Printer Friendly

Biomolecular markers within the core axis of aging and particulate air pollution exposure in the elderly: a cross-sectional study.

Introduction

Telomeres are complexes of hexameric repeats at the distal end of chromosomes where they provide stability and protection to the coding DNA. Telomere length declines with each cell division and thus can be considered as a marker of biological aging (Blackburn 1991). Excessive telomere shortening is a marker of senescence and a cause of genomic instability (Chin et al. 1999). In peripheral white blood cells, telomere shortening has been associated with age-related diseases, such as cardiovascular disease (Haycock et al. 2014) and cancer (Wentzensen et al. 2011). The natural erosion of telomeres associated with aging may be accelerated through oxidative stress and inflammation induced by environmental factors (Mitchell et al. 2014; von Zglinicki 2002). Shorter telomeres were found in peripheral white blood cells of smokers compared with nonsmokers (Nawrot et al. 2010; Valdes et al. 2005) and in persons with higher exposure to traffic-related compounds such as benzene (Hoxha et al. 2009; McCracken et al. 2010). Beside telomeres, oxidative stress also targets mitochondria (Cannino et al. 2009). Maintenance of mitochondrial function has been suggested to be an important mechanism of extending lifespan whereas decreased mitochondrial function, impaired ATP generation and increased reactive oxygen species (ROS) production are associated with aging (Sahin and DePinho 2012). Recently, Sahin et al. reported that mitochondrial changes associated with aging in telomere-deficient mice seemed to be driven by the combined suppression of peroxisome proliferator-activated receptor [gamma]-coactivator1[alpha] (PPARGC1A) and peroxisome proliferator-activated receptor [gamma]-coactivator1[beta] (PPARGC1B) and their downstream targets [nuclear respiratory factor 1 (NRF1) and nuclear factor erythroid 2 like 2 (NFE2L2)] through a tumor protein p53 (TP53)-dependent repression (Sahin et al. 2011). These findings suggest a connection between the nuclear and mitochondrial aging processes (Sahin and DePinho 2012). Further evidence supporting the telomere-mitochondrial axis of aging was observed in sirtuinl (SIRT1) knock-out mice. SIRT1 belongs to a group of highly conserved [NAD.sup.+]-dependent protein deacetylases and functions as a metabolic sensor since the deacetylase activity is controlled by the cellular [NAD.sup.+]/NADH ratio (Yamamoto et al. 2007). Increased SIRT1 expression was shown to stabilize and, in turn, increased mitochondrial biogenesis and function in cell lines (Nemoto et al. 2005) and knock-out mice (Lagouge et al. 2006).

Multiple epidemiological studies have reported associations between acute (Nawrot et al. 2011) or chronic (Brook et al. 2010; Cesaroni et al. 2014; Pope and Dockery 2006) exposure to airborne particulate matter (PM) and cardiovascular outcomes including cardiovascular morbidity and mortality. Oxidative stress and systemic inflammation have been identified as possible underlying mechanisms for effects of long-term exposure on cardiovascular outcomes (Brook et al. 2010). Since oxidative stress is linked to both telomere attrition and mitochondrial DNA (mtDNA) damage in cardiomyocytes (Moslehi et al. 2012), we hypothesized that these markers of aging may play a role in the chronic health effects of air pollution.

To date, evidence that long-term exposure to air pollution can modulate telomere length (Hou et al. 2012; Hoxha et al. 2009) and mtDNA copy number (Hou et al. 2010; Janssen et al. 2012) is limited to cross-sectional studies in healthy adults. To our knowledge, mechanisms underlying these associations have not been studied so far.

Here, we investigate whether biomolecular markers in the core axis of aging including telomere length and mitochondrial DNA are related to residential particulate air pollution exposure in elderly. Furthermore, starting from a candidate gene approach, we study possible mediators of the association between air pollution and the telomere-mitochondrial interactome. We hypothesize that the estimated effects of exposure to air pollution on mtDNA content can be mediated via telomere biology or by expression of genes in the telomere-mitochondrial axis of aging.

Methods

The total population (n = 3,069) of a general medical practice in Genk, Belgium, is registered in the framework of a registration network [i.e., the integrated computerized network (INTEGO)] for family practices in Flanders, Belgium, that covers a representative part of the total Flemish population (Bartholomeeusen et al. 2005). Nonsmoking men and women, 60-80 years old, with no acute infection at enrollment and no history of malignancies, were selected in the southern region of Genk (Bijnens et al. 2013; Pennemans et al. 2011). Former smokers were only included if they stopped smoking more than 10 years before enrollment. Of those that were eligible, 166 persons were recruited by their general practitioner, which resulted in a participation rate of 92%. Due to inadequate shaking of the RNA stabilizer in the RNA sampling tube after blood draw, 41 persons (25%) lacked a suitable RNA blood sample for expression analysis. DNA samples were available for the entire study population.

Questionnaires were administered through face-to-face interviews to collect information on lifestyle, profession, education, past smoking status, age, body mass index (BMI), and gender. Family income was defined as net monthly overall family income and subdivided into low (< 1,500[euro]), medium (1,500[euro]-3,000[euro]) and high (> 3,000[euro]). Education was stratified as low (primary school), medium (high school) and high (college or university). Socioeconomic status was based on educational degree and monthly income and categorised as "low," "middle," and "high." Past smokers were defined as those who had ever smoked during their life.

We gathered information on current and past use of medication from medical records of the medical practice. Reported anti-hypertensive medication included calcium antagonists, beta-blockers, alpha-blockers, and angiotensin-converting-enzyme inhibitors. We also had information whether participants used statins or not. Information on chronic obstructive pulmonary disease (COPD), asthma and myocardial infarction was obtained. After the participants had rested for 5 min, the heart rate and blood pressure were stable and seven consecutive blood pressure readings were taken by an automatic device (Stabil-O-Graph[R], Koln, Germany) according to the guidelines of the European Society of Hypertension (O'Brien et al. 2003). Informed consent was obtained from all participants, and the study was approved by the Ethical Committee of the East-Limburg Hospital (ZOL) in Belgium.

Blood Samples

Blood samples were collected in the morning until 1100 hours, after fasting in Vacutainer[R] Plus Plastic K2EDTA Tubes (BD, Franklin Lakes, NJ, USA) and PAXgene Blood RNA vacutainer tubes (PreAnalytiX, Qiagen, Hilden, Germany). Blood cell counts and differential leukocyte counts were determined using an automated cell counter with flow differential (Cell Dyn 3500, Abbott Diagnostics, Abott Park, IL, USA). Blood glucose levels, total cholesterol, high-density lipoprotein (HDL) cholesterol, low-density lipoprotein (LDL) cholesterol, triglycerides, and C-reactive protein (CRP) were measured according to standard clinical procedures.

DNA Analysis

Total DNA was extracted from white blood cells of the buffy coat using the MagMAX[TM] DNA Multi-Sample kit (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. The yield (ng/[micro]L) and purity ratios (A260/280 and A260/230) of the extracted DNA was determined with the NanoDrop spectrophotometer (ND-1000, Isogen Life Science, De Meern, Netherlands). Extracted DNA was stored at -20[degrees]C until further use.

Measurement of Leukocyte Mitochondrial DNA Content

Relative mtDNA content was determined using a quantitative real-time PCR (qPCR) assay by taking the ratio of two mitochondrial gene copy numbers (MTF3212/R3319 and mitochondrial encoded NADH dehydrogenase [MT-ND1]) to two single-copy nuclear reference genes (acidic ribosomal phosphoprotein P0 [RPLP0] and beta actin [ACTB]) (Pieters et al. 2015). The forward and reverse primers for the mitochondrial genes were respectively 5'-CACCCAAGAACAGGGTTTGT-3' and 5'-TGGCCATGGGTATGTTGTTAA-3' for MTF3212/3319, and 5'-ATGGCCAACC TCCTACTCCT-3' and 5'-CTACAACGTT GGGGCCTTT-3' for MT-ND1. For the reference genes, the forward and reverse primers were respectively 5-ACTCTTCCAGCCTTC CTTCC-3' and 5'-GGCAGGACTTAGCTT CCACA-3' for ACTB, and 5'-GGAAT GTGGGCTTTGTGTTC-3' and 5'-CCCAA TTGTCCCCTTACCTT-3 ' for RPLP0. Each sample was run in duplicate for the nuclear genes and in triplicate for the mitochondrial genes. A 10 [micro]L PCR reaction medium contained Fast SYBR[R] Green I dye 2x (Applied Biosystems, Lennik, Belgium) mastermix, forward (300 nM) and reverse (300 nM) primer, and 12.5 ng DNA. All PCR-reactions were performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The thermal cycling profile was similar for mtDNA and nuclear DNA: 20 sec at 95[degrees]C to activate the AmpliTaq Gold[R] DNA-polymerase, followed by 40 cycles of 1 sec at 95[degrees]C for denaturation, and 20 sec at 60[degrees]C for annealing/extension. Each run was completed by a melting curve analysis to confirm the amplification specificity and absence of non-specific PCR products. Each PCR plate contained six inter-run calibrators (IRCs) and two no-template controls (NTCs). After thermal cycling, raw data were collected and processed. Cq values of the mitochondrial genes were normalized relative to the two reference genes using the qBase software (Biogazelle, Zwijnaarde, Belgium). The program uses modified software from the classic comparative delta-delta-Ct method that takes into account multiple reference genes and uses inter-run calibration algorithms to correct for run-to-run differences (Hellemans et al. 2007). Coefficient of variation (CV) within triplicates was 1.7% for mitochondrial genes and 1.6% for duplicates for the reference genes.

Measurement of Leukocyte Telomere Length

Telomere length was measured as telomere repeat copy number relative to two single gene copy numbers (T/S ratio) by a modified version of the previously described PCR-based telomere assay by Cawthon (Cawthon 2009; Pieters et al. 2015). The forward and reverse primer for the telomeres were 5-ACACT AAGGTTTGGGTTTGGGTTTGGGTT TGGGTTAGTGT-3' and 5'-TGTTA GGTATCCCTATCCCTATCCCTATCC CTATCCCTAACA-3'. The primers of the reference genes (ACTB and RPLP0) were the same as used for the mtDNA content measurement. The telomere reaction medium contained Fast SYBR[R] Green I dye 2x (Applied Biosystems, Lennik, Belgium) mastermix, forward (100 nM) and reverse (900 nM) primer, and 12.5 ng DNA. The telomere reactions were performed in triplicate. The thermal cycling profile for the telomere reaction consisted of the following steps: 20 sec at 95[degrees]C, 2 cycles of 15 sec at 94[degrees]C and 15 sec at 49[degrees]C, and 40 cycles of 15 sec at 94[degrees]C, 10 sec at 62[degrees]C, and 15 sec at 74[degrees]C. Amplification specificity and absence of primer dimers was confirmed by melting curve analysis at the end of each run. Each PCR-plate contained six IRCs and two NTCs. We also included two control samples, one with relatively short telomeres and one with relatively long telomeres. Cq values of the telomere assay were normalized to two reference genes while taking into account run-to-run differences using qBase software (Biogazelle, Zwijnaarde, Belgium). CV within triplicates was 2.6% for telomeres and 1.6% for duplicates for the reference genes. CV for the exponentiated T/S ratio was less than 7%.

Gene Expression Analysis

Total RNA was extracted from PAXgene Blood RNA vacutainer tubes (PreAnalytiX, Qiagen, Hilden, Germany) with the PAXgene Blood RNA kit (PreAnalytiX) according to the manufacturer's instructions. For 41 persons no suitable RNA sample could be collected. cDNA was synthesized from 500 ng RNA using the GoScript[TM] Reverse Transcription System (Promega, Madison, WI, USA) according to the manufacturer's instructions. A qPCR reaction was set up by adding 6.6 ng cDNA together with 5 [micro]L Taqman[R] Fast Advanced Master Mix (Life Technologies, Foster City, CA, USA) and 0.5 [micro]L PrimeTimeTM assay (Integrated DNA Technologies, Coralville, IA, USA) in a final reaction volume of 10 [micro]L. Cycling conditions for all transcripts were 2 min at 50[degrees]C, 10 min at 95[degrees]C and 40 cycles of 15 sec at 95[degrees]C, and 1 min at 60[degrees]C. Overall, we studied the gene expression of candidate genes within the telomere-TP53-PPARGC1A-mitochondrial axis of aging (Lee and Wei 2005; Sahin and DePinho 2012) (Table 1). Each qPCR reaction was carried out in triplicate and three NTCs and six IRCs were included in each 384-well plate. Amplification efficiencies of PrimeTime assays were determined by standard dilution series of a mixed sample, resulting in an efficiency between 90% and 110% for all assays and the amplification specificity was confirmed by visualization of the expected band size on a 4% agarose gel. After thermal cycling, Cq values were collected and normalized to three reference genes, taking into account run-to-run differences using IRCs with qBase software (Biogazelle, Zwijnaarde, Belgium). Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (YWHAZ), hypoxanthine phos-phoribosyltransferase 1 (HPRT1), and RPLP0 were selected via geNorm and Normfinder as reference genes to normalize the data.

Exposure Measurement

The annual exposure levels of [PM.sub.2.5] were estimated for each participant's home address using a high-resolution spatial interpolation method (kriging method) (Janssen et al. 2008) that uses pollution data collected in the official fixed-site monitoring network and land cover data obtained from satellite images (CORINE land-cover data set) in combination with a dispersion model (Lefebvre et al. 2011, 2013). The dispersion model described by Lefebvre et al. (2011, 2013) uses the results from the interpolation method as background and superimposes the effects of industrial point sources and line sources from traffic to calculate the concentrations on a predefined grid. A correction for double counting was applied. This model chain provides daily [PM.sub.2.5] values that are aggregated to annual (1 year), past month (30 days), and past week (7 days) means for each participant's home address. Annual means were considered as a proxy of long-term exposure to [PM.sub.2.5]. Validation statistics of the interpolation tool gave a temporal explained variance ([R.sup.2]) for hourly averages of 0.88 and spatial [R.sup.2] for annual mean [PM.sub.2.5] of 0.83 (Maiheu et al. 2012).

Statistical Analysis

Statistical analyses were conducted using the SAS statistical package, version 9.3 (SAS Institute, Cary, NC, USA). Gene expression data, telomere length, and mtDNA content were [log.sub.10]-transformed to better approximate a normal distribution. We used regression models to study the association between long-term (annual) and short-term (last month and last week) exposure to particulate air pollution and aging-related markers. Additionally, we built a multiple exposure model where we fitted all three exposure windows in the same regression model. We considered the following a priori chosen model covariates: sex, age (years), BMI (kg/[m.sup.2]), socioeconomic status (low/middle/high), statin use (yes/no), past smoking status (yes/no), white blood cell count, and percentage of neutrophils. Pearson correlation coefficients were calculated between leukocyte telomere length, mtDNA content, the studied candidate genes, and annual [PM.sup.2.5] exposure to determine which genes to evaluate in a mediation analysis.

Formal mediation analysis was performed to explore the role of SIRT1 and telomere length as mediators of the association between exposure to particulate air pollution and markers of aging. This approach decomposes the total observed effect of exposure on markers of aging into a direct effect and an indirect effect that acts via the mediator of interest (Valeri and Vanderweele 2013). We only analyzed intermediates that satisfied all the assumptions of mediation analysis (i.e., a significant relation of the outcome to the exposure, a significant relation of the outcome to the mediator, and a significant relation of the mediator to the exposure) as potential mediators (e.g., SIRT1 and telomere length). However, these estimates should be interpreted with caution because the underlying assumptions of causality, as in all observational studies, between each pair of factors in the analysis cannot be verified.

In a sensitivity analysis, we explored whether following continuous covariates such as glucose, HDL, LDL, CRP, and systolic and diastolic blood pressure may alter the association between our biomolecular markers of aging and long-term [PM.sub.2.5] exposure. Furthermore, we performed an analysis excluding participants who lived at their home address for < 10 years. A p-value of < 0.05 was considered to be statistically significant.

Results

Study Population Characteristics

Descriptive characteristics of the study population are displayed in Table 2. Overall, the study population consisted of 166 elderly participants with a mean age ([+ or -] SD) of 70.6 [+ or -] 4.7 years. BMI ([+ or -] SD) averaged 27.5 [+ or -] 3.7 kg/[m.sup.2] and 27.3 [+ or -] 5.1 kg/[m.sup.2] for men and women, respectively. Of the 166 elderly participants, 89 (54%) were former smokers. The majority of former smokers were men (76%). Mean ([+ or -] SD) pack-years for former smokers was 19.0 [+ or -] 17.7 and 13.3 [+ or -] 12.5 for men and women, respectively. The average annual mean ([+ or -] SD) [PM.sub.2.5] concentration at the residence of study participants was 21.1 [+ or -] 1.76 [micro]g/[m.sup.3] (range 15.5 [micro]g/[m.sup.3]-23.4 [micro]g/[m.sup.3]). The average duration of living at the residential address was 37.6 [+ or -] 16.9 years (5-95th percentile: 9-73 years).

Association Between Air Pollution Indicators and Markers of Aging

Based on a simple linear regression model, telomere length (T/S ratio) was 4.06% lower [95% confidence interval (CI): -8.06%, 0.61%; p = 0.09] in association with a 1-year increase in age in the study population (age range 60-80 years), while mtDNA content was not associated with age (-0.62%, 95% CI: -2.07%, 0.88%, p = 0.41). Of the selected candidate genes, only SIRT1 expression was significantly correlated with telomere length, mtDNA content, and annual [PM.sub.2.5] exposure (Table 3).

Biomolecular markers of aging (mtDNA content, telomere length, and SIRT1 expression) were inversely associated with long-term [PM.sub.2.5] exposure (Table 3). In multivariate models adjusted for sex, age, BMI, socioeconomic status, statin use, past smoking status, white blood cell count and percentage of neutrophils, a 5-[micro]g/[m.sup.3] increment in average annual [PM.sub.2.5] exposure was associated with a 16.8% (95% CI: -26.0%, -7.4%, p = 0.0005) relative decrease in telomere length, a 25.7% (95% CI: -35.2%, -16.2%, p < 0.0001) relative decrease in mtDNA content, and a 17.3% (95% CI: -30.0%, -5.1%, p = 0.006) relative decrease in SIRT1 expression (Figure 1).

In contrast with the negative associations between annual average [PM.sub.2.5] exposure and telomere length, mtDNA content, and SIRT1 expression, monthly average [PM.sub.2.5] exposures were associated with longer telomeres, greater mtDNA content, and higher SIRT1 expression (Table 4). Average [PM.sub.2.5] exposures in the previous week was also positively associated with mtDNA content and SIRT1 expression but was not associated with telomere length (Table 4). Furthermore, we fitted all three exposure windows as independent variables in the same regression model but this did not change our findings (Table 4).

Mediation Analysis

We performed mediation analysis to estimate the proportion of the associations between [PM.sup.2.5] exposure and leukocyte mtDNA content that might be mediated by telomere length or SIRT1 expression if underlying causal assumptions of the mediation analysis are valid. We selected SIRT1 for evaluation as a potential mediator because it was significantly associated with [PM.sup.2.5] exposure (Figure 1) as well as with mtDNA content and telomere length (Figure 2), in contrast with the other candidate genes, which did not meet this criterion. In addition, we also evaluated telomere length as a potential mediator of the association between [PM.sup.2.5] exposure and mtDNA content.

Assuming that requirements for the mediation analysis were valid, we estimated that SIRT1 expression mediated 19.6% (95% CI: -8.1%, 22.5%, p = 0.09) of the inverse association between [PM.sup.2.5] exposure and telomere length, and 22.5% (95% CI: 17.8%, 24.4%, p = 0.03) of the inverse association between [PM.sup.2.5] exposure and mtDNA content (Figure 3). The analysis did not indicate statistically significant mediation of the inverse association between [PM.sup.2.5] exposure and mitochondrial DNA content by telomere length (Figure 3).

Sensitivity Analysis

To test the robustness of our results, we determined the influence of different metabolic parameters on the association between our biomolecular markers of aging and long-term [PM.sup.2.5] exposure. In separate models, we adjusted the main model for glucose, HDL, LDL, CRP, and systolic and diastolic blood pressure. Adjustment for the additional covariates did not show strong confounding and did not substantially change estimates between the main model (Table 5). To further test the robustness of our results, we added an analysis excluding participants who lived at their home address for < 10 years (n = 10). This did not alter the reported associations (Table 5).

Discussion

We demonstrated that molecular targets in the core axis of aging in the elderly are influenced by residential particulate air pollution. The key finding of our study is that residential annual average [PM.sup.2.5] exposure was associated with lower mtDNA content, shorter telomere length, and reduced SIRT1 expression in peripheral blood leukocytes of the elderly. If underlying causal assumptions of the mediation analysis are valid, SIRT1 expression mediates a significant proportion of the association between annual average [PM.sup.2.5] exposure and lower mtDNA content on telomere length.

Among the 166 nonsmoking elderly participants, telomere length was associated with a 4.06% decrease per annual increase of age, within the age range of 60-80 years. We found that a 5-[micro]g/[m.sup.3] increment in annual [PM.sup.2.5] was associated with a 16.8% decrease in telomere length and a 25.7% decrease in mtDNA content while adjusting for sex, age, BMI, socioeconomic status, and statin use. The public health significance of the association between annual average [PM.sup.2.5] exposure and telomere length in our population can be illustrated by the fact that it corresponds to the estimated decrease in T/S ratio associated with a 4-year increase in age in our study population. These associations were estimated for a study population with estimated average annual exposure of 21.1 [micro]g/[m.sup.3] (range 15.5 23.4 [micro]g/[m.sup.3]), which are below the annual average [PM.sup.2.5] limits for the EU (25 [micro]g/[m.sup.3]) but above the U.S. [PM.sup.2.5] limit (12 [micro]g/[m.sup.3]) (Esworthy 2015).

Extensive epidemiological studies support the associations between ambient air pollution and adverse health outcomes, including cardiovascular and respiratory disease, both with short-term (Levy et al. 2000; Nawrot et al. 2011) and chronic exposure (Beelen et al. 2014a, 2014b; Hamra et al. 2014; Laden et al. 2006). To date, studies examining the associations between PM exposure and telomere length reported different telomere responses after long-term or short-term exposure to PM. Short-term metalrich PM exposure was positively associated with leukocyte telomere length in 63 steel workers (Dioni et al. 2011) and in a study of 120 office workers and 120 truck drivers in Beijing, China (Hou et al. 2012), and an IQR increase in annual black carbon exposure (0.25 [micro]g/[m.sup.3]) was associated with an 8% decrease in leukocyte telomere length (95% CI: 13%, 2%) in a cohort of 165 never-smoking elderly men (McCracken et al. 2010). Consistent with these studies, we found that short-term (last month) exposure to [PM.sup.2.5] was associated with increased telomere length, whereas long-term (annual) exposure to [PM.sup.2.5], with subsequent cumulative burden of oxidative stress and inflammation, was associated with shorter telomere length. Whether acute increases in telomere length are due to telomerase activation, effects on telomere associated proteins, or clonal expansion of less mature leukocytes needs to be evaluated (Hodes et al. 2002; Weng et al. 1997). Similar differences between short-term and chronic exposure to PM were also reported in association with mtDNA content. Short-term exposure to PM was positively associated with mtDNA content in the steelworkers study (Hou et al. 2010) but negatively associated with mtDNA content in the study of Beijing office workers and truck drivers (Hou et al. 2013). A study performed in 178 newborns from the ENVIRONAGE birth cohort in Belgium (Janssen et al. 2012) revealed that a 10-[micro]g/[m.sup.3] increment in [PM.sup.10] exposure during the last trimester of pregnancy was associated with a 17.4% (95% CI: -31.8%, -0.1%) decrease in placental mtDNA content.

The biological mechanisms by which air pollution may cause adverse health outcomes are not completely understood, but oxidative stress and inflammation are thought to be of importance. The ability of oxidative stress to damage nucleic acids provides a potential mechanism by which it could interfere with telomere DNA (Epel et al. 2004). Due to their high content of guanine, telomeres are highly sensitive to ROS-induced damage (Grahame and Schlesinger 2012). Furthermore, single strand DNA breaks in telomeric DNA are not repaired efficiently (Kruk et al. 1995). In addition to direct effects to DNA, telomere attrition results from somatic cell replication. Oxidative stress and inflammation promote this process. Telomere length represents a record of the replicative history of cells and might be an index of cumulative oxidative stress (von Zglinicki and Martin-Ruiz 2005). Accelerated shortening of telomeres, and as such, senescence of cells may be an important pathway by which oxidative stress may accelerate biological aging and the resultant development of aging-related morbidity, including cardiovascular disease.

A recent experimental study in knock-out mice (Sahin et al. 2011) and cross-sectional studies in humans (Kim et al. 2013; Pieters et al. 2015; Qiu et al. 2015) provide evidence of the relationship between mtDNA content and telomere length and form a mechanistic platform for age-related disease (Moslehi et al. 2012). Our study is the first to report the intermediate mechanisms of PM-induced mtDNA alterations by investigating the role of telomere length and SIRT1 expression. We showed that the association between [PM.sup.2.5] and mtDNA content might be mediated by SIRT1 expression. A study in yeast shows that SIRT1 suppression increases telomerase activity (Palacios et al. 2010) and also inactivates the "guardian of the genome," TP53 (Vaziri et al. 2001). In addition, SIRT1 activates PPARGC1A, a regulator of mitochondrial biogenesis (Aquilano et al. 2010). Overexpression of SIRT1 in mice strains was shown to reduce incidence of several age-related diseases such as cardiovascular disease, metabolic disease, and cancer (Donmez and Guarente 2010). However, we only found significant associations between air pollution and SIRT1 expression with two biomolecular markers of aging (telomere length and mtDNA content). However, the correlation of the other candidate genes was as expected with the biomolecular markers of aging; for example, TP53 correlates inversely with telomere length and SIRT1 expression. SIRT1 expression was also positively correlated with PPARGC1A, as expected from the literature (Sahin and DePinho 2010).

Some limitations of this study warrant consideration. Although the results were consistent after multiple adjustments, we cannot exclude that our findings were caused by some unknown factor that is associated with both mitochondrial function and telomere length. Although we used recently developed statistical methods on causal interference (Valeri and Vanderweele 2013), these methods can never prove the biological direction (causality) of the findings and estimates should be interpreted with considerable caution. Secondly, telomere length, mtDNA content, and gene expression were measured in a mixture of cells in which composition differences between samples could influence our associations. In addition, changes in mtDNA content in human blood cells could also be attributed to platelet variation (Cozzarizza et al. 2003). Platelet contamination increases mtDNA without an augmentation in nuclear DNA and affects mtDNA content (Urata et al. 2008). However, in a previous study by Janssen et al. (2012), mtDNA did not correlate with blood platelets, neutrophils, white blood cells or white blood cell/platelet ratio. Nevertheless, we adjusted all our analysis for white blood cell count and percentage of neutrophils.

Conclusion

In our study population of elderly nonsmokers, we showed that annual average [PM.sup.2.5] exposure was inversely associated with telomere length, mtDNA content, and SIRT1 expression. These observations provide additional evidence that may be relevant for the mechanism of action of air pollution. To our knowledge, this is the first study investigating the potential influence of the telomere-mitochondrial core axis of aging on associations between air pollution and health effects. The public health significance of the association between [PM.sub.2.5] exposure and telomere length in our population is consistent with the estimated decrease in T/S ratio associated with a 4-year increase in age in our study population.

Editor's Note: In the Advance Publication, the titles of Tables 4 and 5 incorrectly indicate that estimated effects were for a 5-[micro]g/[m.sup.3] increase in average [PM.sup.2.5], rather than an IQR increase. The IQR for past-year exposure is 2.50 [micro]g/[m.sup.3], for last-month exposure 2.14 [micro]g/[m.sup.3], and for last-week exposure 3.37 [micro]g/[m.sup.3]. Furthermore, in Table 4 the 95% CI of SIRT1 expression for last-year exposure should be (-0.077, -0.011). In addition, values given in the second paragraph of the "Discussion " for the range and annual average [PM.sup.2.5] exposure estimates in the study population are incorrectly listed as 20.8 [micro]g/[m.sup.3] (range 15.7-23.0 [micro]g/[m.sup.3]); the correct values are 21.1 [micro]g/[m.sup.3] (range 15.5-23.4 [micro]g/[m.sup.3]). The corrections are included in this article. The authors regret these errors.

References

Aquilano K, Vigilanza P, Baldelli S, Pagliei B, Rotilio G, Ciriolo MR. 2010. Peroxisome proliferator-activated receptor [gamma] co-activator [al[ha] (PGC-1[alpha]) and sirtuin 1 (SIRT1) reside in mitochondria: possible direct function in mitochondrial biogenesis. J Biol Chem 285(28):21590-21599.

Bartholomeeusen S, Kim CY, Mertens R, Faes C, Buntinx F. 2005. The denominator in general practice, a new approach from the Intego database. Fam Pract 22(4):442-447.

Beelen R, Raaschou-Nielsen O, Stafoggia M, Andersen ZJ, Weinmayr G, Hoffmann B, et al. 2014a. Effects of long-term exposure to air pollution on natural-cause mortality: an analysis of 22 European cohorts within the multicentre ESCAPE project. Lancet 383(9919):785-795.

Beelen R, Stafoggia M, Raaschou-Nielsen O, Andersen ZJ, Xun WW, Katsouyanni K, et al. 2014b. Long-term exposure to air pollution and cardiovascular mortality: an analysis of 22 European cohorts. Epidemiology 25(3):368-378.

Bijnens E, Pieters N, Dewitte H, Cox B, Janssen BG, Saenen N, et al. 2013. Host and environmental predictors of exhaled breath temperature in the elderly. BMC Public Health 13:1226, doi:10.1186/1471-2458-13-1226.

Blackburn EH. 1991. Structure and function of telomeres. Nature 350(6319):569-573.

Brook RD, Rajagopalan S, Pope CA III, Brook JR, Bhatnagar A, Diez-Roux AV, et al. 2010. Particulate matter air pollution and cardiovascular disease: an update to the scientific statement from the American Heart Association. Circulation 121(21):2331-2378. Cannino G, Ferruggia E, Luparello C, Rinaldi AM. 2009. Cadmium and mitochondria. Mitochondrion 9(6):377-384.

Cawthon RM. 2009. Telomere length measurement by a novel monochrome multiplex quantitative PCR method. Nucleic Acids Res 37(3):e21, doi:10.1093/ nar/gkn1027.

Cesaroni G, Forastiere F, Stafoggia M, Andersen ZJ, Badaloni C, Beelen R, et al. 2014. Long term exposure to ambient air pollution and incidence of acute coronary events: prospective cohort study and meta-analysis in 11 European cohorts from the ESCAPE Project. BMJ 348:f7412, doi:10.1136/bmj.f7412.

Chin L, Artandi SE, Shen Q, Tam A, Lee SL, Gottlieb GJ, et al. 1999. p53 deficiency rescues the adverse effects of telomere loss and cooperates with telomere dysfunction to accelerate carcinogenesis. Cell 97(4):527-538.

Cozzarizza A, Riva A, Pinti M, Ammannato S, Fedeli P, Mussini C, et al. 2003. Increased mitochondrial DNA content in peripheral blood lymphocytes from HIV-infected patients with lipodystrophy. Antivir Ther 8(4):315-321.

Dioni L, Hoxha M, Nordio F, Bonzini M, Tarantini L, Albetti B, et al. 2011. Effects of short-term exposure to inhalable particulate matter on telomere length, telomerase expression, and telomerase methylation in steel workers. Environ Health Perspect 119:622-627, doi:10.1289/ehp.1002486.

Donmez G, Guarente L. 2010. Aging and disease: connections to sirtuins. Aging Cell 9(2):285-290.

Epel ES, Blackburn EH, Lin J, Dhabhar FS, Adler NE, Morrow JD, et al. 2004. Accelerated telomere shortening in response to life stress. Proc Natl Acad Sci USA 101(49):17312-17315.

Esworthy R. 2015. Air Quality: EPA's 2013 Changes to the Particulate Matter (PM) Standard. Washington, DC:Congressional Research Service. R42934. Available: https://www.fas.org/sgp/crs/ misc/R42934.pdf [accessed 2 October 2014].

Grahame TJ, Schlesinger RB. 2012. Oxidative stress-induced telomeric erosion as a mechanism underlying airborne particulate matter-related cardiovascular disease. Part Fibre Toxicol 9:21, doi:10.1186/1743-8977-9-21.

Hamra GB, Guha N, Cohen A, Laden F, Raaschou-Nielsen O, Samet JM, et al. 2014. Outdoor particulate matter exposure and lung cancer: a systematic review and meta-analysis. Environ Health Perspect 122:906-911, doi:10.1289/ehp.1408092.

Haycock PC, Heydon EE, Kaptoge S, Butterworth AS, Thompson A, Willeit P. 2014. Leucocyte telomere length and risk of cardiovascular disease: systematic review and meta-analysis. BMJ 349:g4227, doi:10.1136/bmj.g4227.

Hellemans J, Mortier G, De Paepe A, Speleman F, Vandesompele J. 2007. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol 8(2):R19, doi:10.1186/gb-2007-8-2-r19.

Hodes RJ, Hathcock KS, Weng NP. 2002. Telomeres in T and B cells. Nat Rev Immunol 2(9):699-706.

Hou L, Wang S, Dou C, Zhang X, Yu Y, Zheng Y, et al. 2012. Air pollution exposure and telomere length in highly exposed subjects in Beijing, China: a repeated-measure study. Environ Int 48:71-77.

Hou L, Zhang X, Dioni L, Barretta F, Dou C, Zheng Y, et al. 2013. Inhalable particulate matter and mitochondrial DNA copy number in highly exposed individuals in Beijing, China: a repeated-measure study. Part Fibre Toxicol 10:17, doi:10.1186/1743-8977-10-17.

Hou LF, Zhu ZZ, Zhang XA, Nordio F, Bonzini M, Schwartz J, et al. 2010. Airborne particulate matter and mitochondrial damage: a cross-sectional study. Environ Health 9:48, doi:10.1186/1476-069X-9-48.

Hoxha M, Dioni L, Bonzini M, Pesatori AC, Fustinoni S, Cavallo D, et al. 2009. Association between leukocyte telomere shortening and exposure to traffic pollution: a cross-sectional study on traffic officers and indoor office workers. Environ Health 8:41, doi:10.1186/1476-069X-8-41.

Janssen BG, Munters E, Pieters N, Smeets K, Cox B, Cuypers A, et al. 2012. Placental mitochondrial DNA content and particulate air pollution during in utero life. Environ Health Perspect 120:1346-1352, doi:10.1289/ehp.1104458.

Janssen S, Dumont G, Fierens F, Mensink C. 2008. Spatial interpolation of air pollution measurements using CORINE land cover data. Atmos Environ 42(20):4884-4903.

Kim JH, Kim HK, Ko JH, Bang H, Lee DC. 2013. The relationship between leukocyte mitochondrial DNA copy number and telomere length in community-dwelling elderly women. PLoS One 8(6):e67227, doi:10.1371/journal.pone.0067227.

Kruk PA, Rampino NJ, Bohr VA. 1995. DNA damage and repair in telomeres: relation to aging. Proc Natl Acad Sci USA 92(1):258-262.

Laden F, Schwartz J, Speizer FE, Dockery DW. 2006. Reduction in fine particulate air pollution and mortality: extended follow-up of the Harvard Six Cities study. Am J Respir Crit Care Med 173(6):667-672.

Lagouge M, Argmann C, Gerhart-Hines Z, Meziane H, Lerin C, Daussin F, et al. 2006. Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1[alpha]. Cell 127(6):1109-1122.

Lee HC, Wei YH. 2005. Mitochondrial biogenesis and mitochondrial DNA maintenance of mammalian cells under oxidative stress. Int J Biochem Cell Biol 37(4):822-834.

Lefebvre W, Degrawe B, Beckx C, Vanhulsel M, Kochan B, Bellemans T, et al. 2013. Presentation and evaluation of an integrated model chain to respond to traffic- and health-related policy questions. Environ Model Softw 40:160-170.

Lefebvre W, Vercauteren J, Schrooten L, Janssen S, Degraeuwe B, Maenhaut W, et al. 2011. Validation of the MIMOSA-AURORA-IFDM model chain for policy support: modeling concentrations of elemental carbon in Flanders. Atmos Environ 45(37):6705-6713.

Levy JI, Hammitt JK, Spengler JD. 2000. Estimating the mortality impacts of particulate matter: what can be learned from between-study variability? Environ Health Perspect 108:109-117.

Maiheu B, Veldeman B, Viaene P, De Ridder K, Lauwaet D, Smeets N, et al. 2012. Identifying the best available large-scale concentration maps for air quality in Belgium [in Dutch]. Available: http://www.milieurapport.be/Upload/ main/0_onderzoeksrapporten/2013/Eindrapport_ Concentratiekaarten_29_01_2013_TW.pdf [accessed 2 October 2014].

McCracken J, Baccarelli A, Hoxha M, Dioni L, Melly S, Coull B, et al. 2010. Annual ambient black carbon associated with shorter telomeres in elderly men: Veterans Affairs Normative Aging Study. Environ Health Perspect 1 18:1564-1570, doi:10.1289/ ehp.0901831.

Mitchell C, Hobcraft J, McLanahan SS, Siegel SR, Berg A, Brooks-Gunn J, et al. 2014. Social disadvantage, genetic sensitivity, and children's telomere length. Proc Natl Acad Sci USA 111(16):5944-5949.

Moslehi J, DePinho RA, Sahin E. 2012. Telomeres and mitochondria in the aging heart. Circ Res 110(9):1226-1237.

Nawrot TS, Perez L, Kunzli N, Munters E, Nemery B. 2011. Public health importance of triggers of myocardial infarction: a comparative risk assessment. Lancet 377(9767):732-740.

Nawrot TS, Staessen JA, Holvoet P, Struijker-Boudier HA, Schiffers P, Van Bortel LM, et al. 2010. Telomere length and its associations with oxidized-LDL, carotid artery distensibility and smoking. Front Biosci (Elite Ed) 2:1164-1168.

Nemoto S, Fergusson MM, Finkel T. 2005. SIRT1 functionally interacts with the metabolic regulator and transcriptional coactivator PGC-1[alpha]. J Biol Chem 280(16):16456-16460.

O'Brien E, Asmar R, Beilin L, Imai Y, Mallion JM, Mancia G, et al. 2003. European Society of Hypertension recommendations for conventional, ambulatory and home blood pressure measurement. J Hypertens 21(5):821-848.

Palacios JA, Herranz D, De Bonis ML, Velasco S, Serrano M, Blasco MA. 2010. SIRT1 contributes to telomere maintenance and augments global homologous recombination. J Cell Biol 191(7):1299-1313.

Pennemans V, De Winter LM, Munters E, Nawrot TS, Van Kerkhove E, Rigo JM, et al. 2011. The association between urinary kidney injury molecule 1 and urinary cadmium in elderly during long-term, low-dose cadmium exposure: a pilot study. Environ Health 10:77, doi:10.1186/1476-069X-10-77.

Pieters N, Janssen BG, Valeri L, Cox B, Cuypers A, Dewitte H, et al. 2015. Molecular responses in the telomere-mitochondrial axis of ageing in the elderly: a candidate gene approach. Mech Ageing Dev 145:51-57.

Pope CA III, Dockery DW. 2006. Health effects of fine particulate air pollution: lines that connect. J Air Waste Manag Assoc 56(6):709-742.

Qiu C, Enquobahrie DA, Gelaye B, Hevner K, Williams MA. 2015. The association between leukocyte telomere length and mitochondrial DNA copy number in pregnant women: a pilot study. Clin Lab 61(3-4):363-369.

Sahin E, Colla S, Liesa M, Moslehi J, Muller FL, Guo M, et al. 2011. Telomere dysfunction induces metabolic and mitochondrial compromise. Nature 470(7334):359-365.

Sahin E, DePinho RA. 2010. Linking functional decline of telomeres, mitochondria and stem cells during ageing. Nature 464(7288):520-528.

Sahin E, DePinho RA. 2012. Axis of ageing: telomeres, p53 and mitochondria. Nat Rev Mol Cell Biol 13(6):397-404.

Urata M, Koga-Wada Y, Kayamori Y, Kang D. 2008. Platelet contamination causes large variation as well as overestimation of mitochondrial DNA content of peripheral blood mononuclear cells. Ann Clin Biochem 45(pt 5):513-514.

Valdes AM, Andrew T, Gardner JP, Kimura M, Oelsner E, Cherkas LF, et al. 2005. Obesity, cigarette smoking, and telomere length in women. Lancet 366(9486):662-664.

Valeri L, Vanderweele TJ. 2013. Mediation analysis allowing for exposure-mediator interactions and causal interpretation: theoretical assumptions and implementation with SAS and SPSS macros. Psychol Methods 18(2):137-150.

Vaziri H, Dessain SK, Ng Eaton E, Imai SI, Frye RA, Pandita TK, et al. 2001. [hSIR2.sup.SIRT1] functions as an NAD-dependent p53 deacetylase. Cell 107(2):149-159.

von Zglinicki T. 2002. Oxidative stress shortens telomeres. Trends Biochem Sci 27(7):339-344.

von Zglinicki T, Martin-Ruiz CM. 2005. Telomeres as biomarkers for ageing and age-related diseases. Curr Mol Med 5(2):197-203.

Weng NP, Granger L, Hodes RJ. 1997. Telomere lengthening and telomerase activation during human B cell differentiation. Proc Natl Acad Sci USA 94(20):10827-10832.

Wentzensen IM, Mirabello L, Pfeiffer RM, Savage SA. 2011. The association of telomere length and cancer: a meta-analysis. Cancer Epidemiol Biomarkers Prev 20(6):1238-1250.

Yamamoto H, Schoonjans K, Auwerx J. 2007. Sirtuin functions in health and disease. Mol Endocrinol 21(8):1745-1755.

Nicky Pieters, (1) * Bram G. Janssen, (1) * Harrie Dewitte, (2) Bianca Cox, (1) Ann Cuypers, (1) Wouter Lefebvre, (3) Karen Smeets, (1) Charlotte Vanpoucke, (4) Michelle Plusquin, (1) and Tim S. Nawrot (1,5)

(1) Centre for Environmental Sciences, Hasselt University, Hasselt, Belgium; (2) Primary Health Care Centre GVHV, Genk, Belgium; (3) Flemish Institute for Technological Research (VITO), Mol, Belgium; (4) Belgian Interregional Environment Agency, Brussels, Belgium; (5) Department of Public Health & Primary Care, Occupational & Environmental Medicine, Leuven University, Leuven, Belgium

* These authors contributed equally to this work.

Address correspondence to T.S. Nawrot, Centre for Environmental Sciences, Hasselt University, Agoralaan Building D, 3590 Diepenbeek, Belgium. Telephone: 32-11-268382. E-mail: tim.nawrot@uhasselt.be

We thank H.A. Roels for his comments.

This study was supported by grants of the Flemish Scientific Fund (G073315N/088013) and European Research Council (ERC-2012-StG 310898). N.P. is holder of a PhD mandate from Hasselt University (BOF).

The authors declare they have no actual or potential competing financial interests.

Received: 16 January 2015; Accepted: 30 November 2015; Advance Publication: 15 December 2015; Final Publication: 1 July 2016.

Caption: Figure 1. Relative percentage (%) difference in mitochondrial DNA content (n = 166), telomere length (T/S) ratio (n = 166), and SIRT1 expression (n = 125) in association with a 5-[micro]g/[m.sup.3] increment in average annual [PM.sup.2.5] exposure adjusted for sex, age, BMI, socioeconomic status (based on education and monthly family income), statin use, past smoking status, white blood cell count, and percentage of neutrophils.

Caption: Figure 2. Correlation between (A) telomere length and SIRT1 expression, (B) mtDNA content and SIRT1 expression, and (C) mtDNA content and telomere length.

Caption: Figure 3. Mediation analysis showing the estimated proportion of associations between [PM.sup.2.5] ([micro]g/[m.sup.3]) exposure and leukocyte mtDNA content and telomere length, mediated through SIRT1 expression if underlying assumptions of the analysis are valid.

Table 1. Assay information of the selected candidate genes.

Abbreviation         IDT assay                    Gene name

HPRT1          Hs.PT.39a.22214821      Hypoxanthine phosphoribosyl
                                         transferase 1
NRF1           Hs.PT.56a.3666627       Nuclear respiratory factor 1
NFE2L2         Hs.PT.56a.40946676.gs   Nuclear factor erythroid 2-like
                                         2
PPARGC1A       Hs.PT.56a.40982761      Peroxisome proliferator-
                                         activated receptor [gamma],
                                         coactivator 1 [alpha]
PPARGC1B       Hs.PT.56a.38577994      Peroxisome proliferator-
                                         activated receptor [gamma],
                                         coactivator 1 [beta]
RPLPO          Hs.PT.56a.40434846      Acidic ribosomal phosphoprotein
                                         PO
SIRT1          Hs.PT.56a.40870995      Sirtuin 1
TP53           Hs.PT.56a.39489752.g    Tumor protein p53
YWHAZ          Hs.PT.39a.22214858      Tyrosine 3-monooxygenase/
                                         tryptophan 5-monooxygenase
                                         activation protein, zeta
                                         polypeptide

                                Primer
                 Ref seq      efficiency      Exon      Amplicon
Abbreviation      number        (%) (a)     location   length (bp)

HPRT1          NM_000194          93          6-8          128
NRF1           NM_005011         106         12-13         102
NFE2L2         NM_006164          99          4-5          124
PPARGC1A       NM_013261          99         12-13         133
PPARGC1B       NM_133263         105         12-13         102
RPLPO          NM_053275         101          7-8          146
SIRT1          NM_001142498       94          9-10         133
TP53           NM_001126114       90         16-16         146
YWHAZ          NM_003406         106          1-2          135

bp, base pairs; IDT, integrated DNA technologies.

(a) Primer efficiency was calculated by a standard dilution
series and using the formula: efficiency = [10.sup.(-1/slope)] - 1.

Table 2. Characteristics of the study population, stratified by sex.

                                      Men                  Women
Characteristics                    (n = 77)              (n = 89)

Age (years)                    70.2 [+ or -] 5.1     70.8 [+ or -] 4.3
BMI (kg/[m.sup.2])             27.5 [+ or -] 3.7     27.3 [+ or -] 5.1
Former smoker                      58 (76%)              31 (35%)
Pack years                     19.0 [+ or -] 17.7    13.3 [+ or -] 12.5
Socioeconomic status (a)
  Low                              28 (37%)              37 (42%)
  Middle                           35 (45%)              34 (38%)
  High                             14 (18%)              18 (20%)
Statin use                         45 (58%)              41 (46%)
HDL cholesterol (mg/dL)        53.4 [+ or -] 18.2    66.3 [+ or -] 17.5
LDL cholesterol (mg/dL) *     112.9 [+ or -] 31.6   119.1 [+ or -] 36.3
High sensitivity C reactive    0.12 [+ or -] 0.3     0.13 [+ or -] 0.3
  protein (mg/dL)
Glucose (mg/dL)               106.1 [+ or -] 37.9     100 [+ or -] 29.5
Myocardial infarction               8 (10%)               6 (7%)
COPD *                             10 (13%)               2 (2%)
Asthma                              4 (5%)                2 (2%)
Systolic blood pressure       147.3 [+ or -] 18.2     142 [+ or -] 19.4
Diastolic blood pressure       90.6 [+ or -] 12.6    84.4 [+ or -] 11.6
Telomere length (b)            1.04 [+ or -] 0.05    1.04 [+ or -] 0.04
mtDNA content (b)              0.71 [+ or -] 0.04    0.78 [+ or -] 0.04
Average annual [PM.sub.2.5]    21.1 [+ or -] 1.72    21.1 [+ or -] 1.75
  ([micro]g/[m.sup.3])
Time at current residential    35.9 [+ or -] 17.0    39.3 [+ or -] 16.8
  address (years)

(a) Socioeconomic status was based on educational degree
and monthly family income. (b) Geometric mean [+ or -] SD.

* p < 0.05 between men and women.

Table 3. Pearson correlation matrix between leukocyte telomere length,
mtDNA content, the studied candidate genes, and annual [PM.sub.2.5]
exposure.

                      Telomere      mtDNA
                       length      content      SIRT1     PPARGC1A

mtDNA content          0.22 **
SIRT1                  0.27 **     0.43 ***
PPARGC1A               0.05        0.04        0.20 *
NRF1                   0.22 *      0.26 **     0.74 ***    0.22 *
TP53                  -0.20 *      0.02       -0.11        0.12
PPARGC1B              -0.06       -0.01        0.07        0.20 *
NFE2L2                -0.001       0.02       -0.05        0.07
Annual [PM.sub.2.5]   -0.29 ***   -0.40 ***   -0.26 **     0.03
  exposure

                        NRF1        TP53     PPARGC1B   NFE2L2

mtDNA content
SIRT1
PPARGC1A
NRF1
TP53                   0.03
PPARGC1B               0.42 ***   0.40 ***
NFE2L2                 0.03       0.44 ***   0.24 **
Annual [PM.sub.2.5]   -0.03       0.15       0.03       0.04
  exposure

* p < 0.05; ** p < 0.01; *** p < 0.001.

Table 4. Associations between an IQR increase in average [PM.sub.2.5]
exposure during the previous year (long/term exposure) or during
the previous month or week (short/term exposure) and [log.sub.10]/
transformed telomere length (T/S ratio), mtDNA content, and SIRT1
expression.

                            Telomere length

                           Estimated effect
Exposure model (a)             (95% CI)           p-Value

Single exposure (b)
  Last year             -0.040 (-0.065, 0.017)    0.0005
  Last month             0.029 (0.017, 0.041)     0.0001
  Last week              0.003 (-0.007, 0.014)    0.5
Multiple exposure (c)
  Last year             -0.032 (-0.053, -0.011)   0.0031
  Last month             0.028 (0.015, 0.040)     0.0001
  Last week             -0.004 (-0.014, 0.006)    0.4

                             mtDNA content

                           Estimated effect
Exposure model (a)             (95% CI)           p-Value

Single exposure (b)
  Last year             -0.065 (-0.094, -0.038)   0.0001
  Last month             0.038 (0.025, 0.050)     0.0001
  Last week              0.029 (0.09, 0.039)      0.001
Multiple exposure (c)
  Last year             -0.055 (-0.074, -0.035)   0.0001
  Last month             0.023 (0.012, 0.04)      0.0001
  Last week              0.022 (0.013, 0.032)     0.0001

                           SIRT1 expression

                           Estimated effect
Exposure model (a)             (95% CI)           p-Value

Single exposure (b)
  Last year             -0.041 (-0.077, -0.011)   0.006
  Last month             0.033 (0.015, 0.052)     0.0005
  Last week              0.034 (0.016, 0.051)     0.0003
Multiple exposure (c)
  Last year             -0.039 (-0.066, -0.012)   0.005
  Last month             0.022 (0.002, 0.041)     0.03
  Last week              0.024 (0.005, 0.043)     0.01

IQR, interquartile range.

(a) The IQR was 2.50 pg/[m.sup.3] for past-year exposure, 2.14
[micro]g/[m.sup.3] for last-month exposure, and 3.37
[micro]g/[m.sup.3] for last-week exposure. (b) Single exposure
models were adjusted for sex, age, BMI, socioeconomic status (based
on education and monthly family income), statin use, past smoking
status, white blood cell count, and percentage of neutrophils. (c)
In the multiple exposure model, all three exposure windows were
fitted in the same regression model.

Table 5. Sensitivity analysis of the association between an IQR
increase for past/year [PM.sub.2.5] exposure (2.5 [micro]g/[m.sup.3])
in annual average [PM.sub.2.5] exposure and leukocyte [log.sub.10]/
transformed telomere length (T/S ratio) and mtDNA content.

                              Telomere length

Model variable           Estimated effect (95% CI)   p-Value

Main model               -0.040 (-0.065, -0.017)     0.0005
  + Glucose              -0.039 (-0.61, -0.017)      0.0006
  + CRP                  -0.034 (-0.057, -0.011)      0.003
  + HDL                  -0.032 (-0.054, -0.009)     0.0057
  + LDL                  -0.034 (-0.057, -0.011)     0.0036
  + Systolic BP          -0.037 (-0.060, -0.014)     0.0022
  + Diastolic BP         -0.037 (-0.061, -0.14)      0.0022
Excluding participants   -0.043 (-0.065, -0.021)     0.0002
  < 10 years at
  current address

                               mtDNA content

Model variable           Estimated effect (95% CI)   p-Value

Main model               -0.065 (-0.094, -0.038)     0.0001
  + Glucose              -0.059 (-0.082, -0.037)     0.0001
  + CRP                  -0.056 (-0.078, -0.034)     0.0001
  + HDL                  -0.057 (-0.080, -0.035)     0.0001
  + LDL                  -0.061 (-0.084, -0.038)     0.0001
  + Systolic BP          -0.061 (-0.085, -0.037)     0.0001
  + Diastolic BP         -0.061 (-0.085, -0.037)     0.0001
Excluding participants   -0.064 (-0.088, -0.041)     0.0001
  < 10 years at
  current address

The main model, adjusted for sex, age, BMI, socioeconomic status
(based on education and monthly family income), statin use, past
smoking status, white blood cell count, and percentage of
neutrophils, was additionally adjusted for each listed covariate
in a separate model. A separate sensitivity analysis was
performed using the main model while excluding participants that
lived < 10 years at their current address.


----------

Please note: Illustration(s) are not available due to copyright restrictions.
COPYRIGHT 2016 National Institute of Environmental Health Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Pieters, Nicky; Janssen, Bram G.; Dewitte, Harrie; Cox, Bianca; Cuypers, Ann; Lefebvre, Wouter; Smee
Publication:Environmental Health Perspectives
Article Type:Report
Date:Jul 1, 2016
Words:8305
Previous Article:Cross-Sectional associations of serum perfluoroalkyl acids and thyroid hormones in U.S. adults: variation according to TPOAb and iodine status...
Next Article:Ambient temperature and the risk of preterm birth in Guangzhou, China (2001-2011).
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |