Printer Friendly

Biogeography of Phallusia nigra: is it really black and white?

Abstract. Ascidians (Chordata, Tunicata) are an important group for the study of invasive species biology due to rapid generation times, potential for biofouling, and role as filter feeders in an ecosystem. Phallusia nigra is a putative cosmopolitan ascidian that has been described as introduced or invasive in a number of regions in the Indo-Pacific Ocean (India, Japan, and Hawaii) and in the Mediterranean. The taxonomic description of P. nigra includes a striking smooth, black tunic and large size. However, there are at least two similar Phallusia species--P. philippinensis and P. fumigata--which also have dark black tunics and can be difficult to discern from P. nigra. The distribution of P. nigra broadly overlaps with P. philippinensis in the Indo-Pacific and P. fumigata in the Mediterranean. A morphological comparison of P. nigra from Japan, the Caribbean coast of Panama, and Brazil found that Atlantic and Pacific samples were different species and led us to investigate the range of P. nigra using morphological and molecular analyses. We sequenced 18S rDNA and cytochrome oxidase B of individual ascidians from the Red Sea, Greece, Singapore, Japan, Caribbean Panama, Florida, and Brazil. Our results show that identification of the disparate darkly pigmented species has been difficult, and that several reports of P. nigra are likely either P. fumigata or P. philippinensis. Here we include detailed taxonomic descriptions of the distinguishing features of these three species and sequences for molecular barcoding in an effort to have ranges and potential invasions corrected in the ascidian literature.

Introduction

Invasive invertebrate species often have a large effect on native organisms by shifting species interactions and community organization (Strayer et al., 2011). The correct identification of invasive species is critical for their management and eradication given that unique biological characteristics of the species, such as timing of reproduction and physiological tolerances, are important for management strategies. Ascidians (Chordata, Tunicata) are invertebrate chordates that compose a major part of benthic ecosystems globally and have recently been a major focus of invasive species studies due to increasing numbers of reported invasions (Lambert, 2007; Rius et al., 2008; Dupont et al., 2009; Lejeusne et al., 2011). Ascidians are potent biofoulers and effective invaders because sessile adults and free-swimming tadpole larvae can be transported to new areas through human vectors such as boat hulls, ballast waters, and aquaculture (Lambert, 2002, 2007).

Efforts to correctly identify species in this group are not trivial. Historical taxonomic descriptions of species within the ascidians are not always straightforward (Stefaniak et al., 2009), and there may be significant morphological variation within a single species (Lopez-Legentil and Turon, 2006). Additionally, present taxonomic descriptions may be inadequate for the separation of some ascidian species, as molecular data have uncovered unexpected cryptic diversity even in well-studied ascidian species (Tarjuelo et al., 2001; Caputi etal., 2007; Iannelli et al., 2007b; Perez-Portela and Turon, 2008; Bock et al., 2012; Perez-Portela et al, 2013). However, rigorous morphology-based taxonomy is still central to the initial identification of an organism and can be utilized in conjunction with molecular studies (Schlick-Steiner et al, 2007; Shenkar and Swalla, 2011). Genetic markers combined with morphological character analysis have been instrumental in distinguishing native ascidians from invaders (Nishikawa et al, 2014).

Phallusia nigra is one example of a widely distributed species. It is a solitary ascidian with a striking smooth black tunic usually devoid of epibionts, and a large size, up to 10 cm (see Fig. 1). It lives in tropical waters at shallow depths on hard or rocky substrates, and is very common on artificial substrates. P. nigra was originally described in the early 1800s from the Red Sea, but has been reported in many tropical and subtropical locations since then. It has been reported in the Mediterranean Sea (Izquierdo-Munoz et al, 2009), the Red Sea (Savigny, 1816; Shenkar et al, 2008; Shenkar, 2012), the Pacific Ocean (Abbott et al, 1997; Hirose, 1999; Lambert, 2003), the Indian Ocean (Michaelson, 1919; Monniot and Monniot, 1997; Subba Rao, 2005; Abdul Jaffar Ali and Sivakumar, 2007; Abdul Jaffar Ali et al, 2009), Gulf of Guinea (Millar, 1965), Angola (Millar, 1965), and widely in the west Atlantic Ocean and the Caribbean (Rocha et al, 2005; Mendiola et al, 2006; Bonnet and Rocha, 2011; Carman et al., 2011) (see Fig. 3A). Though its native range is not known, P. nigra has been described as an introduced species in the Pacific (De Felice et al, 2001), in the Indian Ocean (Abdul Jaffar Ali et al, 2009), and in the Mediterranean Sea (Cinar et al, 2006; Shenkar et al. 2008; Izquierdo-Munoz et al, 2009; Kondi-latos et al., 2010), and it has been labeled as either native (Galil, 2007) or cryptogenic (Galil, 2007; Rocha et al, 2012) in the western Atlantic.

Reports of the geographical distribution of P. nigra are complicated by this species' many synonyms: Ascidia nigra Heller, 1878, Ascidia atra Lesueur, 1823, Ascidia somalensis Sluiter, 1905, Phallusia atra Traustedt, 1882, Phallusia violacea Gould, 1852, Phallusiopsis nigra Hartmeyer, 1909, Thallusia nigra Hartmeyer, 1908, Tunica nigra Hilton, 1913; but most reports in the last 70 years have used either Ascidia nigra or Phallusia nigra, with a preference for Phallusia in recent years (Shenkar and Swalla, 2011). Further compounding the difficulty of identifying P. nigra in the field are two other species in the genus Phallusia that also have darkly pigmented tunics and whose geographical range partially overlaps with that of P. nigra: Phallusia philippinensis (Millar, 1975) and Phallusia fumigata (Gruber, 1864) (see Fig. 1). Phallusia fumigata has been described as native to the Mediterranean (Peres, 1958), though it is also found in the Atlantic, on the French coast along the English Channel (Harant and Vernieres, 1933) where it is typically found in shallow waters (up to 50-m depth) in rock crevasses among sponges (Hircinia spp.) or algae (Codium bursa). P. fumigata is referred to as the black bottle tunicate (Harant and Vernieres, 1933), and its dark pigmentation can be seen all over the body or concentrated in the anterior or exposed area (though very young specimens may have a predominantly light coloration). P. philippinensis also has a tunic that is dark (from black-brown to gray), but usually not as opaque as that of P. nigra. It is found on coarse sediment of coral habitats in the Indo-Pacific (Monniot and Monniot, 2001).

Since P. nigra has been repeatedly reported as introduced in many localities and a morphological comparison between populations of black Phallusia from Japan and the Caribbean coast of Panama by the authors has revealed important distinctive characteristics, we hypothesized that some of the previous reports might not be accurate. In this study, we compared individuals from different populations of the three darkly pigmented Phallusia species and detail major morphological characters to distinguish them. We also sequenced the 18S ribosomal subunit DNA and cytochrome oxidase B (cyt-B) from individual ascidians from populations of P. nigra, P. fumigata, and P. philippinensis. Published genetic data for this genus are limited, with only 6 of the 19 recognized species in this genus represented in GenBank, and there has not been wide-scale sequencing of mitochondrial or nuclear genes of Phallusia until now.

Our results show that Phallusia nigra occurs in the Red Sea, Singapore, and the West Atlantic, but it has been confused with both P. fumigata and P. philippinensis in other regions. In Japan and Hawaii, what has been reported as P. nigra is actually P. philippinensis. We provide molecular sequences as well as detailed taxonomic descriptions of the three darkly pigmented Phallusia species, which we hope will be useful for future studies seeking to report occurrences and locations of P. nigra, P. fumigata, and P. philippinensis.

Materials and Methods

Ascidian samples

Morphological comparisons included individuals of Phallusia with dark tunics from Brazil (Rio de Janeiro), Panama (Bocas del Toro, Caribbean coast), Israel (Eilat), Singapore, Japan (Okinawa), Taiwan, Hawaii, Australia, and the Mediterranean (Spain and France). All specimens were deposited at the Ascidiacea collection of the Zoology Department, Federal University of Parana, Brazil (DZUP). We obtained samples for molecular analysis from the Atlantic and greater Caribbean (Florida, Brazil, and Panama), the Mediterranean Sea (Greece), Singapore, Japan, and the Red Sea (Eilat, Israel). The specimens from the Red Sea can be regarded as topotype specimens of Phallusia nigra. Tissue samples were stored in 95% ethanol until DNA was extracted.

DNA extraction, polymerase chain reaction, and sequencing

Genomic DNA was extracted using DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA). Though cytochrome oxidase subunit I (COI) is a commonly used mitochondrial gene in barcoding studies, it did not readily amplify in our samples; however, we successfully amplified cytochrome oxidase B, another commonly used mitochondrial marker. Cytochrome oxidase B (cyt-B) was amplified by modifying PCR conditions previously described (Stefaniak et al, 2009), using forward primer 5'TGRGGNCARATGWSNTTYTG3' and reverse primer 5'GCKAANARRAARTAYCAYTC3'. 18S ribosomal DNA was amplified utilizing primers as previously described (Swalla et al., 2000): 18S-A 5'CAGCAGCGCGGTAA TTCCAGCTC3', 18S-BS 5'CCTGGTTGATCCTGCCAG3' 18S-B 5'AAAGGGCAGGGACGTAATCAACG3', 18S-PH 5'TAATGATCCATCTGCAGGTTCACCT3'. PCR amplifications were carried out in 25-[micro]J reactions containing 0.2 mmol [l.sup.-1] each dNTP (Qiagen, Valencia CA), 1.0 [micro]g each primer, 1X GoTaq Flexi buffer (Promega Corp. Madison, WI), 1.5 mmol [l.sub.2] Mg[Cl.sub.2], 0.5 [micro]l of GoTaq Flexi polymerase (Promega Corp. Madison, WI), and 25-50 ng total DNA. Samples that did not amplify initially were amplified in 25-[micro]l reactions containing 12.5 [micro]l of PrimeSTAR MAX DNA Polymerase Premix (Clontech Laboratories, Mountain View, CA), 5.5 [micro]l water, 1.0 [micro]g each primer, and 25-50 ng total DNA. Cycling conditions for PrimeSTAR MAX reactions are 35 cycles of 10 s denaturing at 98 [degrees]C, 15 s annealing at 48 [degrees]C, and 10 s elongation at 72 [degrees]C. Cycling conditions for GoTaq Flexi polymerase amplifications of cyt-B consist of an initial denaturing step of 4 min at 94 [degrees]C, followed by 60 cycles of 10 s denaturing at 94 [degrees]C, 30 s annealing at 47 [degrees]C, and 50 s elongation at 72 [degrees]C, with a final elongation of 10 min at 72 [degrees]C. Cycling conditions for GoTaq Flexi polymerase amplifications of 18S ribosomal DNA consist of an initial denaturing step of 4 min at 94 [degrees]C, followed by 35 cycles of 1 min denaturing at 94 [degrees]C, 1 min annealing at 47 [degrees]C, and 1.5 min elongation at 72 [degrees]C, with a final elongation of 10 min at 72 [degrees]C. PCR product was extracted from the agarose gel using Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, Pittsburgh, PA). DNA sequencing was performed using BigDye3.1 (Life Technologies, Carlsbad, CA) with a 3130 DNA analyzer (Life Technologies, Carlsbad, CA) in the UW Biology Department Comparative Genomics Center.

Sequence alignments and phylogenetic analysis

18S ribosomal DNA and cyt-B sequences were edited in MacVector (MacVector Inc., Cary, NC) and aligned using MAFFT (Katoh and Standly, 2013). Bayesian analysis was performed using Mr. Bayes 3.1.2 (Ronquist and Huelsenbeck, 2003) using a general time reversible (GTR) model (nst = 6) with gamma-distributed rate variation across sites and a proportion of invariable sites (rates = invgamma) run for 1,000,000 Markov chain Monte Carlo generations, sampling every 5000 generations with a burn-in of 25%. Resulting trees were visualized in FigTree ver. 1.3.1 (Rambaut, 2009). Numbers of variable and informative sites were generated using PAUP (*) ver. 4.0b10 (Swofford, 2002). Divergences of cyt-B sequences within and between clades were estimated using uncorrected pairwise distances (p-distances) calculated in MEGA 5.2.2 (Tamura et al, 2011). Outgroups and other Phallusia sequences were obtained from GenBank. GenBank accession numbers for cyt-B: Ciona intestinalis, NC_004447.2; Ciona savignyi, NC_004570.1; Phallusia nigra (India), JN791272; Phallusia mammillata, NC_009833; Phallusia fumigata, NC_009834; Ascidiella aspersa, NC_021469. GenBank accession numbers for 18S ribosomal DNA: Phallusia nigra (Mediterranean coast of Israel), FM244845.1; Phallusia nigra (India), JN791272.1; Phallusia mammillata, AF236803.2; Phallusia fumigata, FM244844.1; Corella eumyota, FM244846.1; Ascidia ceratodes, L12378.2; Chelyosoma siboja, AF165821.2; Megalodicopia hians, AB075543.1; Corella inflata, AY903930.1.

Results

Based on morphological and molecular characters, the Phallusia reported in the Pacific (Hawaii, Japan, Taiwan, and Australia) are Phallusia philippinensis. We have no evidence that Phallusia nigra is present in Hawaii or Okinawa, Japan, while P. nigra and P. philippinensis co-occur in Singapore. Atlantic populations of dark Phallusia, as well as the Red Sea populations, were all P. nigra. Mediterranean specimens from Spain and France were Phallusia fumigata.

Morphological comparison

Although P. nigra, P. philippinensis, and P. fumigata show external resemblance when fixed (Fig. 1), the dissection and study of internal characters revealed morphological differences that made the identification of the species straightforward, including the musculature pattern on the right side of the body, presence of projections on the peripharyngeal groove, presence of secondary papillae on the pharynx, and size and position of the alimentary canal (Table 1).

A close observation of living adult specimens also shows some differences (Fig. 1, Table 1): P. nigra is really black, with short siphons positioned close, the oral siphon curved dorsally and almost touching the atrial siphon, the lobes of the siphons rarely seen. P. philippinensis is more brownish, with more distant siphons and conspicuous siphon lobes. P. fumigata is also brownish or grayish, has a wrinkled tunic with small papillae around the oral siphon, the siphons are longer and distant from each other, and part of the body is usually found inside crevices. Since descriptions available in the literature are not detailed, especially for P. nigra and P. fumigata, we describe the three species based on the material studied.

Phallusia nigra Savigny, 1816 (Fig. 1, top row)

Examined material. DZUP-PHA-34 Marina Bocas, Bocas del Toro, Panama--7 ind; 20/vi/2011; Collector Rosana Rocha. DZUP-PHA-33 Meia-Lua Bay, Pargos Island, Cabo Frio, Rio de Janeiro, Brazil--7 ind; 30/iii/2011; Col. Rosana Rocha. DZUP-PHA-01 Forno Beach, Arraial do Cabo, Rio de Janeiro, Brazil--2 ind; 04/2002; Col. Rosana Rocha. DZUP-PHA-35 St John Island, Singapore--1 ind.; 1l/vii/2012; Col. Serina Lee. DZUP-PHA 048-051 Kisoski Marina, Eilat, Israel--4 ind.; 20/iii/2014; Col. Gretchen Lambert.

Individuals are up to 10 cm long with the oral siphon usually curved dorsally. The animals attach themselves by the posterior left region and usually attain a vertical upright position. The tunic is black and smooth without encrustations. The oral siphon is apical with 8-10 lobes and the atrial siphon is very close to it, with 8-12 lobes, but in some specimens these lobes are very shallow or absent. The right side musculature is formed by both longitudinal and transverse fibers, the longitudinal wider and running toward both the endostyle and the posterior region, the transverse forming a dense mat underneath the longitudinal fibers. There are oblique fibers extending from the atrial siphon and from the region posterior to it, which cross transverse fibers. On the left side, there are only short longitudinal muscles extending from the oral and atrial siphons and ending before the gut loop. There are 35-115 oral tentacles of three sizes, the larger 2.5-5.5 mm long. There are papillae in the prepharyngeal area. The peripharyngeal groove has two smooth margins and forms a rounded area around the dorsal tubercle, which has a U-shaped opening. The neural gland duct has 10-40 accessory apertures on the left side, and only two animals (in 16) had 79 and 136. The pharynx has 75-121 longitudinal vessels on the right side. The alimentary canal is large and occupies more than 2/3 of the left side. The anterior margin of the intestinal loop reaches the base of the atrial siphon. The intestine is isodiametric, though some individuals have a slightly dilated secondary loop or rectum; however, this may be due to the presence of food in the gut, and the intestine never forms a sac-like structure.

Phallusia philippinensis (Millar, 1975) (Fig. 1, middle row)

Examined material. DZUP-PHA-32 Kaneohe, Hawaii--7 ind; 14/iii/2012. Col. Euichi Hirose. DZUP-PHA-30 Penghu, Taiwan--1 ind; 09/iii/2011; Col. Shih-Wei Su. DZUP-PHA-36; DZUP-PHA-37; DZUP-PHA-38; DZUP-PHA-39 Padang Buoy, Singapore--4 ind; 23/vii/2012; Col. Serina Lee. DZUP-PHA-31 Toya Fishery Port, Okinawa-Jima, Japan--7 ind; 08/iv/2011; Col. Euichi Hirose. DZUP-PHA-44 Magnetic Island, Australia--3 ind., 18/xi/2011; Col. Mari Carmen Pineda.

Individuals are up to 6.5 cm long and attach themselves by the posterior left region, usually attaining a vertical upright position. The tunic is dark or light brown, with encrustations only at the fixation base. The oral siphon is apical with 6-10 lobes and the atrial siphon is in the mid dorsal line, with 6-8 lobes. The right side musculature is formed mainly by longitudinal fibers extending from both oral and atrial siphons. From the oral siphon, the ventral ones are shorter and end in the first 1/3 of the body length, while the middle are longer and end before the base of the atrial siphon. The longitudinal fibers extending from the atrial siphon end in the posterior margin. The transverse fibers are more internal and extend between the dorsal and ventral margins. On the left side, there are longitudinal muscles extending only from the oral siphon and ending before the gut loop. There are 30-57 oral tentacles of four sizes with very small ones (not counted) among the larger, which are 2.5-5.5 mm long. There are papillae in the prepharyngeal area. The peripharyngeal groove has two margins, the anterior one with projections. It forms a V around the dorsal tubercle, which has a U-shaped opening with inrolled ends. The neural gland duct has 20-45 accessory apertures on the left side, with four individuals (in 17) having less than 20. The pharynx has 46-63 longitudinal vessels. The alimentary canal is large and occupies more than 2/3 of the left side. The anterior margin of the intestinal loop reaches beyond the base of the atrial siphon. The intestine is isodiametric, though some individuals have a slightly dilated secondary loop; this may be due to the presence of food in the gut, and the intestine never forms a sac-like structure.

Phallusia fumigata (Grube, 1864) (Fig. 1, bottom row)

Examined material. CRBA-3353 Punta Sarnella, Port de la Selva, Spain--1 ind.; 12/iv/1981; CRBA-3084 Punta Sarnella, Port de la Selva, Spain--1 ind; 22/iii/1981; Col. Joan Cervantes. DZUP PHA47, Port Vendres, France-1 ind.; 28/vii/1992; Col. Rosana M. Rocha.

Individuals are up to 8 cm long. The animals attach themselves inside crevices by the posterior region, leaving only the siphons projecting above the substrate. The tunic is dark brown or gray only in exposed parts, with thicker left side and small papillae along the oral siphon. The oral siphon is apical with 8 lobes, and the atrial siphon is posterior to the mid dorsal line, with 6 lobes. The right side musculature is formed mainly by transverse fibers extending between the dorsal and ventral margins, in the first half. Posterior to the base of the atrial siphon, the transverse fibers are shorter and divide in two marginal bands lining the central region without muscles. Longitudinal fibers extending from the oral siphon are very delicate and end before the level of the atrial siphon. There are 31-33 oral tentacles of four sizes, the larger 2.5-4 mm long. There are papillae in the prepharyngeal area. The peripharyngeal groove has two smooth margins. It forms a V around the dorsal tubercle, which is heart-shaped. We counted 32 and 48 accessory apertures on the left side in the two animals from Spain. The pharynx has 58-67 longitudinal vessels on the right side, with intermediate small papillae between transverse vessels. The alimentary canal occupies half of the left side and is covered by numerous renal vesicles. The anterior margin of the intestinal loop reaches the base of the atrial siphon. The intestine is isodiametric.

The detailed descriptions given in this study show that the position of the atrial siphon, pattern of body musculature, and size of the digestive tract are easily identifiable characters that can be observed by removing the animal from its tunic. A further character to differentiate P. nigra from P. philippinensis is the presence of small projections along the peripharyngeal groove in the latter, while P. fumigata is the only of these three species to have intermediate papillae inside the pharynx. All the mentioned characters are constant in all individuals dissected. The number of oral tentacles and longitudinal vessels were larger in P. nigra, but these characters usually increase in number as animals get larger, and smaller P. nigra could have the same numbers as the other species. The number of accessory apertures proved to be too variable to be reliable as a distinguishing character and its range overlaps among species.

Molecular analysis

Figure 2 shows a phylogenetic tree constructed with cyt-B sequences (see Table 2 for GenBank accessions). The samples that are the true P. nigra are from the Red Sea, Singapore, and Caribbean Panama, Florida, and Brazil; they form a monophyletic clade with high support. The Phallusia samples we obtained from Greece genotyped as P. fumigata when compared to sequences from GenBank (Iannelli et al, 2007a). Sequences of P. philippinensis cyt-B obtained from the two locations in Japan (East Okinawa: Atta Fishery Port, dark gray boxes; West Okinawa: Toya Fishery Port, light gray boxes) do not fall into discrete clades on the tree, indicating that gene flow between the western and eastern sides of the island of Okinawa may be occurring or has occurred in the recent past. There is also a clade from West Okinawa that clusters with high support and may be indicative of a separate population or subspecies of P. philippinensis, but further genetic analysis may be needed to confirm whether this clade of Phallusia in West Okinawa is distinct.

The number of variable characters in available cyt-B sequences of phlebobranch ascidians was 260 out of 419 characters, with 220 sites being parsimony-informative. The number of variable sites in available 18S sequences of phlebobranch ascidians was 256 out of 1715 characters, with 166 sites being parsimony-informative. Because there were so few parsimony-informative characters in phlebobranch 18S sequences, the tree has less resolution, but is available in the appendix (Fig. Al). The maximum genetic divergence (uncorrected p-distances) observed among all taxa was 0.3808 between the Ciona clade and P. nigra. Genetic distances between each Phallusia species ranged from 0.2653 between P. nigra and P. philippinensis to 0.3288 between P. philippinensis and the clade that includes P. mammillata (Table 3). There was little variation within cyt-B for P. nigra (0.0053), whereas P. philippinensis had the highest within-species variation in the Phallusia (0.0941).

The phylogenetic tree of relationships using 18S ribosomal subunit sequences shows P. nigra from the western Atlantic and P. philippinensis from Okinawa as a polytomy with two Phallusia samples from GenBank from India and the Mediterranean coast of Israel, while P. philippinensis from Singapore clusters with P. fumigata in the tree (appendix Fig. A1). We believe that the lack of informative sites in the 18S gene sequences of the available plebobranchs (166 out of 1715 characters) is the reason that the relationships within the Phallusia in the I8S tree differ from those in the cyt-B tree (220 parsimony-informative sites out of 419 characters). We analyzed concatenated sequences using both genes with the same prior probabilities and models of Bayesian inference. The concatenated sequences recovered the relationships between taxa that are well-supported in the cyt-B tree, and the monophyly of P. philippinensis was restored (data not shown). We conclude that the relationships between the three black Phallusia species shown in the cyt-B tree are the best phylogenetic reconstruction hypothesis available with our data.

Geographical distribution

An investigation of the reported distribution of the three s pec ies revealed that although P. nigra has been reported worldwide, P. philippinensis has been found only in the Indo-Pacific, and P. fumigata is a European species (Fig. 3A). Figure 3B shows the di stribution of s peci mens th at were sequenced for this study, with their identification confirm ed by rigorous morphological or genetic analyses. Note the co-occurrence of P. nigra and P. philippinensis in Singapore (Lee et al., 2013). All other populations formerly identified as P. nigra in the Indo-Pacific as ide from those in Singapore are actually P. philippin ensis, and the specimens from Greece are P. fumigata. We also report the first confirmed occurrence of P. philippinen sis in Australia, where it was found in a marina in Magnetic Island, Queensland.

Discussion

The detection of introduced species is not a trivial quest and may be hampered by the lack of historical surveys in a region to the date of arrival of a new species. Poor taxonomy has been recognized as a primary source of the non-recognition of the introduced status of a species (Chapman and Carlton, 1991). In some cases, isolated populations of a widespread species are described as different "native" species; in others, similar species are named as one cosmopolitan invasive species (exampl es in Carlton, 2009). Ascidians are a prevalent group of invaders in both tropical and temperate marine habitats (Lambert, 2007; Pineda et al., 2011), but invasions by this group are often difficult to characterize because morphological plasticity within a species is not unusual (Olson, 1986 ; Marks, 1996 ; Tarjuelo et al., 2004; Lopez-Legentil et al., 2005 ; Hirabayashi et al., 2006). Additionally, studies analyzing mitochondrial markers and other molecular method s have revealed cryptic speciation in a number of well-known species (Tarjuelo et al., 2001 ; Caputi et al., 2007; Hirose et al., 2009; Bock et al., 201 2; Perez-Portela et al., 2013).

Using a combination of morphological characters and molecular data, we show that the putatively cosmopolitan phlebobranch ascidian Phallusia nigra is not as widespread as previously thought and that reports of this species in Greece, Japan, Taiwan, and Hawaii are likely to be incorrect. Morphology and the genetic markers s howed that West Atlantic and Red Sea animals belong to the same species, and since Phallus ia nigra is the only Phallus ia species listed in the Red Sea (Shenkar, 2012) (type locality), there is no doubt in the identificati on of Atlantic samples.

Given morphological distinctions and amounts of genetic variance between Phallusia clades (between 0.2755 and 0.3288), we are confident that the three dark Phallusia included in our study represent different species. Pairwise distances have been used to analyze differences between and within mitochondrial gene sequences to distinguish ascidian species or confirm that individuals from multiple sampling localities represent the same species (Nydam and Harrison, 2010; Smith et al., 2012). Within-species variation of the dark Phallusia was relatively low (p-distances: 0.0053 for P. nigra, 0.0181 for P. fumigata, and 0.0941 for P. philippinensis). It is interesting to note that P. nigra specimens have the lowest p-distances between individuals but the broadest geographical range of the dark Phallusia (Red Sea, West Atlantic, and Singapore).

Although the original description of P. nigra from the Red Sea (type locality) is very simple, a few characters permit its identification: the brilliant black tunic, smooth and without incrustations; the pattern of left body musculature; and the position of the atrial siphon in relation to the intestinal loop (Savigny, 1816: 163, pl. II, fig 2; pl. IX, fig 1). Further, Monniot (1972) compared P. nigra specimens from Bermuda and Suez Canal and found the only difference to be a lobed anus rim in the Suez samples, while the Bermuda P. nigra had a smooth anus rim. The anus was found to be lobed in P. nigra from both Panama and Brazil, which is more similar to the characteristics of P. nigra from the Suez Canal.

We report that although P. philippinensis is found exclusively in the Pacific, its geographical range may be increasing via human vectors. It was described from the Philippines, and in the same study Millar (1975) comments that samples from Arafura Sea (Tokioka, 1952) and Singapore resembled his specimens slightly. Kott (1985) did not agree and created the species P. millari that accommodated both Arafura and Singapore specimens. In 1997 this species was collected again outside the Philippines, this time in Palau on a boat hull (Monniot and Monniot, 2001). The first report in Japan was by Hirose (1999) of animals collected in Gi-nowan Port Marina, Okinawa Island (as P. nigra in that study). Previous monographs on ascidian fauna of Japan did not mention any Phallusia species (Tokioka, 1963; Nishikawa, 1991). In Hawaii the first evidence of the presence of a black ascidian is a picture taken in Pearl Harbor in the 1930s (Carlton and Eldredge, 2009). Abbott et al. (1997) did not explicitly categorize the black Phallusia as introduced or invasive to the Hawaiian Islands, though others have (De Felice et al., 2001). Recently (2011) P. philippinensis was collected from a pier in Magnetic Island, Australia. The species had already been listed by Kott (2005) in the Great Barrier Reef (Queensland) as a junior synonym of P. arabica, but her description of P. arabica shows many differences between those species, mainly in the color of the animal, muscular pattern, presence of a rectum dilation, and a very lobed anus. Thus, it seems that the synonymy does not hold and this is the first report of P. philippinensis in Australia. Evidence accumulated up to this point (lack of previous reports of this animal in well-studied areas and the prominent presence of the species in marinas and on piers) suggests that P. philippinensis is an introduced species in most of its current known Pacific range (Hawaii, Palau, Japan, and Australia).

The first report of P. nigra in the Mediterranean was by Peres (1958) for the Israeli coast, and the species seems to have slowly spread toward the north since then. Recently Izquierdo-Munoz et al. (2009) reviewed the reports of introduced ascidians in the Mediterranean and concluded that P. nigra occurred only in Israel, Lebanon, and Turkey. Kondilatos et al. (2010) report the presence of P. nigra in Rhodes Island, Greece, but they did not describe the specimens in sufficient detail for us to confirm this report. The picture provided by Kondilatos et al. is more similar to P. nigra than to P. fumigata, but the perils of identifying these species by photographs are obvious. We did not obtain any samples from the Mediterranean that were P. nigra; instead, the samples that we sequenced from Greece were P. fumigata, although they were sent to us labeled as P. nigra, which demonstrates the difficulty of identifying these darkly pigmented Phallusia using external features (e.g., coloration). A study similar to what we have done in the Pacific should be undertaken in the Mediterranean since P. nigra seems to be slowly spreading from the initial establishment in the Israeli coast. The single "P. nigra" cytochrome oxidase B sequence in GenBank (which is unpublished) is from India and groups in our molecular trees with P. mammillata, suggesting that this sequenced taxa may be another case of mistaken ascidian identity.

The conspicuous dark tunic of these three darkly pigmented Phallusia species has likely induced researchers to identify populations of P. philippinensis and P. fumigata as P. nigra, because it is the most commonly known of the three. Several studies discussing the occurrence of P. nigra in the Pacific have used Abbott et al. (1997) as a taxonomic guide. But the pattern of the body musculature, the position of the siphons on their figure 11, and their comments that juveniles and adults in shade lose the dark color clearly show that they have misidentified the species. Hirose (1999) and Hirose et al. (2001) also followed the description in Abbott et al. (1997) to identify specimens and incurred the same error. Of the darkly pigmented Phallusia, only P. philippinensis adults change color when moved from shade to light, wherein they become darker (Hirose, 1999). Juvenile individuals of P. nigra (less than 1.5 cm) are light gray but rapidly acquire the characteristic black pigment and never lose it (Van Name, 1945; RMR, pers. obs.).

At this point, we are unable to ascertain the native range of either P. nigra or P. philippinensis. The fact that P. nigra is found extensively throughout the western Atlantic Ocean favors this region as its hypothetical native range, although it was first described from the Red Sea. Considering the Red Sea as its native region would indicate either a massive recent Atlantic invasion without the colonization of most Mediterranean coasts, or that this species had a much wider distribution in the past with present locally extinct populations in the East Atlantic and Mediterranean. The fact that most known populations of P. philippinensis can be recognized as introduced favors the Philippines as its hypothetical native range. The more restricted geographical range of P. fumigata indicates that this species is native to Europe, though the disjunctive distribution between Atlantic and Mediterranean populations suggests possible human regional transport (e.g., Turon et al., 2003). These hypotheses should be further tested with population genetics on a global scale (Rius et al., 2008; Pineda et al., 2011).

Previous to this paper there were no published genetic resources for P. philippinensis and very few sequences (if any) for P. nigra. P. philippinensis has also not previously been included in a published phylogenetic tree. The three darkly pigmented species (P. nigra, P. fumigata, P. philippinensis) form a clade that is a sister group to P. mammillata, which has a bumpy white tunic and occurs in more temperate waters. Whatever the source of the dark pigment found in the tunic (see Hirose, 1999), we believe that the dark appearance of P. fumigata and P. philippinensis has led to their misidentification as P. nigra in the Mediterranean and in the Pacific, respectively. Our results suggest that both P. nigra and P. philippinensis are transportable by human vectors and should be monitored for new introductions in the Pacific. Previous reports of P. nigra should be reviewed to confirm the identification of the species. Genetic resources have been shown to be essential for confirmation of provisional morphological identification (Darling and Blum, 2007), and the sequence data from this study can assist future identification efforts of the dark Phallusia species.

Acknowledgments

This manuscript is dedicated to the memory of Charley Lambert, who spent many years working on ascidians and inspired many others to do so. The authors thank Xavier Turon and Gretchen Lambert for many relevant discussions about ascidian taxonomy and for references on Phallusia fumigata. We also thank Gretchen Lambert for the collection and donation of. P nigra from the Eilat, Israel, gathered by Noa Shenkar and the participants of an ascidian workshop. The workshop and Gretchen Lambert's trip was sponsored by the Israeli Taxonomy Initiative. We thank Mari Carmen Pineda for the collection and donation of specimens (and 18S sequences) found at Magnetic Island, Australia; Dr. Sebastien Darras at Universite Pierre et Marie Curie for photos of living Phallusia fumigata; and Dr. Chryssanthi at Antoniadou, Aristotle University of Thessaloniki, for donation of Phallusia fumigata tissue samples. This collaboration was facilitated when the authors met at the Smithsonian Tropical Research Institute in Bocas del Toro, Panama, in 2011 to teach in the NSF: PASI: Advanced Tunicate Biology: Integrating Modern and Traditional Techniques for the Study of Ascidians. The course was funded by a National Science Foundation (NSF) grant (OISE-1034665), to Director Rachel Collin. We thank the government of Panama for permits for ascidian samples discussed in this manuscript. This material is based in part upon work supported by the National Science Foundation under Cooperative Agreement No. DBI-0939454. This research was also supported by an NSF grant (DEB 0816892) to BJS; NSF Graduate Research Fellowship (DGE1256082) to LEV; "International Research Hub Project" of University of the Ryukyus to EH; CNPq-National Counsel of Technological and Scientific Development grant (304768/2010-3) to RMR; and a Master of Science scholarship from CAPES--Coordenacao de Aperfeicoamento de Pessoal de Nfvel Superior to LMO.

Literature Cited

Abbott, D. P., A. T. Newberry, and K. M. Morris. 1997. Reef and Shore Fauna of Hawaii. Special Publications Bernice Pauahi Bishop Museum Press, Honolulu, HI.

Abdul Jaffar Ali, H., and V. Sivakumar. 2007. Occurrence and distribution of ascidians in Viazhinjam Bay (southwest coast of India). J. Exp. Mar. Biol. Ecol. 342: 189-190.

Abdul Jaffar Ali, H., V. Sivakumar, and M. Tamilselvi. 2009. Distribution of Alien and Cryptogenic Ascidians along the Southern Coasts of Indian Peninsula. World J. Fish. Mar. Sci. 1: 305-312.

Bock, D. G., H. J. Maclsaac, and M. E. Cristescu. 2012. Multilocus genetic analyses differentiate between widespread and spatially restricted cryptic species in a model ascidian. Proc. R. Soc. Lond. B Biol. Sci. 279: 2377-2385.

Bonnet, N., and R. Rocha. 2011. The Ascidiidae (Ascidiacea: Tunicata) of Coastal Brazil. Zool. Stud. 50: 809-825.

Caputi, L., N. Andreakis, F. Mastrototaro, P. Cirino, M. Vassillo, and P. Sordino. 2007. Cryptic speciation in a model invertebrate chordate. Proc. Natl. Acad. Sci. USA 104: 9364-9369.

Carlton, J. T. 2009. Deep invasion ecology and the assembly of communities in historical time. Chapter 2, pp. 13-55 in Biological Invasions in Marine Ecosystems, G. Rilov and J. A. Crooks, eds. Ecological Studies 204, Springer-Verlag, Berlin.

Carlton, J. T., and L. G. Eldredge. 2009. Marine Bioinvasions of Hawai'i. Bishop Museum Press, Honolulu, HI.

Carman, M. R., S. G. Bullard, R. M. Rocha, G. Lambert, J. A. Dijkstra, J. J. Roper, A. M. Goodwin, M. M. Carman, and E. M. Vail. 2011. Ascidians at the Pacific and Atlantic entrances to the Panama Canal. Aquat. Invasions 6: 371-380.

Chapman, J. W., and J. T. Carlton. 1991. A test of criteria for introduced species: the global invasion by the isopod Synidotea laevidorsalis (Miers, 1881) J. Crustac. Biol. 11: 386-400.

Cinar, M. E., M. Bilecenoglu, B. Ozturk, and A. Can. 2006. New record of alien species on the Levantine coast of Turkey. Aquat. Invasions 1: 84-90.

Darling, J. A., and M. J. Blum. 2007. DNA-based methods for monitoring invasive species: a review and prospectus. Biol. Invasions 9: 751-765.

De Felice, R. C, L. G. Eldredge, and J. T. Carlton. 2001. Non-indigenous invertebrates. Pp. B1-B60 in Guidebook to the Introduced Marine Species in Hawaiian Waters, L. G. Eldredge and C. Smith, eds. Bishop Museum Press, Honolulu, HI.

Dupont, L., F. Viar, M. J. Dowell, C. Wood, and J. D. D. Bishop. 2009. Fine-and regional-scale genetic structure of the exotic ascidian Styela clava (Tunicata) in southwest England, 50 years after its introduction. Mol. Ecol. 18: 442-453.

Galil, B. S. 2007. Seeing red: alien species along the Mediterranean coast of Israel. Aquat. Invasions 2: 281-312.

Harant, H., and P. Vernieres. 1933. Tuniciers. Faune de France 27: 1-93.

Hirabayashi, S., F. Kasai, M. M. Watanabe, and E. Hirose. 2006. Contents of ultraviolet-absorbing substances in two color morphs of the photosymbiotic ascidian Didemnum molle. Hydrobiologia 571: 419-422.

Hirose, E. 1999. Pigmentation and acid storage in the tunic: protective functions of the tunic cells in the tropical ascidian Phallusia nigra. Invertebr. Biol. 118: 414-422.

Hirose, E., H. Yamashiro, and Y. Mori. 2001. Properties of tunic acid in the ascidian Phallusia nigra (Ascidiidae, Phlebobranchia). Zool. Sci. (Tokyo) 18: 309-314.

Hirose, M., S. Yokobori, and E. Hirose. 2009. Potential speciation of morphotypes in the photosymbiotic ascidian Didemnum molle in the Ryukyu Archipelago, Japan. Coral Reefs 28: 119-126.

Iannelli, F., F. Griggio, G. Pesole, and C. Gissi. 2007a. The mitochondrial genome of Phallusia mammillata and Phallusia fumigata (Tunicata, Ascidiacea): high genome plasticity at intra-genus level. BMC Evol. Biol. 7: 155.

Iannelli, F., G. Pesole, P. Sordino, and C. Gissi. 2007b. Mitogenomics reveals two cryptic species in Ciona intestinalis. Trends Genet. 23: 419-422.

Izquierdo-Munoz, A., M. Diaz-Valdes, and A. A. Ramos-Espla. 2009. Recent non-indigenous ascidians in the Mediterranean Sea. Aquat. Invasions 4: 59-64.

Katoh, K., and D. Standly. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30: 772-780.

Kondilatos, G., M. Corsini-Foka, and M. A. Pancucei-Papadopoulou. 2010. Occurrence of the first non-indigenous ascidian Phallusia nigra Savigny, 1816 (Tunicata: Ascidiacea) in Greek waters. Aquat. Invasions 5: 181-184.

Kott, P. 1985. The Australian Ascidiacea. Part 1: Phlebobranchia and Stolidobranchia. Mem. Queensl. Mus. 23: 1-439.

Kott, P. 2005. Catalogue of Tunicata in Australian Waters [CDROM]. Available from Australian Biological Resources Study, PO Box 787, Canberra, ACT 2601, Australia. P. 301 in Canberra: Australian Biological Resources Study.

Lambert, G. 2002. Nonindigenous ascidians in tropical waters. Pat: Sci. 56: 291-298.

Lambert, G. 2003. Marine biodiversity in Guam: the Ascidiacea. Micronesica 35/36: 584-593.

Lambert, G. 2007. Invasive sea squirts: a growing global problem. J. Exp. Mar. Biol. Ecol. 342: 3-4.

Lee, S. S. C, S. L. M. Teo, and G. Lambert. 2013. New records of solitary ascidians on artificial structures in Singapore waters. Mar. Biodivers. Rec. 6: e93.

Lejeusne, C, D. G. T. Bock, T. W. Therriault, H. J. Maclsaac, and M. E. Cristescu. 2011. Comparative phylogeography of two colonial ascidians reveals contrasting invasion histories in North America. Biol. Invasions 13: 635-650.

Lopez-Legentil, S., and X. Turon. 2006. Population genetics, phylogeography and speciation of Cystodytes (Ascidiacea) in the western Mediterranean Sea. Biol. J. Linn. Soc. 8: 203-214.

Lopez-Legentil, S., R. Dieckmann, N. Bontemps-Subielos, X. Turon, and B. Banaigs. 2005. Quantative variation of alkaloids in color morphs of Cystodytes (Ascidiacea). Biochem. Syst. Ecol. 33: 1107-1119.

Marks, J. A. 1996. Three sibling species of didemnid ascidians from northern Norway: Didemnum albidum (Verrill, 1871). Didemnum polare (Hartmeyer, 1903), and Didemnum romssae sp.nov. Can. J. Zool. 74: 357-379.

Mendiola, J., H. S. Hernandez, Idalia, L. Rojas, A. Otero, A. Ramirez, M. de los Angeles Chavez, J. A. Payrol, and A. Hernandez. 2006. Antimalarial activity from three ascidians: an exploration of different marine invertebrate phyla. Trans. R. Soc. Trap. Med. Hyg. 100: 909-916.

Michaelson, W. 1919. Ascidiae Ptychobranchiae und Diktyobranchiae des Roten Meeres. Denkschriften Akademie Wissenschaften in Wien 95: 1-20.

Millar, R. H. 1965. Ascidians from the tropical coast of west Africa. Atl. Rep. 8: 247-255.

Monniot, C. 1972. Ascidies phlebobranches des Bermudes. Bull. Mus. Nat. Hist. Natur. 3e ser. 61: 939-948.

Monniot, C, and F. Monniot. 1997. Records of ascidians from Bahrain, Arabian Gulf with three new species. J. Nat. Hist. 31: 1623-1643.

Monniot, F., and C. Monniot. 2001. Ascidians from the tropical western Pacific. Zoosystema 23: 201-383.

Nishikawa, T. 1991. The ascidians of the Japan Sea II. Publ. Seto Mar. Biol. Lab. 35: 25-170.

Nishikawa, T., I. Oohara, K. Saitoh, Y. Shigenobu, N. Hasegawa, M. Kanamori, K. Baba, X. Turon, and J. D. Bishop. 2014. Molecular and morphological discrimination between an invasive ascidian, Ascidiella aspersa, and its congener A. scabra (Urochordata: Ascidiacea). Zool. Sci. (Tokyo) 31: 180-185.

Nydam, M. L., and R. G. Harrison. 2010. Polymorphism and divergence within the ascidian genus Ciona. Mol. Phylogenet. Evol. 56: 718-726.

Olson, R. R. 1986. Photoadaptations of the Caribbean colonial ascidian-cyanophyte symbiosis Trididemnum solidum. Biol. Bull. 170: 62-74.

Peres, J. 1958. Ascidies recoltees sur les cotes Mediterraneennes d'Israel. Bull. Res. Counc. Isr. 7B: 143-150.

Perez-Portela, R., and X. Turon. 2008. Cryptic divergence and strong population structure in the colonial invertebrate Pycnoclavella communis (Ascidiacea) inferred from molecular data. Zoology 111: 163-178.

Perez-Portela, R., V. Arranz, M. Rius, and X. Turon. 2013. Cryptic speciation of global spread? The case of a cosmopolitan marine invertebrate with limited dispersal capabilities. Sci. Rep. 3: Article No. 3197.

Pineda, M., S. Lopez-Legentil, and X. Turon. 2011. The whereabouts of an ancient wanderer: global phylogeography of the solitary ascidian Styela plicata. PLoS One 6: e25495.

Rambaut, A. 2009. FigTree ver.1.3.1. [Online]. Available: http://tree.bio.ed.ac.uk/software/figtree/[2014, December 24].

Rius, M., M. Pascual, and X. Turon. 2008. Phylogeography of the widespread marine invader Microcosmus squamiger (Ascidiacea) reveals high genetic diversity of introduced populations and non-independent colonizations. Divers. Distrib. 14: 818-828.

Rocha, R., N. Bonnet, M. Baptista, and F. Beltramin. 2012. Introduced and native Phlebobranch and Stolidobranch solitary ascidians (Tunicata: Ascidiacea) around Salvador, Bahia, Brazil. Zoologia 29: 39-53.

Rocha, R. M., S. B. Faria, and T. R. Moreno. 2005. Ascidians from Bocas del Toro, Panama. 1. Biodiversity. Caribb. J. Sci. 41: 600-612.

Ronquist, F., and J. P. Huelsenbeck. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572-1574.

Savigny, J. C. 1816. Memoires sur les animaux sans vertebres. G. Dufour. Paris, France.

Schlick-Steiner, B. C, B. Seifert, C. Stauffer, E. Christian, R. H. Crozier, and F. M. Steiner. 2007. Without morphology, cryptic species stay in taxonomic crypsis following discovery Trends Ecol. Evol. 22: 391-392.

Shenkar, N. 2012. Ascidian (Chordata, Ascidiacea) diversity in the Red Sea. Mar. Biodivers. 42: 459-469.

Shenkar, N., and B. J. Swalla. 2011. Global diversity of Ascidiacea. PLoS One 6: e20657.

Shenkar, N., Y. Zeldman, and Y. Loya. 2008. Ascidian recruitment patterns on an artificial reef in Eilat (Red Sea). Biofouling 24: 119-128.

Smith, K. F., L. Stefaniak, Y. Saito, C. E. C. Gemmell, S. C. Cary, and A. E. Fidler. 2012. Increased inter-colony fusion rates are associated with reduced COI haplotype diversity in an invasive colonial ascidian Didemnum vexillum. PLoS One 7: e30473.

Stefaniak. L., G. Lambert, A. Gittenberger, H. Zhang, and S. Lin. 2009. Genetic conspecificity of the worldwide populations of Didemnum vexillum Kott, 2002. Aquat. Invasions 4: 29-44.

Strayer, D. L., V. T. Eviner, J. M. Jeschke, and M. L. Pace. 2011. Understanding the long-term effects of species invasions. Trends Ecol. Evol. 21: 645-651.

Subba Rao, D. V. 2005. Comprehensive review of the records of the biota of the Indian Seas and introduction of nonindigenous species. Aquat. Conserv. Mar. Freshw. Ecosyst. 15: 117-146.

Swalla, B. J., C. B. Cameron, L. S. Corley, and J. R. Garey. 2000. Urochordates are monophyletic within the deuterostomes. Syst. Biol. 49: 52-64.

Swofford, D. L. 2002. PAUP*: Phylogenetic Analysis Using Parsimony ((*) and Other Methods). Sinauer Associates, Sunderland, MA.

Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar. 2011. MEGA5: Molecular Evolutionary Genetics Analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28: 2731-2739.

Tarjuelo, I., D. Posada, K. A. Crandall, M. Pascual, and X. Turon. 2001. Cryptic species of Clavelina (Ascidiacea) in two different habitats: harbours and rocky littoral zones in the northwestern Mediterranean. Mar. Biol. 139: 455-462.

Tarjuelo, I., D. Posada, K. A. Crandall, M. Pascual, and X. Turon. 2004. Phylogeography and speciation of colour morphs in the colonial ascidian Pseudodistoma crucigaster. Mol. Ecol. 13: 3125-3136.

Tokioka, T. 1952. Ascidians collected by Messrs. Renzi Wada and Seizl Wada from the pearl-oyster bed in the Arafura Sea in 1940. Publ. Seto Mar. Biol. Lab. 2: 90-141.

Tokioka, T. 1963. Contributions to Japanese ascidian fauna. XX. The outline of Japanese ascidian fauna as compared with that of the Pacific coasts of North America. Publ. Seto Mar. Biol. Lab. 11: 131-155.

Turon, X., I. Tarjuelo, S. Duran, and M. Pascual. 2003. Characterising invasion processes with genetic data: an Atlantic clade of Clavelina lepadiformis (Ascidiacea) introduced into Mediterranean harbours. Hydrobiologia 503: 29-35.

Van Name, W. G. 1945. The North and South American Ascidians, Vol. 84. Bulletin of the American Museum of Natural History. American Museum of Natural History, New York.

LAUREN E. VANDEPAS (1), LI VIA M. OLIVEIRA (2), SERINA S.C. LEE (3), EUICHI HIROSE (4), ROSANA M. ROCHA (2), AND BILLIE J. SWALLA1 (*)

Received 29 November 2013; accepted 27 October 2014

(1) Biology Department, University of Washington, and Friday Harbor Laboratories, Seattle, Washington;

(2) Departamento de Zoologia, Universidade Federal do Parana, Curitiba, Parana, Brazil; (3) Tropical Marine Science Institute, National University of Singapore, Singapore; and (4) Department of Chemistry, Biology, and Marine Science, University of the Ryukyus, Nishihara-cho, Okinawa, Japan

(*) To whom correspondence should be addressed. E-mail: bjswalla@u.washington.edu

                           Table 1
Morphological comparisons among dark of Phallusia

                            P. nigra

Color of living animals   Black and shiny

Tunic                     Smooth
Oral siphon               Bent dorsally, 8-10 lobes, usually not
                          visible in living animals
Atrial sphon              Anterior to the middle of the body
Right side                Longitudinal transverse, and oblique fibers;
                          longitudinal
musculature               wider and running toward both the endostyle
                          and the posterior region


Peripharyngel groove      Both laminas smooth

Pharyngeal papillae       Absence of intermediate papillae
Alimentary canal          Occupies more than 2/3 of the left side;
                          intestinal loop at the level of the base of
                          the atrial siphon

                         P. philippinesis

Color of living animals  Dark gray or brown; light color when in
                         the shadow portions of the body
Tunic                    Smooth
Oral siphon              Apical and upright, 6-10 visible lobes in
                         living animals
Atrial sphon             In the middle of the body
Right side               Mainly longitudinal fibers extending from
                         both oral
musculature              and atrial siphons, lonely the latter
                         extending till the posterior margin


Peripharyngel groove     Anterior lamina with projections
                         (arrows in Figure 1)
Pharyngeal papillae      Absence of intermediate papillae
Alimentary canal         Occupies more than 2/3 of the left side;
                         intestinal loop anterior to the level of the
                         base of the atrial siphon

Peripharyngel groove     Both laminas smooth

Pharyngeal papillae      Absence of intermediate papillae
Alimentary canal         Occupies more than 2/3 of the left side;
                         intestinal loop at the level of the base of
                         the atrial siphon

                         P. fumigate

Color of living animals  Dark grey with whitish tunic in buried

Tunic                    Small projections around the oral siphon
Oral siphon              Apical and upright, 8 visible lobes in
                         living animals
Atrial sphon             Posterior to the middle of the body
Right side               Mainly transverse fibers extending

musculature              between the dorsal and ventral
                         margins in the first half and with an
                         interruption in the central region in
                         the second half
Peripharyngel groove     Both laminas smooth

Pharyngeal papillae      Presence of intermediate papillae
Alimentary canal         Occupies half of the left side; intestinal
                         loop at the level of the base of the
                         atrial siphon

                           Table 2
Specimen collection locations and GenBank accession numbers

Species                     Collection location


                                      Gene: Cytochrome oxidase B

Phullusia nigra             Red Sea, Israel
Phallusia nigra             Red Sea, Israel
Phullusia nigra             Red Sea, Israel
Phallusia nigra             Red Sea, Israel
Phallusia nigra             Rio de Janeiro, Brazil
Phallusia nigra             Rio de Janeiro, Brazil
Phallusia nigra             Rio de Janeiro, Brazil
Phallusia nigra             Rio de Janeiro, Brazil
Phallusia nigra             Bocas del Toro, Panama
Phallusia nigra             Bocas del Toro, Panama
Phallusia nigra             Bocas del Toro, Panama
Phallusia nigra             Bocas del Toro, Panama
Phallusia nigra             Bocas del Toro, Panama
Phallusia nigra             Florida, United States
Phallusia nigra             Florida, United States
Phallusia nigra             Florida. United States
Phallusia nigra             Singapore
Phallusia philippinensis    Singapore
Phallusia philippinensis    Singapore
Phallusia philippinensis    Okinawa, Japan
Phallusia philippinensis    Okinawa. Japan
Phallusia philippinensis    Okinawa, Japan
Phallusia philippinensis    Okinawa, Japan
Phallusia philippinensis    Okinawa, Japan
Phallusia philippinensis    Okinawa, Japan
Phallusia philippinensis    Okinawa, Japan
Phallusia philippinensis    Okinawa, Japan
Phallusia philippinensis    Okinawa, Japan
Phallusia philippinensis    Okinawa, Japan
Phallusia philippinensis    Okinawa. Japan
                                                 Gene: 18SrDA
Phallusia fumigata          Greece
Phallusia fumigata          Greece Gene: 18SrDNA
Phallusia nigra             Red Sea, Israel
Phallusia nigra             Red Sea, Israel
Phallusia nigra             Red Sea, Israel
Phallusia nigra             Rio de Janeiro, Brazil
Phallusia nigra             Rio de Janeiro, Brazil
Phallusia nigra             Bocas del Toro, Panama
Phallusia nigra             Florida, United States
Phallusia nigra             Singapore
Phallusia philippinensis    Singapore
Phallusia philippinensis    Okinawa. Japan
Phallusia philippinensis    Okinawa, Japan
Phallusia fumigata          Greece

Species                     Collection site                GenBank
                                                           accession

                                      Gene: Cytochrome oxidase B

Phullusia nigra             Kisoski Marina, Eilat          KJ87.<5967
Phallusia nigra             Kisoski Marina, Eilat          KJ875968
Phullusia nigra             Kisoski Marina, Eilat          KJ875969
Phallusia nigra             Kisoski Marina, Eilat          KJ875970
Phallusia nigra             Cabo Frio                      KF302051
Phallusia nigra             Cabo Frio                      KF302052
Phallusia nigra             Cabo Frio                      KF302053
Phallusia nigra             Cabo Frio                      KF302054
Phallusia nigra             Marina Bocas                   KF302058
Phallusia nigra             Marina Bocas                   KF302059
Phallusia nigra             Marina Bocas                   KF302060
Phallusia nigra             Town                           KF302061
Phallusia nigra             Town                           KF302062
Phallusia nigra             Indian River Lagoon            KF302055
Phallusia nigra             Cape Canaveral, FL             KF302056
Phallusia nigra             Indian River Lagoon            KF302057
Phallusia nigra             St. John Island                KF302063
Phallusia philippinensis    Padang Buoy                    KF302038
Phallusia philippinensis    Padang Buoy                    KF302039
Phallusia philippinensis    Okinawajima                    KF302043
Phallusia philippinensis    Okinawajima                    KF302044
Phallusia philippinensis    Okinawajima                    KF302045
Phallusia philippinensis    Okinawajima                    KF302046
Phallusia philippinensis    Okinawajima                    KF302047
Phallusia philippinensis    Okinawajima                    KF302048
Phallusia philippinensis    Okinawajima                    KF302049
Phallusia philippinensis    Okinawajima                    KF302050
Phallusia philippinensis    Toya Fishery Port              KF302040
Phallusia philippinensis    Toya Fishery Port              KF302041
Phallusia philippinensis    Toya Fishery Port              KF302042
                                                 Gene: 18SrDA
Phallusia fumigata          Thermaikos Gulf                KF302064
Phallusia fumigata          Thermaikos Gulf                KF302065
Phallusia nigra             Kisoski Marina, Eilat          KJ875971
Phallusia nigra             Kisoski Marina, Eilat          KJ875972
Phallusia nigra             Kisoski Marina, Eilat          KJ875973
Phallusia nigra             Cabo Frio                      KF268455
Phallusia nigra             Cabo Frio                      KF268456
Phallusia nigra             Town                           KF268458
Phallusia nigra             Indian River Lagoon            KF268457
Phallusia nigra             St. John Island                KF268459
Phallusia philippinensis    Padang Buoy                    KF268460
Phallusia philippinensis    Okinawajima                    KF268462
Phallusia philippinensis    Okinawajima                    KF268461
Phallusia fumigata          Thermaikos Gulf                KF268454

Table 3
Pairwise genetic distances (p-distances) between and within
phlebobranch clades for cytochrome oxidase B

                            Ciona int &   Ascidiella    Phallusia
                            sav (*)       aspersa       spp.

Within-clade                0.2414        N/A           0.0172
Ascidiella aspersa          0.3399
Phallusia spp.              0.3799        0.3190
Phallusia fumigata          0.3576        0.3112        0.2755
Phallusia philippinensis    0.3733        0.3094        0.3288
Phallusia nigra             0.3808        0.3344        0.3045


                            Phallusia   Phallusia         Phallusia
                            fumigata    philippinensis    nigra

Within-clade                0.0181      0.0941            0.0053
Ascidiella aspersa
Phallusia spp.
Phallusia fumigata
Phallusia philippinensis    0.3004
Phallusia nigra             0.3106      0.2653
COPYRIGHT 2015 University of Chicago Press
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Vandepas, Lauren E.; Oliveira, Li Via M.; Lee, Serina S.C.; Hirose, Euichi; Rocha, Rosana M.; Swalla
Publication:The Biological Bulletin
Article Type:Report
Date:Feb 1, 2015
Words:8793
Previous Article:Within-site variation of growth rates and terminal sizes in Mytilus californianus along wave exposure and tidal gradients.
Next Article:Foraging and ingestive behaviors of whale sharks, Rhincodon typus, in response to chemical stimulus cues.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters