Printer Friendly

Both Quorum Sensing (Qs)-I and Ii Systems Regulate Escherichia coli Flagellin Expression.

Byline: Yang Yang, Yun Liu, Mingxu Zhou and Guoqiang Zhu

Abstract

For elucidating effect of quorum sensing (QS) systems I and II (QS-1 and QS-II) on Escherichia coli flagellin expression, E. coli F18ab strain 107/86 was modified to either express acyl-homoserine lactone (AHL) synthase (QS-I) or deleted for autoinducer 2 (AI-2) expression (QS-II). AHL expression and deletion of luxS (AI-2) both inhibited flagellin expression, as measured by motility assays, bacterial gene expression, and host responses to infection. The QS systems and flagellin were coordinately regulated, as deleting fliC caused decreased QS-II activity.

Key words

E.coli, Flagellin, Quorum sensing-I and II.

INTRODUCTION

Porcine edema disease and porcine post-weaning diarrhea are two important diseases which bring pigs high morbidity and mortality. Shiga toxin-producing E. coli (STEC) is major pathogen of the diseases (Da et al., 2001; Frydendahl, 2002). Flagella participate in bacterial pathogenicity as important virulence factor. Besides providing motility, it also contributes to bacterial initial adhesion or colonization to host cells. In vivo, enteric bacteria could take advantage of flagella motility to compete with intestinal microbiota by exploiting inflammation (Stecher et al., 2004, 2008; Duan et al., 2012; Zhou et al., 2013).

Quorum sensing (QS) represents one crucial communication system, and was considered as a kind of bacterial-population based language between bacteria (Pacheco and Sperandio, 2009; Curtis and Sperandio, 2011). QS-I positive bacteria normally express acyl-homoserine lactone (AHL) synthase, whereas the QS-II system is regulated by LuxS and autoinducer 2 (AI-2) (Niu et al., 2013). We previously reported that QS-I expression in E. coli suppresses flagella expression (Yang et al., 2013). QS-II also regulates bacterial virulence strategies, including regulate motility by flhDC, type III secretion systems (Anand and Griffiths, 2003; Li et al., 2007; Han and Lu, 2009), as well as biofilm formation and bacterial pathogenicity (Sperandio et al., 2002; Clarke et al., 2006; Gonzalez et al., 2006).

Here we investigated the extent to which QS-II can also regulate flagellin expression in STEC and examined the potential for coordinate regulation between two QS systems.

MATERIALS AND METHODS

Strains used in this study

Strains and plasmids used are listed in Table I. LB broth or LB agar plates were used for bacterial growth. Caco-2 cell line was cultivated in DMEM with 10 % FBS (37 AdegC, 5 % CO2). Human TNF and IL-8 immunoassay Kits (RandD Systems, Inc.) were purchased for relative experiments.

Construction of recombinant strains

The F18ab luxS gene in-frame deletion mutant (F18abIluxS) was constructed using I>>Red-based recombination system (Datsenko and Wanner, 2000). The luxS open reading frame (ORF) was amplified by primers LuxS-1/ LuxS-2 (Table II). Plasmid pBR-luxS was constructed and then transformed into F18abIluxS to obtain the complemented strain F18abIluxS/pluxS.

To over-express uvrY and csrB in F18ab, the primers uvrY-F/uvrY-R and csrB-F/csrB-R were used to PCR amplify uvrY and csrB, respectively. uvrY and csrB were cloned into pBR322 and transformed into F18ab E. coli.

AI-2 bioassays and motility assays

After grown to an OD600 of 1.3, supernatants of strains were collected. Bioluminescence was measured in luminescence mode by Tecan GPM reader (Han and Lu, 2009; Zhou et al., 2014). For motility assays, strains were seeded in the middle of motility agar plates. After appropriate growth time, motility halos were measured (Duan et al., 2013).

Table I.- Strains and plasmids used in this study.

Strain or plasmid###Description###Source or reference

Strains

E. coli F18ab 107/86###Wild-type:###Duan et al. (2012)

###O139:H1:F18ab, Stx2e; O139:H1:F18ab, Stx2e

E. coli F18ab/pyenI###107/86 carrying pyenI###Yang et al. (2013)

E. coli F18ab/pBR###107/86 carrying pBR322###Yang et al. (2013)

E. coli F18abfliC###fliC deletion mutant###Duan et al. (2012)

E. coli F18abfliC/pfliC###F18abfliC carrying pBR-fliC###Duan et al. (2012)

E. coli F18abluxS###luxS deletion mutant###This study

E. coli F18abluxS/pluxS###F18abluxS carrying pBR-luxS###This study

E. coli F18ab/pcsrB###107/86 carrying pcsrB###This study

E. coli F18ab/puvrY###107/86 carrying puvrY###This study

E. coli DH5a###AI-2 bioassay negative control###Takara Ltd.

Vibrio harveyi BB170###AI-2 bioassay reporter strain###Bassler et al. (1994); Yang et al. (2013)

Plasmids

pBR322###Expression vector, Ampr###Takara Ltd.

pBR-luxS###pBR322 carrying LuxS ORF###This study

pKD3###Cmr; Cm cassette template###Datsenko and Wanner (2000); Duan et al. (2012)

pKD46###Ampr, Red recombinase expression###Datsenko and Wanner (2000); Duan et al. (2012)

pCP20###Ampr,Cmr; Flp recombinase expression###Datsenko and Wanner (2000); Duan et al. (2012)

Table II.- Primers used in this study.

Primer###Sequence (5'-3')###Primer###Sequence (5'-3')

LuxS-1###ATGCCGTTGTTAGATAGCTTCAC###csrA-RT-F###AGCCTGGATACGCTGGTAGA

LuxS-2###CTAGATGTGCAGTTCCTGCAACT###csrA-RT-R###CGAGTTGGTGAGACCCTCAT

LuxS-1###TGCAGTTCGGGTGGCGAAAACAATGA###barA-RT-F###GCTGCGTACACCACTGAATG

###ACACCCCGCATGGCGACGCAATCATGT###barA-RT-R###TGCGTAGTGGGAATGGAATAC

###GTAGGCTGGAGCTGCTTCG

###fliC-RT -F###CAGCAAGCGGTGAAGTGAA

LuxS-2###TCTGATTCTGATCCTGCACTTTCAGCAC###fliC-RT-R###AAGCGTAGCCACAGTAGCA

###GTCTTCCATTGCCGCTTTCCCATATGAAT###flhD-RT-F###ACTGACTCTTCCGCAAATGGT

###ATCCTCCTTAG

###flhD-RT-R###TGGCTGTCAAAACGGAAGTG

uvrY-F###TAAGGATCCATGGACATGAGTAT###il8-RT-F###TGCAGCTCTGTGTGAAGGTG

uvrY-R###TTAGTCGACTCACTGACTTGATAAT###il8-RT-R###ACTTCTCCACAACCCTCTGC

csrB-F###TAAGGATCCGTCGACAGGGAGT###il10-RT-F###CCACGCTTTCTAGCTGTTGA

csrB-R###CGCGTCGACAATAAAAAAAGGG###il10-RT-R###CTCCGAGACACTGGAAGGTG

gapA-RT-F###CGTTAAAGGCGCTAACTTCG###tnfa-RT -F###CCCAGGGACCTCTCTCTAATC

gapA-RT-R###ACGGTGGTCATCAGACCTTC###tnfa-RT-R###TGAGGTACAGGCCCTCTGAT

uvrY-RT-F###TACCAGCGAAAGTCATGCAG###GAPDH-RT-F###GATGGGCGTGAACCATGAG

uvrY-RT-R###CGTTCAGACAAACTGGCAAA###GAPDH-RT-R###GAGGCATTGCTGACGATCTTG

Measurement of mRNA level

Tiangen RNA Extraction Kit (DP419) was employed in this study, through which total RNA from each strain was prepared (Han and Lu, 2009). Primers for flhD, fliC, csrA, barA, uvrY, pfs, and luxS genes were designed and listed in Table II. Gene gapA was chosen as the endogenous reference. Caco-2 (1x106 cells/well density) was plated in 6-well plates. 107 CFU of relative strains were injected into each well, and infected for 2 h. Then cells were dealt with Tiangen RNA Extraction Kit following the standard protocol. 2-IICT method was employed for data analysis.

ELISA assay

Monolayer of Caco-2 was prepared for infection of individual E. coli strains. After 2h incubation, supernatants were obtained by centrifugation (Duan et al., 2012). With commercial kits, expression levels of IL-8 and TNF were then measured.

Statistics

All experiments were repeated at least 3 times. Data are presented as the mean + standard deviation. To evaluate statistical significance with p < 0.05 considered significant, the Student's t-test method was employed.

RESULTS AND DISCUSSION

QS-1 and QS-II have differential impact on bacterial motility and affect E. coli-induced pro-inflammatory responses F18ab E. coli was transformed with the yenI gene from Y. enterocolitica to induce endogenous AHL production (QS-1) (Yang et al., 2013). Flagella involves in bacterial motility, adhesion, invasion. Furthermore, it could induce inflammation response in host cells. With the recombinant strain, function of AHL (QS-1 signals) upon flagella expression could be identified. Subsequently, expressing pyenI inhibited bacterial motility on swim agar plates (Fig. 1A). Reduced flagella expression was observed in AHL positive strain F18ab/pyenI, as well as decreased motility ability.

QS-II manipulates multiple genes expression through AI-2. In many pathogenic bacteria, AI-2 participates in regulating bacterial virulence strategies. To assess a similar role for QS-2 on motility, we deleted the luxS gene. F18abIluxS was deficient in AI-2 production (Fig. 1B) and was less motile than the WT strain (Fig. 1A). Consistent with their impaired motility, fliC expression was inhibited in both pyenI and in IluxS (Fig. 1C).

Bacterial flagellin can induce pro-inflammatory responses through TLR5. TLR5 stimulates pro-inflammatory genes in NF-KB and MAPK pathways (Vijay-Kumar et al., 2010; Salazar-Gonzalez and Navarro-Garcia, 2011). Researchers found that as one pathogen-associated molecular pattern (PAMP), flagellin also have TLR5-independent pro-inflammatory ability by Naip5 and Ipaf, members of the NLR family (Miao et al., 2006; Ren et al., 2006).

These F18ab E. coli strains did not activate the pro-inflammatory IL-8 or TNF responses of infected Caco-2 cells to a magnitude equal to that of infection by WT F18ab E. coli, as measured by both RT-PCR (Fig. 2A, B) or by ELISA (Fig. 2C, D). QS-1 expression inhibits F18 E. coli motility, whereas QS-II expression enhances motility by affecting fliC expression.

AI-1 and flagella expression influence AI-2

AI-2 activity was impaired in F18ab/pyenI, indicating that QS-1 influences AI-2 production (Fig. 1B). The phenomenon was consistent with the decreased mRNA level of both luxS and pfs in F18ab/pyenI (Fig. 3), which encode enzymes involved in AI-2 synthesis in E. coli (Zhu et al., 2007). Pfs, an important functional enzyme in AI-2 signal synthesis, encounter 25 % decrease of mRNA level under QS-1 influence, while flagella motility was reduced heavily in luxS mutant. FliC expression also regulated QS-II, as deleting fliC inhibited pfs and luxS expression (Fig. 3).

Coordinate regulation of flagella and QS expression

Bacteria utilize two-component systems for adaptation to environmental changes (Pernestig et al., 2001, 2003; Herren et al., 2006; Yang et al., 2014). The BarA/UvrY and the CsrA/CsrB two-component systems regulate flagella expression (Edwards et al., 2011). UvrY can activate barA expression through an auto-regulatory loop. Influence of CsrA upon csrB is regulated partly by barA, and a BarA-independent, UvrY-dependent mechanism also involves. CsrA indirectly induces csrB transcription. UvrY can directly activate csrB transcription, and also is included in up-regulation of CsrA. Increased transcription of uvrY has been observed when E. coli is sustained in an AHL-positive environment (Wei et al., 2001; Van Houdt et al., 2006).

In this study, expression of barA and uvrY were increased by 2.3- and 2.7-fold, respectively, in F18ab/pyenI (Fig. 4). Up-regulation of uvrY and barA can induce csrB transcription, which binds to CsrA and antagonizes its regulatory effects upon flhDC (Liu and Romeo, 1997; Mercante et al., 2009; Edwards et al., 2011). flhD expression did decreased 2.1-fold in pyenI (Fig. 4). Over-expressing uvrY and csrB caused a 1.7- and 2.3-fold reduction in fliC expression, respectively (Fig. 1C).

CONCLUSIONS

Overall, we show here that expressing QS-1 in E. coli inhibits flagella expression, whereas the LuxS QS-II system up-regulates flagella expression. These systems are coordinately regulated, as QS-I inhibited QS-II and flagellin expression positively regulated LuxS. We implicate the BarA/UvrY and the CsrA/CsrB two-component systems as possible regulators of this coordinated regulation. In the presence of cattle rumen AHLs, E. coli O157:H7 represses LEE gene expression and activates gad expression to improve acid tolerance (Sperandio, 2010; Sheng et al., 2013). Other aspects of E. coli biology are also regulated by AHLs, including cell division (Sitnikov et al., 1996) and antibiotic resistance (Rahmati et al., 2002). These data suggest that E. coli flagella expression is also regulated by AHLs.

ACKNOWLEDGEMENTS

This study was supported by grants from the 13th Five-Year National Key Development Program (2016YFD0501000), Natural Science Foundation of Jiangsu Province (BK20150442), the Chinese National Science Foundation Grants (Nos. 31502075, 31072136, 31270171 and 30771603), the Genetically Modified Organisms Technology Major Project of China (2014ZX08006-001B), Program for Chang Jiang Scholars and Innovative Research Team In University "PCSIRT" (IRT0978), 948 programme from Ministry of Agriculture of the People's Republic of China (grant No. 2011-G24) and the Priority Academic Program Development of Jiangsu Higher Education Institutions.

Statement of conflict of interest

The authors or their institution do not have any relationships that may influence or bias the results and data presented in this manuscript. There is no conflict of interests regarding the publication of the manuscript.

REFERENCES

Anand, S.K. and Griffiths, M.W., 2003. Quorum sensing and expression of virulence in Escherichia coli O157:H7. Int. J. Fd. Microbiol., 85: 1-9. https://doi.org/10.1016/S0168-1605(02)00482-8

Bassler, B.L., Wright, M. and Silverman, M.R., 1994. Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway. Mol. Microbiol., 13: 273-286. https://doi.org/10.1111/j.1365-2958.1994.tb00422.x

Clarke, M.B., Hughes, D.T., Zhu, C., Boedeker, E.C. and Sperandio, V., 2006. The QseC sensor kinase: a bacterial adrenergic receptor. Proc. natl. Acad. Sci. USA, 103: 10420-10425. https://doi.org/10.1073/pnas.0604343103

Curtis, M.M. and Sperandio, V., 2011. A complex relationship: The interaction among symbiotic microbes, invading pathogens, and their mammalian host. Mucosal. Immunol., 4: 133-138. https://doi.org/10.1038/mi.2010.89

Da, S.A., Valadares, G.F., Penatti, M.P., Brito, B.G. and Da, S.L.D., 2001. Escherichia coli strains from edema disease: O serogroups, and genes for Shiga toxin, enterotoxins, and F18 fimbriae. Vet. Microbiol., 80: 227-233. https://doi.org/10.1016/S0378-1135(01)00316-9

Datsenko, K.A. and Wanner, B.L., 2000, One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. natl. Acad. Sci. USA, 97: 6640-6645. https://doi.org/10.1073/pnas.120163297

Duan, Q., Zhou, M., Zhu, L. and Zhu, G., 2012. Flagella and bacterial pathogenicity. J. Basic Microbiol., 52: 1-8.

Duan, Q., Zhou, M., Zhu, X., Bao, W., Wu, S., Ruan, X., Zhang, W., Yang, Y., Zhu, J. and Zhu, G., 2012. The flagella of F18ab Escherichia coli is a virulence factor that contributes to infection in a IPEC-J2 cell model in vitro. Vet. Microbiol., 160: 132-140. https://doi.org/10.1016/j.vetmic.2012.05.015

Duan, Q., Zhou, M., Zhu, X., Yang, Y., Zhu, J., Bao, W., Wu, S., Ruan, X., Zhang, W. and Zhu, G., 2013. Flagella from F18+Escherichia coli play a role in adhesion to pig epithelial cell lines. Microb. Pathog., 55: 32-38. https://doi.org/10.1016/j.micpath.2012.09.010

Edwards, A.N., Patterson-Fortin, L.M., Vakulskas, C.A., Mercante, J.W., Potrykus, K., Vinella, D., Camacho, M.I., Fields, J.A., Thompson, S.A., Georgellis, D., Cashel, M., Babitzke, P. and Romeo, T., 2011. Circuitry linking the Csr and stringent response global regulatory systems. Mol. Microbiol., 80: 1561-1580. https://doi.org/10.1111/j.1365-2958.2011.07663.x

Frydendahl, K., 2002. Prevalence of serogroups and virulence genes in Escherichia coli associated with postweaning diarrhoea and edema disease in pigs and a comparison of diagnostic approaches. Vet. Microbiol., 85: 169-182. https://doi.org/10.1016/S0378-1135(01)00504-1

Gonzalez, B.A., Zuo, R., Hashimoto, Y., Yang, L., Bentley, W.E. and Wood, T.K., 2006, Autoinducer 2 controls biofilm formation in Escherichia coli through a novel motility quorum-sensing regulator (MqsR, B3022). J. Bact., 188: 305-316. https://doi.org/10.1128/JB.188.1.305-316.2006

Han, X.G. and Lu, C.P., 2009. Detection of autoinducer-2 and analysis of the profile of luxS and pfs transcription in Streptococcus suis serotype 2. Curr. Microbiol., 58: 146-152. https://doi.org/10.1007/s00284-008-9291-9

Herren, C.D., Mitra, A., Palaniyandi, S.K., Coleman, A., Elankumaran, S. and Mukhopadhyay, S., 2006. The BarA-UvrY two-component system regulates virulence in avian pathogenic Escherichia coli O78:K80:H9. Infect. Immun., 74: 4900-4909. https://doi.org/10.1128/IAI.00412-06

Li, J., Attila, C., Wang, L., Wood, T.K., Valdes, J.J. and Bentley, W.E., 2007. Quorum sensing in Escherichia coli is signaled by AI-2/LsrR: Effects on small RNA and biofilm architecture. J. Bact., 189: 6011-6020. https://doi.org/10.1128/JB.00014-07

Liu, M.Y. and Romeo, T., 1997. The global regulator CsrA of Escherichia coli is a specific mRNA-binding protein. J. Bact., 179: 4639-4642. https://doi.org/10.1128/jb.179.14.4639-4642.1997

Mercante, J., Edwards, A.N., Dubey, A.K., Babitzke, P. and Romeo, T., 2009. Molecular geometry of CsrA (RsmA) binding to RNA and its implications for regulated expression. J. mol. Biol., 392: 511-528. https://doi.org/10.1016/j.jmb.2009.07.034

Miao, E.A., Alpuche-Aranda, C.M., Dors, M., Clark, A.E., Bader, M.W., Miller, S.I. and Aderem, A., 2006. Cytoplasmic flagellin activates caspase-1 and secretion of interleukin 1beta via Ipaf. Nat. Immunol., 7: 569-575. https://doi.org/10.1038/ni1344

Niu, C., Robbins, C.M., Pittman, K.J., Osborn, J., Stubblefield, B.A., Simmons, R.B. and Gilbert, E.S., 2013. LuxS influences Escherichia coli biofilm formation through autoinducer-2-dependent and autoinducer-2-independent modalities. FEMS Microbiol. Ecol., 83: 778-791. https://doi.org/10.1111/1574-6941.12034

Pacheco, A.R. and Sperandio, V., 2009. Inter-kingdom signaling: Chemical language between bacteria and host. Curr. Opin. Microbiol., 12: 192-198. https://doi.org/10.1016/j.mib.2009.01.006

Pernestig, A.K., Georgellis, D., Romeo, T., Suzuki, K., Tomenius, H., Normark, S. and Melefors, O., 2003. The Escherichia coli BarA-UvrY two-component system is needed for efficient switching between glycolytic and gluconeogenic carbon sources. J. Bact., 185: 843-853. https://doi.org/10.1128/JB.185.3.843-853.2003

Pernestig, A.K., Melefors, O. and Georgellis, D., 2001. Identification of UvrY as the cognate response regulator for the BarA sensor kinase in Escherichia coli. J. biol. Chem., 276: 225-231. https://doi.org/10.1074/jbc.M001550200

Rahmati, S., Yang, S., Davidson, A.L. and Zechiedrich, E.L., 2002. Control of the AcrAB multidrug efflux pump by quorum-sensing regulator SdiA. Mol. Microbiol., 43: 677-685. https://doi.org/10.1046/j.1365-2958.2002.02773.x

Ren, T., Zamboni, D.S., Roy, C.R., Dietrich, W.F. and Vance, R.E., 2006. Flagellin-deficient Legionella mutants evade caspase-1- and Naip5-mediated macrophage immunity. PLoS Pathog., 2: e18. https://doi.org/10.1371/journal.ppat.0020018

Salazar-Gonzalez, H. and Navarro-Garcia, F., 2011. Intimate adherence by enteropathogenic Escherichia coli modulates TLR5 localization and proinflammatory host response in intestinal epithelial cells. Scand. J. Immunol., 73: 268-283. https://doi.org/10.1111/j.1365-3083.2011.02507.x

Sheng, H., Nguyen, Y., Hovde, C.J. and Sperandio, V., 2013. SdiA aids enterohemorrhagic E. coli carriage by cattle fed forage or grain diets. Infect. Immun., 81: 3472-3478. https://doi.org/10.1128/IAI.00702-13

Sitnikov, D.M., Schineller, J.B.,and Baldwin, T.O., 1996. Control of cell division in Escherichia coli: Regulation of transcription of ftsQA involves both rpoS and SdiA-mediated autoinduction. Proc. natl. Acad. Sci. USA, 93: 336-341. https://doi.org/10.1073/pnas.93.1.336

Sperandio, V., 2010. SdiA sensing of acyl-homoserine lactones by enterohemorrhagic E. coli (EHEC) serotype O157:H7 in the bovine rumen. Gut Microbes, 1: 432-435. https://doi.org/10.4161/gmic.1.6.14177

Sperandio, V., Torres, A.G. and Kaper, J.B., 2002. Quorum sensing Escherichia coli regulators B and C (QseBC): A novel two-component regulatory system involved in the regulation of flagella and motility by quorum sensing in E. coli. Mol. Microbiol., 43: 809-821. https://doi.org/10.1046/j.1365-2958.2002.02803.x

Stecher, B., Barthel, M., Schlumberger, M.C., Haberli, L., Rabsch, W., Kremer, M. and Hardt W.D., 2008. Motility allows S. typhimurium to benefit from the mucosal defence. Cell Microbiol., 10: 1166-1180. https://doi.org/10.1111/j.1462-5822.2008.01118.x

Stecher, B., Hapfelmeier, S., Muller, C., Kremer, M., Stallmach, T. and Hardt, W.D., 2004. Flagella and chemotaxis are required for efficient induction of Salmonella enterica serovar Typhimurium colitis in streptomycin-pretreated mice. Infect. Immun., 72: 4138-4150. https://doi.org/10.1128/IAI.72.7.4138-4150.2004

Van Houdt, R., Aertsen, A., Moons, P., Vanoirbeek, K. and Michiels, C.W., 2006. N-acyl-L-homoserine lactone signal interception by Escherichia coli. FEMS Microbiol. Lett., 256: 83-89. https://doi.org/10.1111/j.1574-6968.2006.00103.x

Vijay-Kumar, M., Carvalho, F.A., Aitken, J.D., Fifadara, N.H. and Gewirtz, A.T., 2010. TLR5 or NLRC4 is necessary and sufficient for promotion of humoral immunity by flagellin. Eur. J. Immunol., 40: 3528-3534. https://doi.org/10.1002/eji.201040421

Wei, Y., Lee, J.M., Smulski, D.R. and LaRossa, R.A., 2001, Global impact of sdiA amplification revealed by comprehensive gene expression profiling of Escherichia coli. J. Bact., 183: 2265-2272. https://doi.org/10.1128/JB.183.7.2265-2272.2001

Yang, Y., Yao, F., Zhou, M., Zhu, J., Zhang, X., Bao, W., Wu, S., Hardwidge, P.R. and Zhu, G., 2013. F18ab Escherichia coli flagella expression is regulated by acyl-homoserine lactone and contributes to bacterial virulence. Vet. Microbiol., 165: 378-383.

Yang, Y., Zhou, M., Hou, H., Zhu, J., Yao, F., Zhang, X., Zhu, X., Hardwidge, P.R. and Zhu, G., 2014. Quorum-sensing gene luxS regulates flagella expression and Shiga-like toxin production in F18ab Escherichia coli. Can. J. Microbiol., 60: 355-361. https://doi.org/10.1139/cjm-2014-0178

Zhou, M., Duan, Q., Zhu, X., Guo, Z., Li, Y., Hardwidge, P.R. and Zhu, G., 2013. Both flagella and F4 fimbriae from F4ac+ enterotoxigenic Escherichia coli contribute to attachment to IPEC-J2 cells in vitro. Vet. Res., 44: 30. https://doi.org/10.1186/1297-9716-44-30

Zhou, M., Guo, Z., Yang, Y., Duan, Q., Zhang, Q., Yao, F., Zhu, J., Zhang, X., Hardwidge, P.R. and Zhu, G., 2014. Flagellin and F4 fimbriae have opposite effects on biofilm formation and quorum sensing in F4ac+ enterotoxigenic Escherichia coli. Vet. Microbiol., 168: 148-153. https://doi.org/10.1016/j.vetmic.2013.10.014

Zhu, C., Feng, S., Sperandio, V., Yang, Z., Thate, T.E., Kaper, J.B. and Boedeker, E.C., 2007. The possible influence of LuxS in the in vivo virulence of rabbit enteropathogenic Escherichia coli. Vet. Microbiol., 125: 313-322. https://doi.org/10.1016/j.vetmic.2007.05.030
COPYRIGHT 2018 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Yang, Yang; Liu, Yun; Zhou, Mingxu; Zhu, Guoqiang
Publication:Pakistan Journal of Zoology
Article Type:Report
Date:Oct 31, 2018
Words:3701
Previous Article:Rapid and Simple Detection of Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) by Reverse Transcription Loop-Mediated Isothermal...
Next Article:Replacement of Fish Meal with Moringa oleifera Leaf Meal (MOLM) and its Effect on Growth Performance and Nutrient Digestibility in Labeo rohita...
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |