Printer Friendly

Black hawk-eagle (Spizaetus tyrannus) identified by DNA from a feather recovered in the rain-forest region of Veracruz.

DNA-based species identification has increasingly been used in recent years. For example, DNA extracted from feces was used to identify a vagrant tropical kingbird (Tyrannus melancholicus) found in Michigan almost 2,000 km from the northern limit of its normal range (Lindsay and Hass, 2013); comparison with DNA samples from museum skins allowed for its precise identification. New approaches for environment surveillance involving environmental DNA demonstrate, among other things, that this method can be useful in monitoring common species as well as those that are threatened and endangered (Bohmann et al., 2014).

In the late 1990s, 42% of all Neotropical raptors were considered threatened due to habitat loss, environmental pollutants, and direct persecution (Bildstein et al., 1998). Those in Mexico and Central America might be at particularly high risk because of the limited extents of remaining habitat relative to regions further to the south (Wassenaar et al., 2007). Raptors are top predators, their populations are of limited size, and they are one of the most threatened groups of birds in tropical environments. Habitat loss and fragmentation have diminished the abundance, richness, and diversity of these birds and their prey (Carrete et al., 2009). In addition, raptors often are persecuted by local people, due to presumed attacks on poultry, and also are captured for the pet market. Given these factors, it is important to document occurrences of Neotropical raptors throughout their current ranges.

[FIGURE 1 OMITTED]

The Los Tuxtlas Biosphere Reserve, Veracruz, is the most-northerly tropical rainforest in the Americas. Although strongly affected by deforestation in the 1970s, the remaining forests are protected in a reserve of 115,122 ha of which 12% is continuous and well preserved forest (Comision Nacional de Areas Naturales Protegidas, 2006).

On 17 June 2013, along a transect through a habitat fragment of evergreen rain forest and secondary growth in the central part of the Los Tuxtlas Biosphere Reserve, we were searching for feathers of the great curassow (Crax rubra). During the search we recovered a single large, black, unidentified tail feather with four whitish bands; it measured 30.7 cm in length, 7.2 cm in width, and 7.5 cm in calamus length (Fig. 1). The feather was in the leaf litter at the foot of a Macayo tree (Andira galeottiana) at an elevation of 532 m above sea level (18[degrees]29'2.42,,N, 95[degrees]4'30.16"W). Subsequently, the feather was examined and compared with those of several specimens housed in the National Collection of Birds of Mexico (Instituto de Biologia, Universidad Nacional Autonoma de Mexico). However, because we could not conclusively identify the feather to species level based on appearance alone, we subjected it to genetic analysis.

DNA was extracted using a DNeasy[R] Blood & Tissue Kit (Qiagen, Hilden, Germany). A 25-mg portion of the edge of the feather calamus was cut and placed in a 1.5-mL tube. We followed the protocol recommended by the manufacturer, with the following modifications suggested by Jennifer Gomes Ferreira (pers. comm.): prior to extraction, 180 [micro]L of buffer ATL, 30 [micro]L of dithiothreitol (1 M), and 10 [micro]L of proteinase K (20 mg/ml) were added to the sample, which was then vortexed vigorously and incubated at 56[degrees]C overnight.

We amplified cytochrome c oxidase I (COI), and nicotinamide adenine dinucleotide dehydrogenase 2 (ND2) genes through the polymerase chain reaction (PCR) in a 10-pL volume using a PCR kit Platinum (Invitrogen, Carlsbad, California). The following reagents were used: Taq DNA polymerase (1 unit); 1X PCR buffer; 1.5-mM MgCl2; 10% trehalose; 0.2-mM dNTP mix; and 0.2pM solution of forward and reverse primers (COI: Ltyr- 5'-3' TGTAAAAAGGWCTACAGCCTAACGC, Tavares and Baker, 2008); H8205- 5'-3' GGTTCGATTCCTTCCTTTCTTG, Pereira and Baker, 2004). For ND2, we used L5215- 5'-3' TATCGGGCCCATACCCCGAAAAT (Hackett, 1996) and H6313- 5'-3' CTCTTATTTAAGGCTTTGAAGGC (Sorenson et al. 1999). For each reaction, 2-3 [micro]L of DNA template was added.

We amplified the entire COI using a standardized program of 94[degrees]C for 1 min, 5 cycles (94[degrees]C for 1 min, 45[degrees]C for 40 s, 72[degrees]C for 1 min), 35 cycles (94[degrees]C for 1 min, 51[degrees]C for 40 s, 72[degrees]C for 1 min), and 72[degrees]C for 5 min (Lijtmaer et al., 2012). ND2 was amplified with initial denaturing at 94[degrees]C for 2 min followed by 40 cycles at 94[degrees]C for 45 s, 58[degrees]C for 1 min, 72[degrees]C for 2 min, and 72[degrees]C for 10 min. The product was visualized in a 1% agarose gel. A band of the expected size was obtained and sequenced by the Sanger method in the sequencing laboratory of the Instituto de Biologia, Universidad Nacional Autonoma de Mexico. Aligner CodonCode (version 4.2) was used for displaying and aligning the sequence obtained. Amplifications also were attempted for the Cyt b gene, with no success, when analyzing the feather or study-skin samples.

A COI fragment with a length of 1,463 base pairs (bp; GenBank accession no. KU842345) and an ND2 fragment of 1,041 bp were obtained (GenBank accession no. KU842347) from the feather sample. Subsequently, a BLAST (National Center for Biotechnology Information, Bethesda, Maryland) run in the Barcode of Life Data Systems (www.barcodeoflife.org) and GenBank (U.S. National Institutes of Health, Bethesda, Maryland) was performed with the sequences obtained. In this way, the identification of the feather as belonging to the black hawk-eagle (Spizaetus tyrannus), was confirmed, with 99.68% and 99% top matches respectively.

In order to further evaluate the specimen in question, we obtained COI and ND2 sequences of 652 bp and 966 bp, respectively, from a museum skin of an ornate eagle (Spizaetus ornatus) from Veracruz housed in the Instituto de Biologia, Universidad Nacional Autonoma de Mexico, National Collection of Birds of Mexico (CNAV024206, GenBank accession no. KU842344 and KU842346). The COI sequence for this specimen was amplified with BirdF1 and BirdR1 primers (Lijtmaer et al., 2012) and the ND2 sequence with the primers mentioned above.

From GenBank, one gene sequence each of COI and ND2 was available for a specimen from Guyana of a black hawk-eagle (JQ176245.1 and AY987096.1, respectively) and a black-and-white hawk-eagle (Spizaetus melanoleucus; JQ176244.1 and AY987097.1). Similarly, single COI and ND2 sequences were available from GenBank (unless otherwise indicated) for the following Old World species: Wallace's hawk-eagle (Nisaetus nanus; ND2 only; AY987093.1); Philippine hawk-eagle (Nisaetus philippensis, COI only; HM639912.1); changeable hawk-eagle (Nisaetus cirrhatus; COI only; BOLD-ROMC331-07); Blyth's hawkeagle (Nisaetus alboniger; AP008239.1 and AY987095.1); and mountain hawk-eagle (Nisaetus nipalensis; AP008238.1 and AY987094.1).

Using MEGA 5.2.2 software (Tamura et al., 2011), we performed separate genetic analyses based on 8 sequences of COI and 7 of ND2. The COI data matrix was clipped on the edges and nonoverlapping regions, producing a region comparable among species of 615 bp and of 1,041 bp for ND2. We obtained the following genetic distances between sequences of the feather and the other specimens: 0.3% with the black hawk-eagle specimen from Guyana, corresponding to differences in two sites of third positions in the 615-bp COI fragment; 8.6% with the black-and-white hawk-eagle; 10.2% with the ornate eagle from Veracruz; and an average of 10.9% with the other species. ND2 genetic distances relative to the feather sample were as follows: 0.7% with the black hawk-eagle from Guyana, 9.7% with the black-and-white hawk-eagle, 10.6% with the ornate eagle, and an average of 13.1% with the rest of the species.

The feather sample showed a strong relationship with the black hawk-eagle from Guyana for both genes (Fig. 2), and the skin sample of the ornate eagle of Veracruz was more-closely related with the black-and-white hawk-eagle than with the feather sample or the black hawk-eagle from Guyana.

The black hawk-eagle lives in evergreen and deciduous forests of the Neotropics (Ferguson-Lees and Christie, 2004; Howell and Webb, 2005), usually at an elevation of 1,000-1,300 m above sea level (up to 3,000 m in Guatemala). The species is considered sedentary throughout its range (Whitacre et al., 2012). In Mexico, its historic range extended to the south from southern Tamaulipas and Guerrero, and is considered endangered (Secretarla de Medio Ambiente y Recursos Naturales, 2010). Two subspecies are recognized: Spizaetus tyrannus tyrannus in southeastern Brazil and northeastern Argentina; and Spizaetus tyrannus serus in the rest of the range from Mexico to northern Brazil and the Guianas (Bierregaard, 1994). Observations of the species in open areas suggest that it may have some degree of tolerance for habitat fragmentation; however, few nests have been found in fragmented landscapes. The black hawk-eagle has been little studied; most of the information available about this species comes from incidental reports and brief accounts in regional lists and field guides (Whitacre et al., 2012). For the Los Tuxtlas Biosphere Reserve, W. J. Schaldach, Jr. (in litt.) listed the species originally as an uncommon resident of rain forests, but becoming rare and endangered.

[FIGURE 2 OMITTED]

Genetic markers can be a powerful tool to assist in species identification when using noninvasive samples, such as those from molted feathers. We isolated high-quality DNA from a recently shed feather of a black hawk-eagle; an identification was inferred from the barcoding mitochondrial gene (COI) and confirmed by results from the ND2 gene. The feather probably had been recently shed; it was readily distinguished from the leaf litter and did not show signs of decomposition. This is confirmed by our being able to recover two large sequence fragments (>1,000 bp), which would not have been possible if the sample had been old and degraded. This analysis allowed us to confirm the occurrence of the black hawk-eagle at a lower elevation than expected in a region where it is rare. Several, more-recent observations of the black hawk-eagle have been reported in this area by individuals submitting observations to the eBird website (eBird.org), but it remains to be established whether these observations are of the same individual, a possibility that could be explored with more feathers (Rudnick et al., 2007).

In the Neotropics, several species of similar raptors co-occur in the same area, and the characteristic patterns of the feathers sometimes are very similar. Therefore, genetic analysis can be useful and could provide additional population information (Rudnick et al., 2007). Collecting and identifying feathers also can provide information on species that are difficult to capture and observe, as well as those with threatened populations such as the black hawk-eagle.

Finally, the main threats regarding the conservation of birds in Veracruz lie in the destruction and disruption of natural ecosystems, although other activities such as live capture, development of human infrastructure, mining projects, and power lines continue to negatively affect these ecosystems (Comision Nacional para el Conocimiento y Uso de la Biodiversidad, 2011). As a consequence, valuable species in the food chain, such as birds of prey, could soon disappear. In Los Tuxtlas Biosphere Reserve, some raptor species have already been extirpated, including the harpy eagle (Harpia harpyja), king vulture (Sarcoramphus papa), and probably the black-and-white hawk-eagle (W. J. Schaldach, Jr., 2003, in litt.). This record provides important confirmation that the black hawk-eagle is present in the region, and it may encourage field ornithologists to document records of species occurrence by collecting shed feathers and using genetics tools. It also highlights the conservation value of the Los Tutxlas Reserve for bird populations typical of the rainforest ecosystem.

Support for fieldwork was possible thanks to a grant from the (Fondo Mixto-CONACYT-Veracruz) project 109298 "Monitoring, habitat fragmentation, population genetics and conservation of vertebrates in risk status in the Biosphere Reserve Los Tuxtlas." We acknowledge the Direccion General de Vida Silvestre and the Comision Nacional de Areas Naturales Protegidas for granting research permits. We appreciate the improvements in English usage made by C. Riehl through the Association of Field Ornithologists' program of editorial assistance. C. Loyola-Blanco of the Laboratorio de Fotografia Cientifica del Instituto de Biologia helped with Figure 1. We also thank M. A. Patten and two anonymous reviewers for relevant and interesting suggestions to an earlier version of the manuscript.

LITERATURE CITED

BIERREGAARD, R. O. 1994. Black hawk-eagle Spizaetus tyrannus. Pages 204-205 in Handbook of the birds of the world. Volume 2 (J. del Hoyo, A. Elliot, and J. Saragatal, editors). Lynx Editions, Barcelona, Spain.

BILDSTEIN, K L., W. SCHELSKY, J. ZALLES, AND S. ELLIS. 1998. Conservation status of tropical raptors. Journal of Raptor Research 32:3-18.

BOHMANN, K., A. EVANS, M. T. P. GILBERT, G. R. CARVALHO, S. CREER, M. KNAPP, D. W. YU, AND M. DE BRUYN. 2014. Environmental DNA for wildlife biology and biodiversity monitoring. Trends in Ecology & Evolution 29:358-367.

CARRETE, M., J. L. TELLA, G. BLANCO, AND M. BERTELLOTTI. 2009. Effects of habitat degradation on the abundance, richness and diversity of raptors across Neotropical biomes. Biological Conservation 142:2002-2011.

COMISION NACIONAL PARA EL CONOCIMIENTO Y USO DE LA BIODIVERSIDAD. 2011. La biodiversidad de Veracruz: Estudio de Estado. Comision Nacional para el Conocimiento y Uso de la Biodiversidad, Gobierno del Estado de Veracruz, Universidad Veracruzana, Instituto de Ecologia, A.C. Mexico, D.F.

COMISION NACIONAL DE AREAS NATURALES PROTEGIDas. 2006. Programa de Conservacion y Manejo Reserva de la Biosfera Los Tuxtlas. 1a ediciton. Comision Nacional de Areas Naturales Protegidas. Mexico D.F., Mexico.

FERGUSON-LEES, J., AND D. A. CHRISTIE. 2006. Raptors of the world. Princeton University Press, Princeton, New Jersey.

HACKETT, S. 1996. Molecular phylogenetics and biogeography of tanagers in the genus Ramphocelus (Aves). Molecular Phylogenetics and Evolution 5:368-382.

HOWELL, S. N. G., AND S. WEBB. 1995. A guide to the birds of Mexico and northern Central America. Oxford University Press, New York.

LINDSAY, A. R., AND S. C. G. HAAS. 2013. DNA from feces and museum specimens confirms a first state record bird. Occasional Papers of the Museum of Zoology, University of Michigan 742:1-10.

LIJTMAER, D. A., K C. R. KERR, M. Y. STOECKLE, AND P. L. TUBARO. 2012. DNA barcoding birds: from field collection to data analysis. Pages 127-152 in DNA barcodes: methods and protocols (W. J. Kress and D. L. Erickson, editors). Methods in molecular biology 858. Humana Press, New York.

PEREIRA, S. L., AND A. J. BAKER. 2004. Vicariant speciation of curassows (Aves, Cracidae): a hypothesis based on mitochondrial DNA phylogeny. Auk 121:682-694.

RUDNICK, J. A., T. E. KATZNER, E. A. BRAGIN, AND J. A. DE WOODY. 2007. Species identification of birds through genetic analysis of naturally shed feathers. Molecular Ecology Resources 7:757-762.

SECRETARIA DE MEDIO AMBIENTE Y RECURSOS NATURALES. 2010. NOM059-SEMARNAT-2010 para la protecciton ambiental-especies nativas de Mexico de flora y fauna silvestres-categorias de riesgo y especificaciones para su inclusion, exclusion o cambio-lista de especies en riesgo. Secretaria de Medio Ambiente y Recursos Naturales, Diario Oficial. Mexico D.F., Mexico.

SORENSON, M. D., J. C. AST, D. E. DIMCHEFF, T. YURI, AND D. P. MINDELL. 1999. Primers for a PCR-based approach to mitochondrial genome sequencing in birds and other vertebrates. Molecular Phylogenetics and Evolution 12:105114.

TAMURA, K., D. PETERSON, N. PETERSON, G. STECHER, M. NEI, AND S. KUMAR. 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28:2731-2739.

TAVARES, E. S., AND A. J. BAKER. 2008. Single mitochondrial gene barcodes reliably identify sister-species in diverse clades of birds. BMC Evolutionary Biology 8:81.

WASSENAAR, T., P. GERBER, P. H. VERBURG, M. ROSALES, M. IBRAHIM, AND H. STEINFELD. 2007. Projecting land use changes in the Neotropics: the geography of pasture expansion into forest. Global Environmental Change 17:86-104.

WHITACRE, D. F., J. LOPEZ, G. LOPEZ, S. H. FUNDS, C. J. FLATTEN, AND J. A. MADRID. 2012. Black hawk-eagle. Pages 185-202 in Neotropical birds of prey: biology and ecology of a forest raptor community (D. F. Whitacre, editor). Cornell University Press, Ithaca, New York.

Submitted 29 August 2015.

Acceptance recommended by Associate Editor, Gary D. Schnell, 10 February 2016.

Jonathan Morales-Contreras, Patricia Escalante, * Marisela Martinez-Ruiz, Noemi Matias-Ferrer

Instituto de Biologia, Universidad Nacional Autonoma de Mexico, Apartado Postal 70-153, 04510 Coyoacan, Mexico DF, Mexico

* Correspondent tilmatura@ib.unam.mx
COPYRIGHT 2016 Southwestern Association of Naturalists
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Morales-Contreras, Jonathan; Escalante, Patricia; Martinez-Ruiz, Marisela; Matias-Ferrer, Noemi
Publication:Southwestern Naturalist
Article Type:Report
Geographic Code:1MEX
Date:Jun 1, 2016
Words:2692
Previous Article:Predation of a pupfish by a fishing spider subsequently stolen by a diving beetle.
Next Article:Karyotypes of Cualac tesselatus and Floridichthys carpio comments on the phylogenetic distribution of multiple sex chromosomes in North American...
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters