Printer Friendly

Biodiversity and Molecular Characterization of Trichoderma spp. and Exploring its Synergistic Action for the Management of Cucumber Damping Off Incited by Pythium aphanidermatum.

Trichoderma is a filamentous, soil-borne, mycoparasitic fungus found in plant root ecosystem (32) with antifungal activity against several soil-borne plant pathogens (15). Antagonistic action is attributed through competition for space and nutrients (23), production of siderophores (3,29), synthesis of inhibitory compounds (pyrone antibiotics) (5) and the release of cell wall lytic enzymes including cellulytic, chitinolytic, pectinolytic, proteolytic and lipolytic enzymes (6). Besides the antagonistic activity, Trichoderma is an opportunistic, avirulent plant symbiont. Rhizosphere colonization by Trichoderma stimulate plant defense, plant growth and reproductive capacity (4,12). Meyer (21) demonstrated the diversity in conidial ornamentation, mitochondrial DNA and plasmids among strains having warted conidia and warranted for taxonomic revision. Recently Polymerase Chain Reaction (PCR) has been used for identification of fungal species. Genotypic techniques involving the amplification of a phylogenetically informative target, such as the small-subunit (18S) rRNA gene are increasingly gaining importance (35). rRNA gene is essential for the survival of all cells and the genes encoding the rRNA are highly conserved in the fungal kingdom. The rRNA genes are universally conserved, while the ITS region and intergenic spacer (IGS) are highly variable (19). The ITS and IGS region are the fastest evolving regions and varies among the species within a genus. Thus, the sequences of these regions were used for identification of closely related species (34). The diversity of Trichoderma has been used for the management of soil-borne diseases. Among the soil-borne diseases, damping off caused by the genus Pythium is a common problem in fields and greenhouse grown crops which kills the seedlings. This disease complex usually involves other pathogens such as Fusarium, Phytophthora and Rhizoctonia. Pre- and post-emergence damping-off caused by Pythium spp. in vegetable crops are economically important worldwide (33). Rapid germination of sporangia of Pythium in 1.5-2.5 h after exposure to exudates or volatiles from seeds or roots (22) followed by immediate infection makes management of the pathogen very difficult (33). Pythium spp. tends to be generalistic and non-specific in their host range, which causes extensive and devastating root rot is often very difficult to prevent or control (17). With this background the present study was undertaken for characterization of bio geographical diversity of Trichoderma by morphological and molecular means to explore the antagonistic potential against damping off pathogen in cucumber under protected cultivation.

MATERIALS AND METHODS

Sampling and Isolation of Trichoderma

Rhizospheric soil samples were collected from different crop fields of Nilgiri district, Tamil Nadu, India. Trichoderma were isolated from the rhizospheric soil samples on Trichoderma selective medium (10) using serial dilution technique (26). The plates were incubated at 28 [+ or -] 2[degrees]C for 4 to 7 days. Visible fungal colonies were transferred to Potato dextrose agar (PDA) plates and incubated at 28 [+ or -] 2[degrees]C for 5 days and maintained on PDA medium for subsequent

studies.

Molecular characterization of Trichoderma spp.

Genomic DNA extraction from Trichoderma isolates

Extraction of genomic DNA of all the isolates of Trichoderma spp. were extracted by harvesting the mycelium grown in potato dextrose broth for 3-4 days at 28 [+ or -] 2[degrees]C. Mycelial mat was collected on filter paper, washed with distilled water for 2-3 times, frozen and used for DNA extraction. Genomic DNA was extracted as per the protocol described by Raeder and Broda (24). DNA was suspended in 50[micro]l of TE buffer and quantified with ethidium bromide fluorescence.

PCR amplification and sequencing

Primers ITS1 (5'-TCCGTAGGTGAACCT GCGG-3') and ITS4 (5'-TCCTCCGCTTAT TGATATGC-3') described by White et al (34) were used to amplify a fragment of rDNA including ITS1 and ITS2 and the 5.8S rDNA gene. The PCR amplification reactions were performed in a 50 1/4l mixture containing 50 mM KCl, 20 mM Tris HCl (pH 8.4), 2.0 mM MgCl2, 200 1/4M of each of the four deoxynucleotide triphosphates (dNTPs), 0.2 %M of each primer, 40 g/ %l of template and 2.5 U of Taq polymerase. The cycle parameters included an initial denaturation of 1 min at 95[degrees]C, followed by 35 cycles of 1 min at 95[degrees]C, 30 s at 60[degrees]C and 1.5 min at 72[degrees]C, with a final extension of 10 min at 72[degrees]C. The PCR products were resolved in 1% agarose gel, purified PCR product was sequenced in SciGenome Labs Pvt Ltd, Kerala.

Phylogenetic analysis

The rDNA homology searches were performed using ITS gene sequences by BLAST program (http://www.ncbi.nlm.nih.gov). Sequeces were compared with Trichoderma spp. isolates retrieved from the Genbank database. Newly obtained sequences were submitted in Genbank database (NCBI). Sequences were analyzed in pairwise and multiple sequence alignment and the identity was scored with the Bio-Edit V 7.0.5 (11). Phylogenetic tree was constructed by the neighbor joining method and tree topologies were evaluated by performing bootstrap analysis of 1000 data sets performed with MEGA 6 (Molecular Evolutionary Genetic Analysis) software (31). The rDNA homology searches were performed using ITS gene sequences by TrichOKEY program (http://www.isth.com). Sequences were compared with Trichoderma spp. isolates retrieved from the TrichOKEY database.

Isolation of Pythium from infected cucumber plants

The pathogen Pythium was isolated from damping off affected cucumber plants collected from major cucumber growing areas of Coimbatore, Erode and Madurai districts of Tamil Nadu. The infected plant tissue was washed with sterile water and cut into small pieces from the leading edges of lesions. Then surface sterilized with 0.1% mercuric chloride, washed with sterile distilled water thrice and shade dried on sterile filter paper. The dried pieces were plated on PDA and incubated at 28[degrees]C [+ or -] 2[degrees]C for 5 days.

Molecular Characterization of Pythium isolate

Isolation of genomic DNA of Pythium sp.

Genomic DNA was extracted from the suspension cultures of Pythium by the Cetyl Trimethyl Ammonium Bromide (CTAB) method as described by Lee and Taylor (18). The isolate of Pythium was grown at room temperature (28 [+ or -] 2[degrees]C), and transferred into 250 ml conical flasks containing 150 ml potato dextrose broth (PDB). It was incubated at 28 [+ or -] 2[degrees]C for 5 days. After complete colonization of the medium, the mycelium was harvested by filtration through sterile filter paper and stored at -80 [degrees]C until used for DNA extraction. DNA was extracted from the harvested mycelia according to the procedure described by Mahuku (20). Mycelia were ground to a fine powder in liquid nitrogen and suspended in CTAB buffer.

The mixture was incubated at 65[degrees]C for 30 min. DNA was precipitated using ice-cold isopropanol and the pellet was washed with 70% ethanol, dried and dissolved in TE buffer.

Identification of Pythium sp.

To identify the species of Pythium isolates of 16S rDNA intervening sequence specific Pa1(5'TCCACGTGAACCGTTGAAATC3'); ITS2-(5'GCTGCGTTCTTCATCGATGC-3') primers were used to get an amplicon of 210 bp size (13). PCR amplification reactions were performed in a 50 1/4l mixture containing 50 mM KCl, 20 mM Tris HCl (pH 8.4), 2.0 mM MgCl2, 200 1/4M of each of the four deoxynucleotide triphosphates (dNTPs), 0.2 1/4M of each primer, 40 g/1/4l of template and 2.5 U of Taq polymerase. Amplification was conducted with a total reaction volume of 50[micro]l in Eppendorf Master Cycler, German. The PCR settings used were as follows: a hold of 2 min at 95[degrees]C, 30 cycles of 1min at 94[degrees]C, 30 sec at 54[degrees]C and 1 min at 72[degrees]C and a final extension of 10min at 72[degrees]C. The PCR products were resolved on 1% agarose gel at 50 V, stained with ethidium bromide (0.5[micro]g/ml) and analyzed using gel documentation system.

Screening of Trichoderma spp against P. aphanidermatum

The antifungal activity of Trichoderma spp. was tested by dual culture technique (7). The pathogen and Trichoderma were grown on PDA for a week at room temperature (28 [+ or -] 2[degrees]C), about nine mm diameter mycelial disc of the pathogen (Pythium aphanidermatum) was cut from the periphery and transferred to the Petri plate with PDA and nine mm diameter mycelial disc of Trichoderma was placed simultaneously at opposite sides of same Petriplate aseptically and incubated at room temperature 28 [+ or -] 2[degrees]C with alternate light and darkness for 7 days and observed periodically. The experiment was replicated thrice and per cent growth inhibition was calculated by the formula of I = (C-T)/C x 100, where C is mycelial growth in control plate, T is mycelial growth of test organisms in inoculated plate and I is inhibition of mycelial growth. Hyperparasitism was calculated by measuring the overgrowth of Trichoderma isolates on the pathogen from the zone of interaction of Trichoderma with pathogen in centimeter.

Testing the efficacy of Trichoderma spp. against P aphanidermatum in green house

The efficacy of Trichoderma spp. against damping off pathogen was evaluated with the four effective Trichoderma isolates viz., T. virens (TRI 37), T. harzianum isolates (TRI 36, TRI 35) and T. asperellum isolate (TRI 9) in pot culture. Treatment details include T1- Biopriming (BP) with TRI 37 @ 10g/kg of seeds, T2- BP with TRI 36 @ 10g/kg of seeds, T3- BP with TRI 35 @ 10g/kg of seeds, T4-BP with TRI 9 @ 10g/kg of seeds,T5- BP with (TRI 37+TRI 36+TRI 35+TRI 9) @ 10g/kg of seeds, T6-Soil application (SA) with TRI 37 @ 2.5kg/ha at 15 and 30th days after seeding, T7-SA with TRI 36 @ 2.5kg/ha at 15 and 30th days after seeding, T8-SA with TRI 35 @ 2.5kg/ha at 15 and 30th days after seeding, T9-SA with TRI 9 @ 2.5kg/ha at 15 and 30th days after seeding, T10-SA with (TRI 37+TRI 36+TRI 35+TRI 9) @ 2.5kg/ha at 15 and 30th days after seeding, T11-BP+SA with TRI 37 @ 10g/kg of seeds+@ 2.5kg/ha at 15 and 30th days after seeding,T12- BP+SA with TRI 36 @ 10g/kg of seeds+@ 2.5kg/ha at 15 and 30th days after seeding, T13-BP+SA with TRI 35 @ 10g/kg of seeds+@ 2.5kg/ha at 15 and 30th days after seeding, T14- BP+SA with TRI 9 @ 10g/kg of seeds+@ 2.5kg/ha at 15 and 30th days after seeding, T15-BP+SA with (TRI 37+TRI 36+TRI 35+TRI 9) @ 10g/kg of seeds+@ 2.5kg/ha at 15 and 30th days after seeding, T16-BP+SA with Metalaxyl 2g/kg of seeds + 0.1% @ 15 and 30th days after seeding, T17- Un treated control. The treatments were replicated thrice and pathogen inoculated control was maintained. Five cucumber seeds were planted in each pot containing sterile potting medium (red soil: sand: FYM at 1:1:1 w /w/w). The pathogen was multiplied in sand maize medium and incorporated @ 10g per pot up to the depth of 10cm @[10.sup.5]cfu/g. Trichoderma was delivered through bio priming of seed and soil application with different combinations. Seeds were bioprimed with talc based bio formulation @ 10 g/ kg followed by two soil applications on 30 and 45 days after sowing @ 2.5 kg/ha. Plants inoculated with the pathogen alone served as control. Healthy controls were also maintained. Disease incidence was recorded after 20 days of sowing and per cent disease incidence was calculated as follows.

Disease incidence (%) = Number of plants affected/Total number of plant x 100

The experimental design was completely randomized with three replicates (pots) for each treatment and repeated twice.

RESULTS AND DISCUSSION

Isolation of Trichoderma spp.

A total of 34 isolates of Trichoderma were isolated from different rhizosphere soil samples of different crop plants. Isolate code, species identification, location, NCBI accession numbers, TrichOKEY identification and isolation details of Trichoderma strains are furnished in Table 1.

Molecular characterization of Trichoderma spp.

PCR amplification with the conserved primer (ITS 1 -5'TCTGTAGGTGAACCTGCG 3') and ITS 4-5'TCCTCCGCTTATTGATATGC 3') of ITS region yielded the genomic product of 600 bp (Fig 1) in the reactions performed with 34 isolates of Trichoderma species. Absence of size variation among the isolates collected suggest that, majority of the isolates belong to Trichoderma.

DNA sequencing

The size of the amplicon containing the ITS 1, ITS2 and 5.8S r RNA was around 600 bp. In order to ascertain the Trichoderma orgin of sequence, the sequences were initially analyzed in BLAST. In the BLAST analysis isolates TRI 1 to TRI 16, TRI 19 to TRI 21, TRI 23- TRI 29, 38, 50, 60 and 70 had highest identity with T. asperellum. The query coverage was between 93-100% and identity was between 96-100%. In the case of other next three isolates TRI 35, 36 and TRI 37, isolate TRI 35 and 36 exhibited maximum identities with T. harzianum isolate TRI 37 with T. virens. On the basis of identity search in BLAST the isolates collected in the present study could be clearly categorized into three groups. 1. Major group comprising isolates were identified as T. asperellum and another small group of two isolates belonging T. harzianum and one belonging to T. virens(table) To overcome this problem the International Commission of Taxonomy of Fungi has recommended the use of DNA barcode tools for correct identification of Hypocrea and Trichoderma species. Therefore the ITS neucleotide sequence of the 34 isolates of the present study were analysed in TrichOKEY programme (www.isth.info) contrasting to results obtained in BLAST search in TrichOKEY analysis. The 34 isolates could be differentiated into 4 groups, one major group comprise isolate TRI 2-13, 16, 19, 20, 24, 26, 27, 28, 38, 50, 60 and 70 belonging to T. koningiopsis pertaining to the Rufa clade. The second group consists of isolates TRI 35 and TRI 36 which were confirmed as T. harzianum under catopteron clade, third group comprised isolate TRI 37 which was identified as T. virens belonging to virens clade, fourth group comprised of isolate TRI 15 which was identified as T. asperellum belonging to pachybasium A clade. Comparision of the results of TrichOKEY with BLAST indicate that the isolates TRI 2-13, 16, 19, 20, 24, 26, 27, 28, 38, 50, 60 and 70 under BLAST search were identified as T. asperellum. The other two group of isolates were identified as T. harzianum and T. virens by BLAST and appeared to be similar to TrichOKEY analysis. The six isolates (TRI 1, 14, 21, 23, 25 and 29) identified as T. asperellum in BLAST were found to have only genus specific hall mark sequences in TrichOKEY. However further species identification was not possible in TrichOKEY since species specific hall mark were not detectable, the isolates are therefore considered as unidentified species under the genus Trichoderma.

Diversity study of Trichoderma spp.

The result of the phylogenetic analysis based on the 18S-28S-rRNA gene sequences of different species of Trichoderma isolates were analyzed and results revealed that three different clusters were formed in phylogenetic tree (Fig 2). The evolutionary history was inferred using the Neighbor-Joining method Saitou and Nei (25). The optimal tree with the sum of branch length = 1.69400390. The difficulty in identification of species using NCBI similarity search tool, BLAST (http:// blast.ncbi.nlm.nih.gov). has been expressed by several workers (8). The lacunae in identifying species on the basis of similarity search in BLAST are absence of quality control of species authentification, sequences deposited under the original names and not under the names after verification. Kredics et al (16) suggested that more than 40% of Hypocreae and Trichoderma sequences available in Genbank database are unidentified or misidentified at the species level. In the present study the isolate which had maximum hit with T. asperellum were identified as T. koningiopsis in TrichOKEY. However identification of the other isolates as T. virens, T. harzianum tally both in BLAST and TrichOKEY search.

The relationship between the Trichoderma isolates of the present study and the established species in the TrichOKEY programme were assessed further. The type sequences of the identified species, T. koningiopsis, T. asperellum, T. virens and T. harzianum belonging to clade Rufa, Pachybasium A, Virens and Catopteron (harzianum clade) were retrived from database and analyzed in multiple alignment in CLUSTAL-W programme. A phylogenetic tree was constructed based on alignment clearly revealed the species identity of the isolates under study. The TRI isolates 2-13, 15, 16, 19, 20, 22, 24, 26-28, 38, 50, 60 and 70 occupied the same position as the T. koningiopsis the member of rufa clade, it is intresting to note here that T. asperellum which belong to pachybasium clade also occupy the same branch as that of rufa clade which suggest that on the basis of nucleotide identity these two species are not easily distinguishable. The isolate TRI 37 was grouped with virens clade, TRI 35 and TRI 36 was aligned with catopteron clade. Very clearly these three rufa, virens and catopteron clade branch off distinctly. Interesting results are observed with TRI isolates TRI 23, 25, 21, 29 and 14 which could not be identified at species level in TrichOKEY. They have origin along with rufa and pacybacium clade but branch off distinctly. They may represent a new species group which need to be validated by taking more phylogenetic marker genes.

The shortcoming in identification of species by using only ITS marker has been reported by several workers (30,17). Druchian and kubich (9) evaluated along 11 gene loci and formed that the 4th and 5th introns of translation elongation factor 1 alpha (tef1-EF-1 [+ or -]) and the coding region of endochitinase-42(ech 42) aid in resolving the species

Antagonistic activity

Dual culture assay revealed that all the isolates of Trichoderma spp inhibited the mycelial growth of P.aphanidermatum more than 50% over control (Table 2, Fig 3). However, the maximum inhibition of 87.78% of the mycelia growth of P.aphanidermatum was observed with the T. virens isolate TRI 37. It was followed by the T. harzianum isolates TRI 35 and TRI 36, which inhibited the mycelial growth to an extent of 85.5% over control. The next best isolates TRI 7, TRI 9, TRI 26 and 38 which inhibited the growth of pathogen to an extent of 81.5, 81.3, 80.0 and 80.0 per cent over the control were T. asperellum respectively. Similarly Anita et al (2) reported that, interaction between Trichoderma and isolated Pythium species in dual culture technique, range of inhibition was observed ranging from 56.92 -86.67%. The significant inhibition was observed in case of T. viride against P. viniferum 86.67%. Studies on hyperparasitism indicated that the T.virens isolate (TRI 37) overgrew on P. aphanidermatum up to 2.16 cm from the zone of interaction, indicating the hyperparasite nature of the T.virens isolate TRI 37. Hyperparasitism by the T.virens indicate the capability of these isolate produce hydrolytic enzyme followed by lysis of pathogen. Similarly hyperparasitism nature reported by Yang et al (36), In co-culture in vitro, isolates of Trichoderma spp., including Tri01003, Tri01090 and Tri01091, displayed the ability to steadily colonize and aggressively attack the mycelia of P. ultimum, and finally produce conidia on the Pythium colony.

Bioefficacy of Trichoderma formulation on the management of cucumber damping-off

The effective isolate s of T. virens, T. harzianum isolates (TRI 35 and 36) and T. asperellum isolate (TRI9) were evaluated for the management of cucumber damping off under pot culture in green house through biopriming of seeds and soil application either as individual isolate or as consortia. Results of the investigation emphasized ingeneral that bio-priming, soil application and bio priming coupled with soil application with consortia of Trichoderma isolates comprising of T. virens (TRI 37), T. harzianum isolates (TRI 35 and 36) and T. asperellum (TRI 9) were effective in the suppression of damping off rather than the application of individual isolates of Trichoderma compared to untreated control. However, bio priming and soil application with the consortia comprising of T.virens (TRI37), T.harzianum isolates (TRI 35 and 36) and T.asperellum (TRI 9) suppressed damping off to an extent of 76.82% over untrated control and was followed by the soil application of consortia comprising of (TRI 37+TRI 36+TRI 35+TRI 9),which was applied on 15 and 30th days after seeding(74.08% reduction over control).

Comparison of Trichoderma consortia, delivered through biopriming and soil application with T. virens isolate (TRI 37) and T. harzianum isolates (TRI 35 and 36) was only next to seed treatment with metalaxyl coupled with soil application of metalaxyl 0.1% on 15 and 30th days after seeding, which reduced damping off upto 85.02% over control(Table 3). Similar results were also reported by Abd-El-Khair et al (1) and Singh et al (28) that confirms our findings. They reported that the incidence of damping-off was found maximum in the pathogen inoculated control (54.67%) and lowest in the plants treated with the consortium of Trichoderma isolates BHU51+BHU105 (22.00%) rather than the individual application of Trichoderma isolate BHU51 and BHU105 on to seeds. Singh and Singh (27) also reported that the use of mixture of Trichoderma, increase the level of defence releted enzymes in the plant that protect the plant from the infection caused by Macrophomina.

ACKNOWLEDGEMENT

I would like to duly acknowledge UGC grant and DST-FIST for providing the facilities of instrumentation in Department of Plant Pathology, Tamil Nadu Agricultural University.

REFERENCE

(1.) Abd-El-Khair, H., Khalifa, R. Kh. M., Haggag, K. H. E. Effect of Trichoderma species on damping off diseases incidence, some plant enzymes activity and nutritional status of bean plants. J. Amer. Sci. 2010; 6(9): 486-497.

(2.) Anita, P., Aarti, L., Ashwin, L., Hariprasad, P., Shubhada, M. In vitro antagonistic properties of selected Trichoderma spp. against tomato root rot causing Pythium species. Int. J. Sci. Environ. Technol, 2012; 1(4): 302-315.

(3.) Anke, H., Kinn, J., Bergquist, K.E., Sterner, O. Production of siderophores by strains of the genus Trichoderma: Isolation and characterization of the new lipophilic coprogen derivative, palmitoylcoprogen. Biol. Met., 1991; 4(3): 176 180.

(4.) Bailey, B.A., Bae, H., Strem, M.D., Roberts, D.P., Thomas, S.E., Crozier, J., Samuels, G.J., Choi, I.Y., Holmes, K.A. Fungal and plant gene expression during the colonization of cacao seedlings by endophytic isolates of four Trichoderma species. Planta., 2006; 224: 1449-1464.

(5.) Benitez, T., Rincon, A. M., Limon, M. C., Codon, A. C. Mecanismos de biocontrol de cepas de Trichoderma. Int. Microbiol., 2004; 7(4): 249-260.

(6.) Bisset, J. A. revision of the genus Trichoderma. II. Infrageneric classification. Can. J. Bot., 1991; 69: 2357-2372.

(7.) Chernin, L., Chet, I.: Microbial enzymes in the bio control of plant pathogens and pests. In: Enzyme in the environment (Dick, R.P. and Burns, R.G. eds). Marcel Dekker, New York, 2002; pp171-225

(8.) Dennis, C. Webster, J. Antagonistic properties of species groups of Trichoderma III. Hyphal interaction. Transaction of British mycological Society.1971; 57: 363-369.

(9.) Druzhinina, I., Koptchinski, A., Komon, M., Bissett, J., Szakacs, G., Kubicek, C.P. An oligonucleotide barcode for species identification in Trichoderma and Hypocrea. Fungal Genet. Biol., 2005; 42: 813-828.

(10.) Druzhinina, I., Kubicek, C.P. Species concepts and biodiversity in Trichoderma and Hypocrea: from aggregate species to species clusters. J. Zhejiang Univ. Sci., 2005; 6: 100-112.

(11.) Elad, Y., Chet, L., Henis, Y. A selective medium for improving quantitative isolation of Trichoderma spp. from soil. Phytoparasitica, 1981; 9 (1): 59-67.

(12.) Hall, T.A. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98NT. Nucleic Acids Symposium Series, 1999; 41: 95-98.

(13.) Harman, G.E., Howell, C.R., Viterbo, A., Chet, I. Lorito, M. Trichoderma species opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol., 2004; 2: 43-56.

(14.) Jarvis, W. R. (ed): Managing diseases in green house crops. Saint Paul, Minnesota: APS Press. 1992; 122-7.

(15.) Jash, S., Pan, S. Evaluation of mutant isolates of T.harzianum against R. solani causing seedling blight of green gram. Ind. J. Agric. Sci., 2004; 74: 190-193

(16.) Kredics, L., Antal, Z., Doczi, I., Manczinger, L., Kevei, F., Nagy, E. Clinical importance of the genus Trichoderma. A review. Acta. Microbiol. Immunol. Hung., 2003; 50:105-117.

(17.) Kullnig-Gradinger, C.M., Szakacs, G., Kubicek, C.P. Phylogeny and evolution of the fungal genus Trichoderma: a multigene approach. Mycol. Res, 2002; 106: 757-767.

(18.) Lee, S.B., Taylor, J.W. Isolation of DNA from fungal mycelia and single spores. In: PCR protocols: A guide to method and applications (Innis, M.A., Gelfand, D. H., Sninsky, J.J., White, T.J. eds). New York, USA, Academic press, 1990; pp 282-287.

(19.) Lieckfeldt, E., Samuels, G.J., Helgard, H.I., Petrini, O. A morphological and molecular perspective of Trichoderma viride: is it one or two species. Appl. Environ. Microbiol., 2002; 65: 2418-2428.

(20.) Mahuku, G. A Simple Extraction Method Suitable for PCR-Based Analysis of Plant, Fungal and Bacterial DNA. Plant Mol. Biol. Rep, 2004; 22: 71-81.

(21.) Meyer, R. J. Mitochondrial DNAs and plasmids as taxonomic characters in Trichoderma viride. Appl. Environ. Microbiol., 1991; 57: 2269-2276.

(22.) Osburn, R.M., Schroth, M.N., Hancock, J.G., Hendson, M. Dynamics of sugarbeet colonization by Pythium ultimum and Pseudomonas species: Effects on seed rot and damping-off. Phytopathol., 1989 ; 79: 709-716.

(23.) OzbayNusret, S. E. N. Fusarium crown and root rot of tomato and control methods. J Plant Pathol., 2004; 2: 1-4.

(24.) Raeder, U., Broda, P. Rapid preparation of DNA from filamentous fungi. Lett. Appl. Microbiol., 1985; 1: 17-20

(25.) Saitou, N., Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. and Evol., 1987; 4:406-425.

(26.) Sinclair, J.B., Dhingra, O.D. (ed): Basic plant pathology methods, 2nd edn. CRC press, 1995; pp 448.

(27.) Singh, S. P. and Singh, H. B. 2014. Effect of mixture of Trichoderma isolates on biochemical parameters in leaf of Macrophomina phaseolina infeceted brinjal. J. Environ. Biol. 35: 871-876.

(28.) Singh, S.P., Singh, H. B., Singh, D. K. Biocontrol potential mixture of Trichoderma isolates on Damping off and collar rot of tomato. The Bioscan, 2014; 9(3): 1301-1304.

(29.) Srivastava, M., Tiwari, R., Sharma, N. Effect of different cultural variables on siderophores produced by Trichoderma spp., 2013; 1(7): 16.

(30.) Taylor, J.W., Jacobson, D.J., Kroken, S., Kasuga, T., Geiser, D.M., Hibbett, D.S., Fisher, M.C. Phylogenetic species recognition and species concepts in fungi. Fungal Genet. Biol., 2000; 31: 21-32.

(31.) Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. and Evol., 2013; 30: 2725-2729.

(32.) Vinale, F., Sivasithamparam, K., Ghisalberti, E.L., Marra, R., Woo, S.L., Lorito, M. Trichoderma-plant-pathogen interactions. Soil Biol. Biochem., 2008; 40: 1-10.

(33.) Whipps, J.M., Lumsden, D.R. Biological control of Pythium species. Biocontrol Sci. and Techn., 1991; 1: 75-90.

(34.) White, T.J., Bruns, T., Lee, S.,Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR protocols: a guide to methods and applications. (Innis, M.A., Gelfand, D.H., Shinsky, J.J., White, T. J., eds). Academic Press, San Diego, 1990; pp 315-322.

(35.) Woese, C.R., Fox, G.E. Phylogenetic structure of the prokaryotic domain: the primary kingdoms. Proc. Natl. Acad. Sci., USA. 1977; 74: 5088-5090.

(36.) Yang, Y., Chang, K. F., Hwang, S.F., Callan, N. W., Howard, R.J., Blade, S.F. Biological control of Pythium damping off in Echinacea angustifolia with Trichoderma species. J. Plnt. Dis. Protn., 2004; 111(2): 126-136.

S. Vasumathi, K. Eraivan Arutkani Aiyanathan and S. Nakkeeran *

Department of Plant Pathology, Tamil Nadu Agricultural University, Coimbatore - 641 003, India.Y

http://dx.doi.org/10.22207/JPAM.11.1.64

(Received: 08 October 2016; accepted: 03 December 2016)

* To whom all correspondence should be addressed.

E-mail nakkeeranayya@gmail.com

Caption: Fig. 1. Molecular confirmation of Trichodema isolates with ITS primers

Caption: Fig. 2. Phylogenetic tree of the Trichoderma isolates. The numbers given over branches indicate bootstrap coefficient

Caption: Fig. 3. Antagonistic efficacy of Trichoderma spp. against cucumber damping off pathogen under in vitro condition
Table 1. Identification, JSICBI Genebank accession number and isolation
details of different isolates of Trichoderma

s.    Isolate                GPS Location                  Source of
No.   code         Area       Longitude      Latitude       culture

1     TRI 1      Coonoor      11.3530 fN    76.7959 fE      Lillium
2     TRI 2      Coonoor      11.3530 fN    76.7959 fE      Lillium
3     TRI 3      Gudalur      11.5029 fN    76.4917 fE        Tea
4     TRI 4      Gudalur      11.5029 fN    76.4917 fE        Tea
5     TRI 5     Baraliayur    11.3429 fN    76.8500 fE        Tea
6     TRI 6     Chinnaka-     11.3347 fN    76.7705 fE    Silver oak
                 rumpalam
7     TRI 7     Chinnaka-     11.3347 fN    76.7705 fE        Tea
                 rumpalam
8     TRI 8     Baraliayur    11.3429 fN    76.8500 fE   Chrysanthemum
9     TRI 9      Kaikatti     11.3128 fN    76.6909 fE        Tea
10    TRI 10    Edavanalli    12.5207 fN    77.9855 fE      Lillium
11    TRI 11    Edavanalli    12.5207 fN    77.9855 fE      Lillium
12    TRI 12      Kallar      11.3390 fN    76.8652 fE        Tea
13    TRI 13      Kallar      11.3390 fN    76.8652 fE     carnation
14    TRI 14     Kasolai      11.3151 fN    76.6992 fE     Carnation
15    TRI 15     Kasolai      11.3151 fN    76.6992 fE      Gerbera
16    TRI 16     Kasolai      11.3151 fN    76.6992 fE        Tea
17    TRI 19     Katteri      11.3341 fN    76.7879 fE   Chrysanthemum
18    TRI 20    Kunnakombai   11.3149 fN    76.7111 fE        Tea
19    TRI 21    Kunnakombai   11.3149 fN    76.7111 fE    Silver oak
20    TRI 22    Kothagiri     11.4086 fN    76.8720 fE       Rose
21    TRI 23    Kothagiri     11.4086 fN    76.8720 fE      Lillium
22    TRI 24     Kodanad      11.5015 fN    76.9063 fE      Lillium
23    TRI 25     Kodanad      11.5015 fN    76.9063 fE   Chrysanthemum
24    TRI 26     Kodanad      11.5015 fN    76.9063 fE     Carnation
25    TRI 27      Denad      11.44906916    76.9420 fE      Gerbera
26    TRI 28    Masiangudi    11.5634 fN    76.6338 fE        Tea
27    TRI 29    Masiangudi    11.5634 fN    76.6338 fE   Chrysanthemum
28    TRI 35     Devasola     11.3204 fN    76.6868 fE      Lillium
29    TRI 36     Devasola     11.3204 fN    76.6868 fE    Silver oak
30    TRI 37     Devasola     11.3204 fN    76.6868 fE        Tea
31    TRI 38    Chinnaka-     11.3347 fN    76.7705 fE        Tea
                rumpalayam
32    TRI 50      Kallar      11.3390 fN    76.8652 fE   Chrysanthemum
33    TRI 60    Maniyapuram   11.3157 fN    76.7080 fE     Carnation
34    TRI 70    Maniyapuram   11.3157 fN    76.7080 fE      Gerbera

s.    Isolate   Genebank          Identity of Species
No.   code      accession
                 number          NCBI           TricHOKEY

1     TRI 1     KX533988    T. asperellum    T.koningiopsis
2     TRI 2     KX533979    T. asperellum    T.koningiopsis
3     TRI 3     KX533983    T. asperellum    T.koningiopsis
4     TRI 4     KX533985    T. asperellum    T.koningiopsis
5     TRI 5     KX533991    T. asperellum    T.koningiopsis
6     TRI 6     KT462693    T. asperellum    T.koningiopsis

7     TRI 7     KX533980    T. asperellum    T.koningiopsis

8     TRI 8     KX533992    T. asperellum    T.koningiopsis
9     TRI 9     KX533993    T. asperellum    T.koningiopsis
10    TRI 10    KX533994    T. asperellum    T.koningiopsis
11    TRI 11    KX533986    T. asperellum    T.koningiopsis
12    TRI 12    KU361372    T. asperellum    T.koningiopsis
13    TRI 13    KX533978    T. asperellum    T.koningiopsis
14    TRI 14    KX533987    T. asperellum     Unidentified
15    TRI 15    KX533984    T. asperellum     T. asperellum
16    TRI 16    KX533995    T. asperellum    T.koningiopsis
17    TRI 19    KX533996    T. asperellum    T.koningiopsis
18    TRI 20    KX523262    T. asperellum    T.koningiopsis
19    TRI 21    KX533997    T. asperellum     Unidentified
20    TRI 22    KX523263    T. asperellum    T.koningiopsis
21    TRI 23    KX147092    T. asperellum    T.koningiopsis
22    TRI 24    KX084067    T. asperellum    T.koningiopsis
23    TRI 25    KX533998    T. asperellum     Unidentified
24    TRI 26    KX533999    T. asperellum    T.koningiopsis
25    TRI 27    KX533981    T. asperellum    T.koningiopsis
26    TRI 28    KX533982    T. asperellum    T.koningiopsis
27    TRI 29    KX5334000   T. asperellum     Unidentified
28    TRI 35    KX533989     T.harzianum       T.harzianum
29    TRI 36    KX533990     T.harzianum       T.harzianum
30    TRI 37    KU666466      T. virens         T. virens
31    TRI 38    KX523264    T. asperellum    T.koningiopsis

32    TRI 50    KX555650    T. asperellum    T.koningiopsis
33    TRI 60    KX 147094   T. asperellum    T.koningiopsis
34    TRI 70    KX147093    T. asperellum    T.koningiopsis

Table 2. In vitro efficacy of Trichoderma spp. against Pythium
aphanidermatum by dual culture method

S.    Isolates No.                      Mycelia       Mycelia
No.                                    growth(cm)   growth(cm)
                                        Pythium     Trichoderma

1     TRI 1 (T.asperellum-KX533988)       2.67          6.3
2     TRI 2(T.asperellum-KX533979)        2.20          6.8
3     TRI 3(T.asperellum-KX533983)        2.37          6.6
4     TRI 4(T.asperellum-KX533985)        2.70          6.3
5     TRI 5(T.asperellum-KX533991)        2.63          6.4
6     TRI 6(T.asperellum-KT462693)        3.60          5.4
7     TRI 7(T.asperellum-KX533980)        1.40          7.6
8     TRI 8(T.asperellum-KX533992)        2.10          6.9
9     TRI 9(T.asperellum-KX533993)        1.37          7.6
10    TRI 10(T.asperellum-KX533994)       2.70          6.3
11    TRI 11(T.asperellum-KX533986)       2.50          6.5
12    TRI 12(T.asperellum-KU361372)       2.10          6.9
13    TRI 13(T.asperellum-KX533978)       3.57          5.4
14    TRI 14(T.asperellum-KX533987)       3.63          5.4
15    TRI 15(T.asperellum-KX533984)       2.37          6.6
16    TRI 16(T.asperellum-KX533995)       3.07          5.9
17    TRI 19(T.asperellum-KX533996)       2.37          6.6
18    TRI 20(T.asperellum-KX523262)       4.30          4.7
19    TRI 21(T.asperellum-KX533997)       2.13          6.9
20    TRI 22(T.asperellum-KX523263)       3.63          5.4
21    TRI 23(T.asperellum-KX147092)       2.40          6.6
22    TRI 24(T.asperellum-KX084067)       4.30          4.7
23    TRI 25(T.asperellum-KX533998)       2.67          6.3
24    TRI 26(T.asperellum-KX533999)       2.43          6.6
25    TRI 27(T.asperellum-KX533981)       4.20          4.8
26    TRI 28(T.asperellum-KX533982)       3.70          5.3
27    TRI 29(T.asperellum-KX5334000)      2.63          6.4
28    TRI 35(T.harzianum-KX533989)        1.33          7.7
29    TRI 36(T.harzianum-KX533990)        1.30          7.7
30    TRI 37(T.virens-KU666466)           1.10          7.8
31    TRI 38(T.asperellum-KX523264)       2.20          6.8
32    TRI 50(T.asperellum-KX555650)       2.13          6.9
33    TRI 60(T.asperellum-KX147094)       3.40          5.6
34    TRI 70(T.asperellum-KX147093)       3.57          5.4
35    Control                             9.0           --

S.    Isolates No.                      Hyperpar-       Inhibition
No.                                    asitism(cm)     over control
                                                            (%)

1     TRI 1 (T.asperellum-KX533988)        1.8       70.33 (n) (56.99)
2     TRI 2(T.asperellum-KX533979)         1.7       75.56 (h) (60.37)
3     TRI 3(T.asperellum-KX533983)         1.8       73.67 (i) (59.78)
4     TRI 4(T.asperellum-KX533985)         1.9       70.00 (o) (56.78)
5     TRI 5(T.asperellum-KX533991)        1.62       70.78 (m) (57.27)
6     TRI 6(T.asperellum-KT462693)        1.60       60.00 (s) (50.76)
7     TRI 7(T.asperellum-KX533980)        1.98       84.44 (e) (66.76)
8     TRI 8(T.asperellum-KX533992)         1.8       76.67 (f) (61.12)
9     TRI 9(T.asperellum-KX533993)        1.08       84.81 (d) (67.06)
10    TRI 10(T.asperellum-KX533994)       1.08       70.00 (o) (56.78)
11    TRI 11(T.asperellum-KX533986)       1.98       72.22 (l) (58.19)
12    TRI 12(T.asperellum-KU361372)       1.44       76.67 (f) (61.11)
13    TRI 13(T.asperellum-KX533978)       0.72       60.37 (r) (50.98)
14    TRI 14(T.asperellum-KX533987)        1.8       59.63 (t) (50.55)
15    TRI 15(T.asperellum-KX533984)       1.44       73.70 (i) (59.14)
16    TRI 16(T.asperellum-KX533995)       1.98       65.93 (p) (54.28)
17    TRI 19(T.asperellum-KX533996)       1.44       73.70 (i) (59.14)
18    TRI 20(T.asperellum-KX523262)       0.36       52.22 (w) (46.27)
19    TRI 21(T.asperellum-KX533997)        1.8       76.30 (g) (60.86)
20    TRI 22(T.asperellum-KX523263)       1.08       59.63 (t) (50.55)
21    TRI 23(T.asperellum-KX147092)       1.98       73.33 (j) (58.90)
22    TRI 24(T.asperellum-KX084067)       0.36       52.22 (w) (46.27)
23    TRI 25(T.asperellum-KX533998)       1.98       70.37 (n) (57.02)
24    TRI 26(T.asperellum-KX533999)       1.98       72.96 (k) (58.66)
25    TRI 27(T.asperellum-KX533981)       1.08       53.33 (v) (49.90)
26    TRI 28(T.asperellum-KX533982)       1.98       58.89 (u) (50.11)
27    TRI 29(T.asperellum-KX5334000)       1.8       70.74 (m) (57.25)
28    TRI 35(T.harzianum-KX533989)        1.98       85.19 (c) (67.36)
29    TRI 36(T.harzianum-KX533990)        1.98       85.56 (b) (67.66)
30    TRI 37(T.virens-KU666466)           2.16       87.78 (a) (69.53)
31    TRI 38(T.asperellum-KX523264)       1.98       75.56 (h) (60.37)
32    TRI 50(T.asperellum-KX555650)        1.8       76.30 (g) (60.86)
33    TRI 60(T.asperellum-KX147094)       1.97       62.22 (q) (52.07)
34    TRI 70(T.asperellum-KX147093)        1.8       60.37 (r) (50.98)
35    Control                              --               --

Means followed by a common letter are not significantly different at
the 5% level by DMRT; Figures in parentheses are square root
transformed values

Table 3. Effect of bioformulations of Trichoderma spp. on the
incidence of cucumber damping off under glasshouse conditions

S.    Treatments                          Damping off      Per cent
No                                       incidence (%)    reduction
                                                         over control

T1    BP with TRI 37 @10g/kg of seed       38.00 (k)        53.44
                                            (37.16)

T2    BP with TRI 36 @10g/kg of seed       39.10(l)         53.15
                                            (38.70)

T3    BP with TRI 35 @10g/kg of seed       39.07 (l)        53.19
                                            (38.68)

T4    BP with TRI 9 @10g/kg of seed        39.20 (l)        53.03
                                            (38.76)
T5    BP with TRI37+TRI 36+TRI             37.17 (j)        55.46
      35+TRI9 10g/kg of seed                (37.56)

T6    SA with TRI 37 @ 2.5 kg/ha at 15     29.66 (g)        64.46
      and 30th days after seeding           (32.99)

T7    SA with TRI 36 @ 2.5 kg/ha at 15     32.71 (h)        60.81
      and 30th days after seeding           (34.88)

T8    SA with TRI 35 @ 2.5 kg/ha at 15     32.69 (h)        60.83
      and 30th days after seeding           -34.87

T9    SA with TRI 9 @ 2.5 kg/ha at 15      35.27 (i)        57.74
      and 30th days after seeding           (36.43)

T10   SA with TRI37+TRI 36+TRI             21.13 (c)        74.68
      35+TRI 9 @ 2.5 kg/ha at               (27.36)
      15 and 30th days after seeding

T11   BP +SA with TRI 37 @10g/kg of        23.04 (d)        72.39
      seed+2.5 kg/ha at 15 and
      30th days after seeding               (28.68)

T12   BP +SA with TRI 36 @10g/kg of        23.00 (d)        72.44
      seed+2.5 kg/ha at 15 and              (28.65)
      30th days after seeding

T13   BP +SA with TRI 35 @10g/kg of        26.45 (e)        68.31
                                            (30.95)
      30th days after seeding
T14   BP +SA with TRI 9 @10g/kg of         27.24 (f)        67.36
      seed+ 2.5 kg/ha at 15 and             (31.46)
      30th days after seeding

T15   BP +SA with TRI37+TRI 36+TRI         19.34 (b)        76.82
      35+TRI9 @10g/kg of seed+              (26.09)
      2.5 kg/ha at 15 and 30th days
      after seeding

T16   BP +SA with Metalaxyl 2g/kg          12.50 (a)        85.02
      of seed+ 0.1% at 15 and               (20.70)
      30th days after seeding

T17   Control                              83.47 (m)          --
                                            (66.01)
COPYRIGHT 2017 Oriental Scientific Publishing Company
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Vasumathi, S.; Aiyanathan, K. Eraivan Arutkani; Nakkeeran, S.
Publication:Journal of Pure and Applied Microbiology
Article Type:Report
Date:Mar 1, 2017
Words:6544
Previous Article:Ecological Biodiversity Measurement of Seed Mycoflora Contamination of Freshly Harvested in Maize Growing Zone-II.
Next Article:Comparative Study Between Different Types of Media used for the Isolation of Uropathogens with Special Reference to E.coli.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |