alata   -63.77       350      USNM 54366
Alatina alata   -61.76        -       USNM 54385
Alatina alata   -53.65        -       Stiasny, 1940
Alatina alata   -38.83       1067     Morandini, 2003
Alatina alata    54.77       1880     Stiasny, 1940
Alatina alata    79.10       2530     Stiasny, 1940
Alatina alata    80.00       4000     Stiasny, 1940
Alatina alata   118.83        -       USNM 42094
Alatina alata   138.70       3450     Stiasny, 1940
Alatina alata   143.53       1-2      USNM 1296950, 1296951
Alatina alata   145.71        -       USNM 1296956-1296960
Alatina alata   146.63        -       USNM 1124410-1124425
Alatina alata   167.60       1060     Stiasny, 1940

(USNM, collection catalog coding of the National Museum of Natural
History, Smithsonian Institution, Washington, D.C.; FLMNH, Florida
Museum of Natural History, Gainesville, FL). Latitude and longitude are
presented in decimal degrees.

Appendix 2
Sequences from Alatina alata and Alatina grandis specimens collected in
this study and from other cubozoans available in GenBank

   Order         Family             Species         Isolate

 Carybdeida    Alatinidae        Alatina alata      AGC519
                                                    AGC520
                                                    TF1
                                                    TF2
                                                    TM1
                                                    TM2
                                                    TM3
                                                    QLD28
                                                    QLD29
                                                    QLD31A
                                                    QLD31B
                                                    QLD32A
                                                    QLD32B
                                                    QLD32C
                                                    QLD32D
                                                    QLD32E
                                                    QLD32F
                                                    QLD32G
                                                    QLD32H
                                                    QLD32I
                                                    QLD32J
                                                    CU01
                                                    CU02
                                                    CU03
                                                    CU04
                                                    CU05
                                                    CU06
                                                    CU07
                                                    CU08
                                                    CU09
                                                    CU10
                                                    CU11
                                                    CU12
                                                    CUB
                                                    CU14
                                                    CU15
                                                    CU16
                                                    CU17
                                                    CU18
                                                    CU19
                                                    CU20
                                                    CU21
                                                    CU22
                                                    CU23
                                                    CU24
                                                    CU25
                                                    CU27
                                                    GS
                                                    isoB
                                                    Saipan31
                                                    Saipan32
                                                    Saipan33
                                                    Saipan34
                                                    Saipan36
                             non-Carybdea
                             marsupialis

                             Alatina grandis        Saipan38

                                                    Saipan39
              Tripedaliidae  Tripedalia cystophora


                             Copula sivickisi
              Tamoyidae      Tamoya haplonema


                             Tamoya ohboya

                             Tamoya sp.
              Carybdeidae    Carybdea arborifera

                             Carybdea mora

                             Carybdea cf rastonii

                             Carybdea rastonii
                             Carybdea xaymacana

              Carukiidae     Carukia barnesi

                             Gerongia rifkinae
                             Morbakka virulenta

                             Cubozoa sp.
Chirodropida                 Chirodropidae sp.
                             Chironex fleckeh

                             Chiropsella bronzie

                             Chiropsalmus
                             quadrumanus

              Geographic
   Order      location

 Carybdeida   Kralendijk. Bonaire

              Osprey Reef,
              Australia

              Waikiki, Hawaii

              Saipan, Northern
              Mariana Islands

                       -

                       -
              Saipan, Northern
              Mariana Islands

                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
                       -
Chirodropida           -
                       -
                       -
                       -
                       -
                       -
                       -

                       -
                       -

                           GenBank Accession Numbers
   Order      ORF-PolB    COI          16S        ITS       28S

 Carybdeida   KU707221     -                              KU707403
              KU707222  KU707303   KU707330        -      KU707404
              KU707223  KU707304   KU707329     KU707358  KU707405
              KU707224  KU707305      -         KU707359  KU707406
              KU707225  KU707306   KU707331     KU707360  KU707407
              KU707226  KU707307   KU707332     KU707361  KU707408
              KU707227  KU707308   KU707333     KU707362  KU707409
              KU707228  KU707292   KU707321        -      KU707390

              KU707229  KU707293   KU707322        -         -
                 -         -          -            -      KU707391
                 -         -          -            -      KU707392
              KU707230  KU707294   KU707323     KU707349  KU707393
              KU707231  KU707295   KU707324     KU707350  KU707394
              KU707232  KU707296   KU707325     KU707351  KU707395
              KU707233  KU707297   KU707326        -      KU707396
              KU707234  KU707298   KU707327     KU707352  KU707397
              KU707235  KU707299       -        KU707353  KU707398
              KU707236  KU707300   KU707328     KU707354  KU707399
              KU707237  KU707301       -        KU707355  KU707400
              KU707238  KU707302       -        KU707356  KU707401
              KU707239      -          -        KU707357  KU707402
                 -      KU707276       -        KU707334  KU707367
              KU707240      -          -        KU707335  KU707368
                 -          -      GQ506987        -         -
              KU707241      -      GQ506988     KU707336  KU707369
              KU707242  KU707277   GQ506989        -      KU707370
              KU707243  KU707278   GQ506990     KU707337  KU707371
              KU707244  KU707279   GQ506991     KU707338  KU707372
              KU707245  KU707280   GQ506992     KU707339  KU707373
                 -          -      GQ506993        -          -
                 -          -      GQ506994        -          -
              KU707246      -      GQ506995     KU707340  KU707374
              KU707247  KU707281   GQ506996        -      KU707375
              KU707248  KU707282   KU707316     KU707341  KU707376
              KU707249  KU707283   GQ506997     KU707342  KU707377
              KU707250  KU707284   KU707317     KU707343  KU707378
              KU707251  KU707285   KU707318        -      KU707379
              KU707252  KU707286   KU707319        -      KU707380
              KU707253      -      KU707320        -      KU707381
              KU707254      -      -               -      KU707382
              KU707255  KU707287   GQ507000     KU707344  KU707383
              KU707256      -      GQ507001        -      KU707384
              KU707257      -      GQ5O70O2        -      KU707385
              KU707258  KU707288      -         KU707345  KU707386
              KU707259  KU707289   GQ507003     KU707346  KU707387
              KU707260  KU707290   GQ507004     KU707347  KU707388
              KU707261  KU707291   GQ507005     KU707348  KU707389
              KU707262  KU707274   KU707314        -         -
              KU707263  KU707275   KU707315        -         -
              KU707264  KU707269   KU707309        -         -

              KU707265  KU707270   KU707310     KU707363  KU707410
              KU707266  K.U707271  KU707311     KU707364     -
              KU707267  KU707272   KU707312     KU707365     -
              KU707268  KU707273   KU707313     KU707366     -
                 -          -      AF360118        -         -

                 -          -      GQ849105        -         -
                 -          -      KU707411        -         -

                 -          -      KU707412        -         -
                 -          -      GQ849123        -         -
                 -          -      GQ849124        -         -
                 -          -      KM200334        -         -
                 -          -      GQ849113        -         -
                 -          -      HQ824526        -         -
                 -          -      HQ824527        -         -
                 -          -      HQ824529        -         -
                 -          -      GQ849095        -         -
                 -          -      HQ824528        -         -
                 -          -      GQ849122        -         -
                 -          -      GQ849096        -         -
                 -          -      KP053889        -         -
                 -          -      KP053890        -         -
                 -          -      KM200331        -         -
                 -          -      AB720900        -         -
                 -          -      GQ849106        -         -
                 -          -      GQ849108        -         -
                 -          -      GQ849125        -         -
                 -          -      GQ849107        -         -
                 -          -      GQ849116        -         -
                 -          -      GQ849117        -         -
                 -          -      GQ849112        -         -
                 -          -      GQ849115        -         -
                 -          -      GQ849114        -         -
                 -          -      GQ849118        -         -
                 -          -      GQ849097        -         -
                 -          -      GQ849098        -         -
                 -          -      GQ849119        -         -
                 -          -      GQ849120        -         -
                 -          -      GQ849121        -         -
                 -          -      JN184782        -         -
Chirodropida     -          -      GQ849104        -         -
                 -          -      GQ849101        -         -
                 -          -      GQ849102        -         -
                 -          -      GQ849103        -         -
                 -          -      GQ849099        -         -
                 -          -      GQ849100        -         -
                 -          -      GQ849109        -         -

                 -          -      GQ849110        -         -
                 -          -      GQ849111        -         -


JONATHAN W. LAWLEY (1, 2, (*), CHERYL LEWIS AMES (2,3), BASTIAN BENTLAGE (2), ANGEL YANAGIHARA (4), ROGER GOODWILL (5), EHSAN KAYAL (2), KIKIANA HURWITZ (5), AND ALLEN G. COLLINS (2,6)

(1) Departamento de Ecologia e Zoologia, Universidade Federal de Santa Catarina, Florianopolis, SC 88040-970, Brazil; (2) Department of Invertebrate Zoology, National Museum of Natural History, Smithsonian Institution, Washington, D.C. 20013; (3) Biological Sciences Graduate Program, University of Maryland, College Park, Maryland 20742; (4) Department of Tropical Medicine, Medical Microbiology and Pharmacology, John A. Burns School of Medicine, University of Hawai'i at Manoa, Honolulu, Hawaii 96822; (5) Department of Biology, Brigham Young University--Hawaii, Laie, Hawaii 96792; and (6) National Systematics Laboratory of NOAA 's Fisheries Service, National Museum of Natural History, Smithsonian Institution, Washington, D.C. 20013

(*) To whom correspondence should be addressed. E-mail: jonathan.lawley@yahoo.com.br

Received 1 March 2016; accepted 15 June 2016.
Table 1
Primers used for sequencing

Marker    Primer name   Primer

ORF-PolB  AM_ORF314-F1  AGCGCTATGATTAGAGTATTTAAGG
          AM_ORF314-R1  TCAATTCTAGTTTAGAGCTTCCTC
          AM_polB-Fl    ATCCTGTACTAAGCCAAATCATC
          AM_polB-Rl    ATATAATCGGTCGTTAGTCGGC
COI       med-cox l-F   ACNAAYCAYAAAGATATHGG
          med-cox l-R   TGGTGNGCYCANACNATRAANCC
L6S       med-rnl-F     GACTGTTTACCAAAGACATAGC
          med-rnl-R     AAGATAGAAACCTTCCTGTC
ITS       C2            GAAAAGAACTTTGRARAGAGAGT
          D2            TCCGTGTTTCAAGACGGG
28S       28S-F63       AATAAGCGGAGGAAAAGAAAC
          28S-R635      GGTCCGTGTTTCAAGACGG

Marker    Reference

ORF-PolB  This study
          This study
          This study
          This study
COI       This study
          This study
L6S       This study
          This study
ITS       Chombard et al., 1997
          Chombard et al., 1997
28S       Medina et al., 2001
          Medina et al., 2001

ORF-PolB primers were designed based on Kayal et al. (2012). COI and
16S were designed based on conserved regions among medusozoan
cnidarians that overlap well with the commonly used Folmer et al.
(1994) and Palumbi (1996) fragments, respectively.

Table 2
Percentage pairwise difference between sampling localities

                     Bonaire  Australia  Hawaii  Saipan

          Bonaire    1.90     1.42       1.47    1.58
                     3.57
ORF-PolB  Australia  4.47     1.26       1.55    1.27
                              2.55
(0-6.47)  Hawaii     4,7      2.98       1.68    1.58
                                         3.42
          Saipan     4.26     2.43       2.88    1.21
                                                 2.22
          Bonaire    0.84     1.02       1.06    1.14
                     1.93
COI       Australia  2.52     0.59       1.06    0.59
                              1.23
(0-4.48)  Hawaii     2.66     1.57       1.17    1.03
                                         1.86
          Saipan     2.51     1.18       1.57    1.15
                                                 0.68
          Bonaire    0.64     0.36       0.42    0.38
                     1.30
16S       Australia  1.15     0.27       0.38    0.26
                              0.69
(0-2.02)  Hawaii     1.27     0.72       0.43    0.42
                                         0.80
          Saipan     1.1      0.56       0.67    0.21
                                                 0.45
          Bonaire    0.35     0.35       0.31    0,49
                     0.92
ITS       Australia  0.88     0.42       0.36    0.5
                              0.82
(0-2.15)  Hawaii     0.81     0.72       0.30    0.52
                                         0.64
          Saipan     1.19     1.05       1.05    0.48
                                                 1.35
          Bonaire    0.06     0.07       0.07    0.05
                     0.09
28S       Australia  0.08     0.06       0.06    0.05
                              0.06
(0-0.28)  Hawaii     0.09     0.07       0.07    0.05
                                         0.09
          Saipan     0.06     0.03       0.05

Values below diagonal are the averages; values above diagonal are the
standard deviations. Ranges below marker names are the minimum and
maximum percentage pairwise differences recorded for the marker. Absent
values indicate lack of sampling for average and standard deviation
calculations.

Table 3
Molecular diversity indices

          Indices       Bonaire              Saipan

ORF-PolB  N        7                   5
          Nh       7                   5
          h        1 [+ or -] 0.08     1 [+ or -] 0.13
          [pi]     0.03 [+ or -] 0.01  0.02 [+ or -] 0.01
COI       N        6                   5
          Nh       6                   5
          h        1 [+ or -] 0.09     1 [+ or -]0.13
          [pi]     0.02 [+ or -] 0     0.01 [+ or -] 0
16S       N        5                   5
          Nh       4                   5
          h        0.9 [+ or -] 0.16   1 [+ or -]0.13
          [pi]     0.01 [+ or -] 0     0.01 [+ or -] 0
ITS       N        5                   4
          Nh       9                   5
          h        0.98 [+ or -] 0.05  0.89 [+ or -] 0.09
          [pi]     0.01 [+ or -] 0     0.01 [+ or -] 0
28S       N        7                   1
          Nh       3                   1
          h        0.6 [+ or -] 0.08   0[+ or -]0
          [pi]     0.001 [+ or -] 0    0[+ or -]0

              Australia             Hawaii               All

ORF-PolB  12                   24                   48
          12                   23                   47
           1 [+ or -] 0.03      0.99 [+ or -] 0.01   0.99 [+ or -] 0
           0.02 [+ or -] 0      0.03 [+ or -] 0      0.03 [+ or -] 0
COI       11                   18                   40
          11                   17                   36
           1 [+ or -] 0.04      0.99 [+ or -] 0.02   0.99 [+ or -] 0.01
           0.01 [+ or -] 0      0.02 [+ or -] 0      0.02 [+ or -] 0
16S        8                   24                   42
           8                   15                   26
           1 [+ or -] 0.06      0.94 [+ or -] 0.03   0.96 [+ or -] 0.02
           0.01 [+ or -] 0      0.01 [+ or -] 0      0.01 [+ or -] 0
ITS        9                   15                   33
          10                   16                   19
           0.92 [+ or -] 0.04   0.95 [+ or -] 0.02   0.97 [+ or -] 0.01
           0.01 [+ or -] 0      0.01 [+ or -] 0      0.01 [+ or -] 0
28S       13                   23                   44
           4                    8                    9
           0.29 [+ or -]0.11    0.52 [+ or -] 0.08   0.47 [+ or -] 0.06
           0.001 [+ or -] 0     0.001 [+ or -] 0     0[+ or -]0

Haplotype and nucleotide diversity are represented as mean [+ or -]
standard deviation. N, number of individuals sequenced; Nh, number of
haplotypes or alleles; h, haplotype diversity; [pi], nucleotide
diversity.

Table 4
AMOVA and Isolation by Distance (IBD) analyses

                              ORF-PolB  COI     16S     ITS     28S

All four sampled localities
 Among population variation   14%       17%      9%      9%      3%
 Within population variation  86%       83%     91%     91%     97%
 [PHI]ST/ FST                  0.137     0.170   0.086   0.088   0.032
Atlantic vs. Pacific
 Among group variation        31%       35%     27%      4%     12%
 Within group variation       -1%        0%     -2%      7%     -2%
 Within population variation  70%       65%     75%     89%     90%
 [PHI]ST/ FST                  0.302     0.354   0.249   0.110   0.099
 [PHI]SC/ FSC                 -0.010     0.001  -0.031   0.075  -0.027
 [PHI]CT/ FCT                  0.309     0.353   0.272   0.038   0.122
Isolation by distance (r)      0.791     0.968   0.850   0.260   0.955
 P-value                       0.208     0.041   0.129   0.417   0.121

Analysis of molecular variance (AMOVA) is represented in the first part
of the table with only one group encompassing the entire dataset
including all four populations; then with two groups divided by ocean
basin (i.e., Pacific containing Saipan, Australia, and Hawaii vs.
Atlantic containing Bonaire). The mitochondrial AMOVA was calculated
assuming the TrN model of nucleotide evolution. Molecular variance is
divided into components of among groups (OCT and FCT), among localities
within groups ([PHI]SC and FSC), and among all localities ([PHI]ST and
FST). Values in bold are significant (P < 0.05).

Table 5
Pairwise [PHI]ST and FST between sampling localities

                     Bonaire  Australia  Hawaii

ORF-PolB  Bonaire
          Australia  0.33856
          Hawaii     0.26632  -0.00804
          Saipan     0.30904   0.0088    -0.01313
COI       Bonaire
          Australia  0.40264
          Hawaii     0.2944    0.00702
          Saipan     0.37697  -0.00964    0.00402
16S       Bonaire
          Australia  0.15865
          Hawaii     0.24323  -0.04435
          Saipan     0.19975  -0.05031    0.01688
ITS       Bonaire
          Australia  0.0751
          Hawaii     0.10827   0.02792
          Saipan     0.15351   0.06368    0.18581
28S       Bonaire
          Australia  0.17493
          Hawaii     0.05603  -0.00225
          Saipan     0.01712  -0.31725   -0.25806

Values in bold are significant (P < 0.05). The Pairwise [PHI]STs
(mitochondrial) were calculated assuming the TrN model of nucleotide
evolution.
COPYRIGHT 2016 University of Chicago Press
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Lawley, Jonathan W.; Ames, Cheryl Lewis; Bentlage, Bastian; Yanagihara, Angel; Goodwill, Roger; Kaya
Publication:The Biological Bulletin
Article Type:Report
Date:Oct 1, 2016
Words:11998
Previous Article:Sea hare Aplysia punctata (Mollusca: Gastropoda) can maintain shell calcification under extreme ocean acidification.
Next Article:New Editor-in-Chief of The Biological Bulletin.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters