Printer Friendly

Bioactive metabolites from chaetomium globosum L18, an endophytic fungus in the medicinal plant curcuma wenyujin.

ARTICLE INFO

Keywords: Curcuma wenyujin Chaetomium globosum L18 Endophytic fungi Metabolites Antifungal activity Cytotoxic activity

ABSTR

ACT An endophytic fungus, strain L18, isolated from the medicinal plant Curcuma wenyujin Y.H. Chen et C. Ling was identified as Chaeromium globosum Kunze based on morphological characteristics and sequence data for the internal transcribed spacer (ITS-5.8S-IT52) of the nuclear ribosomal DNA. A new metabolite named chaetoglobosin X (1), together with three known compounds erogosterol (2), ergosterol 5 [alpha],8-peroside (3) and 2-methyl-3-hydroxy indole (4), were isolated from C globosum L18. Their structures were elucidated by spectroscopic methods including NMR, UV, IR and MS data and comparison with published data. Chaetoglobosin X (1) is hitherto unknown, whereas 2-methyl-3-hydroxy indole (4) is reported for the first time as a fungal metabolite, and erogosterol (2) and ergosterol 5cx,8-peroside (3) are known fungal metabolites previously identified in other genera. Chaetoglobosin X (1) exhibited a broader antifungal spectrum and showed the strongest cytotoxic activity against H22 and MFC cancer cell lines.

Introduction

Fungal endophytes are microorganisms that colonize living, internal tissues of plants without causing any immediate, overtly negative effects (Aly et al. 2008). Endophytic fungi are ubiquitous in plant species and are tnutualistic to their host (Li et al. 2007). Some can produce similar or identical biologically active constituents as the host, such as taxol (Stierle et al. 1993). In addition, many fungal endophytes produce secondary metabolites and some of these compounds exhibit antifungal and antibacterial activity that strongly inhibits the growth of other microorganisms (Gunatilaka 2006). Other secondary metabolites display antibiotic activity against pathogens and tumor cells to different degrees (Li et al. 2000). Recently, endophytic fungi have been recognized as important sources of a variety of structurally novel active secondary metabolites with anticancer, antimicrobial and other biological activities (Yang et al. 2011).

Curcuma is a well-known genus used in traditional Chinese medicines. Curcuma weriyujin Y.H. Chen et C. Ling, called 'Erzhu' in Chinese, contains volatile components that are pharmacologically active and often used for their anticancer activity. The principal components include [beta]-elemene, curzerene, curzerenone, germacrone, curcumol, isocurcumenol and curcumenol (Mau et al. 2003). However, little is known about secondary metabolites produced by endophytes harbored inside the healthy tissues of C. wenyu-jin (Xuan and Zhang 2007). We recently isolated the endophytic fungus Chaetomium globosum from the leaves of C. wenyujin based upon analysis of the nucleotide sequences of the 18S and internal transcribed spacer (ITS) region of the ribosomal RNA gene and morphological characteristics. In previous studies, several novel metabolites have been reported from strains of C. globosum, which were isolated from Ginkgo biloba and the rhizosphere of the Christmas cactus and the marine fish Mugil cephalus (Kithsiri Wijeratne et al. 2006; Muroga et al. 2009; Qin et al. 2009; Yamada et al. 2008). Our ongoing search for biologically active secondary metabolites from C. globosum in C. wenyujin led to isolation of one new compound, namely chaetoglobosin X (1), together with three known compounds, namely erogosterol (2) (Li et al. 2003), ergosterol 5 [alpha],8-peroside (3) (Gao et al. 2000; Xie et al. 2007) and 2-methyl-3-hydroxy indole (4) (Ding and Yang 1999). The known metabolites were identified by comparison of their spectroscopic data with those reported in the literature. In addition, 2-methyl-3-hydroxy indole (4) was found for the first time as a natural product in endophytic fungi. We report herein the isolation and structural elucidation of the metabolites as well as antifungal activity against phytopathogenic fungi and cytotoxic activity. The results indicate that compound 1 has reasonably strong fungistatic activities on plant pathogenic fungi and inhibits the growth of mouse fore-stomach carcinoma cell(MFC) and morse hepatocellular carcinoma cell(H22). The endophytic fungus C. globosum could protect the host by producing secondary metabolites and may have the potential to be used in the medical field.

Methods

General experimental procedures

Melting points were measured on a digital Electrothermal 9100 melting point apparatus. Optical rotations were measured in CH[Cl.sub.3] using a Perkin-Elmer polarimeter with a sodium lamp operating at 598 nm and 25 [degrees] C. IR and UV spectra were recorded on a Nicolet 5DX-FTIR spectrophotometer and Shimadzu UV-1700 spectrophotometer. (1)H and (13)C NMR spectra were recorded on a Bruker AVANCE 600 NMR spectrometer (operating at 600 MHz for (1)H and 150 MHz for (13)C). ESI-MS was conducted on a Micromass ZQ[TM] 4000 mass spectrometer. Analytical HPLC was performed on a Varian Pro Star 230 using a Phenomenex C-18 column (250 mm x 4.6 mm). Thin-layer chromatography (TLC) and precoated TLC were performed on silica gel 60. Column chromatog-raphy (CC) was carried out on silica gel (100-200 mesh; Qingdao Haiyang Chemicals) with a gradient system of PE/EtOAc or on Sephadex LH20 with CH[Cl.sub.3]/MeOH. All fungal culture media were purchased from Difco and the materials used for the antimicrobial assays were all obtained from Oxoid.

Fungal material and identification

Fresh healthy leaves of Curcuma wenyujin were collected in Zhejiang Province, Wenzhou, China, in 2008. The samples were washed under running tap [H.sub.2]O and air-dried. The cleaned leaves were surface-sterilized as previously described (Chomcheon et al. 2006). The surface-sterilized leaves were cut into small pieces using a sterile blade and placed on sterile water agar plates for further incubation at 28[degrees]C. The hyphal tip of the endophytic fungus growing out from the plant tissue was cut by a sterile Pasteur pipette and transferred onto a sterile potato dextrose agar (PDA) plate. After incubation at 28[degrees]C for 6 days, culture purity was determined from colony morphology.

The isolated endophytic fungus L18 was identified based on both microscopic morphology and analysis of the nucleotide sequence of the ITS1-5.8S-ITS2 ribosomal RNA region. The primers ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990) were used to amplify the region from total cellular DNA as previously described (Prachya et al. 2007). The amplified DNA was purified and directly sequenced using the same primers. BLASTN 2.2.18+ (Zhang et al. 2000) was used to search for similar sequences in GenBank. Highly similar sequences were GU062299.1 (Max ident 99%, E value 0.0, Query coverage 91%), HQ316556.1 (Max ident 98%, E value 0.0, Query coverage 94%), FN598936.1 (Max ident 98%, E value 0.0, Query cov-erage 92%), AB511978.1 (Max ident 98%, E value 0.0, Query coverage 91%), EU918706.1 (Max ident 97%, E value 0.0, Query coverage 99%), and GQ906953.1 (Max ident 97%, E value 0.0, Query coverage 96%). These results indicated that strain L18 might be Chaetomium globosum.

Endophytic fungus isolate L18 grew on PDA as a gray-white velvety colony. Extrametrical ascocarps were olive or green-yellow with ascomal hairs. The clustered asci were clavate with each containing 8 ascospores; the ascospores were 9-11 [micro]m x 6.2-9.1 [micro]m, pale brown and lemon-shaped. These characteristics corresponded well with those of C. globosum (Wei 1979). Thus, based on microscopic morphological characteristics and ITS sequence data, this endophytic fungus was identified as C. globosum. The 18S and ITS rRNA sequence for L18 has been lodged in GenBank (accession number GU564156). The culture of Chaetomium globosum L18 has been deposited at the Microbiology Laboratory in Jilin Agriculture University, China.

Fermentation, extraction and isolation

The endophytic fungus C. globosum L18, grown on PDA at 28[degrees]C for 5 days, was inoculated into 500 ml Erlenmeyer flasks containing 300 ml potato dextrose broth and autoclaved at 125[degrees]C for 15 min. The fermentation was shaken at 150 rpm at 28[degrees]C for 8 days. The cultures (801) were separated into mycelium and filtrate by filtration. The filtrate was extracted three times with an equal volume of EtOAc and the EtOAc layer was collected. The frozen mycelia was smashed and extracted three times repeatedly by ultrasonic treatment with an equal volume of EtOAc. Both of the EtOAc extracts were combined and evaporated to dryness under reduced pressure to obtain a crude broth extract (25.16g). This extract was subjected to silica gel CC using gradient elution with petroleum ether - EtOAc (95:5-55:45, v/v), to give ten fractions. These fractions were analyzed on silica TLC using petroleum ether - EtOAc (85:15, v/v) as the developing solvent. Combining similar fractions resulted in six fractions (A1-A6). Fraction A2 was purified by silica gel CC with a gradient of petroleum ether - EtOAc (80:20-65:35) to give four subfractions (B1-84). Subfraction B2 was further purified by silica gel CC with petroleum ether - EtOA (75:25) as the mobile phase to give compound 2 (87.6 mg). Fraction B4 was purified by silica gel CC with petroleum ether-acetone (85:15) to give compound 1 (34.7 mg). Subfraction A3 was further purified by precoated TLC (silica gel F254) using petroleum ether - EtOA (70:20) as the mobile phase to give compound 3 (39.9 mg). Subfraction A5 was further purified by Sephadex LH-20 CC, eluted with [CH.sub.3]Cl-MeOH (40:30), and five fractions (C1-05) were obtained. Fractions C2 and C3 were combined and further purified on preparative TLC eluted with [CH.sub.3]C1:Me0H (5:4) to yield compound 4 (42.3 mg).

Chaetoglobosin L (1)

Orange powder, m.p. 195-198[degrees]C; [[alpha]][D.sup.25] -123[degrees](c 1.2, CH[Cl.sub.3]); UV (MeOH) [[lambda].sub.max] (log[epsilon]) 254 (2.39), 340 (3.79), 369 (4.10) nm; IR [v.sub.max] (KBR) 3450, 3108, 2967, 2930, 2875, 1774, 1678.2, 1619.5, 1515.4, 1401, 1248, 1120, 1037, 959, 894, 873, 850 [cm.sup.-1]; ESI-MS: m/z 415.1951 [[m].sup.+], 437.1948 [[M+Na].sup.+], 459.1945 [[M+C1].sup.-]; (calcd. for [C.sub.23][H.sub.26][O.sub.7], 414.1948). For (1)H and (13)C NMR spectroscopic data, see Table 1.

Table 1
(1)H (600 MHz) and (13)C (150 MHz) NMR spectroscopic data for compound
1 in CD[Cl.sub.3] and DMSO-[d.sub.6] (J values in Hz).

Position    (1)H ([delta],     (13)C ([delta],     DEFT        HMBC
            CD[Cl.sub.3])    DMSO-[d.sub.6])

1                                      183.6           C         C-2

2               3.41(m, 1H)             51.0          CM    C-l, C-4

3                                      201.3           C   C-2, C-4,
                                                                 C-5

4               2.28(m, 1H)             38.6          CH   C-2, C-5,
                                                                 C 6

5               1.41(m, 2H)             28.9  [CH.sub.2]  C-4, C-19,
                                                                C-20

6                                      140.6           C   C-4, C-5,
                                                          C-8, C-20,
                                                                C-21

7                                      126.3           C   C-5. C-8,
                                                          C-9, C-20.
                                                                C-21

8               8.59(s, 1H)            151.2          CH   C-9, C-2I

9         6.46(d, 15.6,1H)            120.7          CH   C-8, C-11

10                                     168.4           C   C-8, C-9,
                                                               C-11,
                                                                C-12

11              6.81(s, 1H)            105.7          CH        C-9,
                                                               C-12.

12                                     107.8           C       C-11,
                                                               C-22.

13        6.63(dd.7.8.15.6,            147.4          CH       C-11,
                       1 H)                                C-12,C-22

14                                      87.8           C        C-22

15                                     110.5           C

16                                     157.5           C

17                                     160.9           C   C-2, C-23

18              3.55(m, 1H)             70.0          CH   C-2, C-23

19         0.85(t, 7.2, 3H)             21.9  [CH.sub.3]    C-4, C-5

20         1.04(d, 6.6, 3H)             25.7  [CH.sub.3]         C-5

21               1.62(s,3H)             19.5  [CH.sub.3]         C-8

22               0.97(s,3H)             13.2  [CH.sub.3]        C-12

23           0.98(d,1.8,3H)             12.0  [CH.sub.3]         C-2


Ergosterol (2)

White needle-shaped crystals, m.p. 165-169[degrees]C; [[alpha]][D.sup.25] -123[degrees](c 1.2, CH[Cl.sub.3]); UV (MeOH) [[lambda].sub.max] (log[epsilon]) 267 (4.61), 251 (4.66) nm; (1)H NMR (CD[Cl.sub.3], 600 MHz) [delta] 0.63 (3H, s, 18-[CH.sub.3]), 0.82 (3H, d, J= 6.4, 26-[CH.sub.3]), 0.84 (3H, d, J=6. 4, 27-CH3), 0.92 (3H, d, J= 6.8, 28-[CH.sub.3]), 0.95 (3H, s, 19-[CH.sub.3]), 1.03 (3H, d, J= 6.8, 21-[CH.sub.3]), 3.63 (1H, m, H-30), 5.18 (1H, dd, J= 15.2, 8.0, H-23), 5.22 (1H, dd, J= 15.2, 8.0, H-22), 5.39 (1H, dd, J= 2.4, 6.0, H-6), 5.57 (1H, dd, J= 2.4, 5.4, H-7).(13)C NMR (CD[Cl.sub.3], 150 MHz) [delta] 141.4 (C-8), 139.8 (C-5), 135.6 (C-23), 132.0 (C-22), 119.6 (C-6), 116.3 (C-7), 70.5 (C-3), 55.8 (C-17), 54.6 (C-14), 46.3 (C-9), 42.8 (C-13), 42.8 (C-24), 40.4 (C-20), 39.1 (C-12), 38.4 (C-1), 37.1 (C-10), 33.1 (C-4), 33.1 (C-25), 28.3 (C-16), 28.3 (C-2), 23.0 (C-15), 21.1 (C-11), 21.1 (C-27), 20.0 (C-26), 19.7 (C-21), 17.6 (C-28), 16.3 (C-19), 12.1 (C-18); ESI-MS: m/z 419.3237 [[M+Na].sup.+], 395.3249 [[M-H].sup.-]; (calcd. for [C.sub.28][H.sub.46]O, 396.3243).

Ergosterol 5[alpha],8[alpha]-peroside (3)

Colorless needle-shaped crystals, m.p. 173-175[degrees]C; UV (MeOH) [[lambda].sub.max] (log[epsilon]) 265 (3.88), 298 (4.92), 321 (1.30) nm; IR [v.sub.max] (KBR) 3525, 3309, 3105, 1653, 1546, 1465, 1218, 1190, 1054, 1038 [cm.sup.-1]; (1)H NMR (CD[Cl.sub.3], 600 MHz) [delta] 6.48 (1H, d, J= 8.4), 6.22 (1 H, di= 8.4), 5.19 (114, dd, J=7,8, 15.0), 5.12 (1H, dd, J=8.4, 15.0), 0.98 (3H, d, J = 6.6), 0.88 (3H, d, J= 6.8), 0.86 (3H, s), 0.82 (3H, d, J= 6.6), 0.79 (3H, d, J= 6.6), 0.78 (3H, s); (13)C NMR (CD[Cl.sub.3], 150 MHz) [delta] 135.4 (C-6), 135.2 (C-22), 132.3 (C-23), 130.7 (C-7), 82.1 (C-5), 79.4 (C-8), 66.4 (C-3), 56.2 (C-17), 51.7 (C-14), 51.1 (C-9), 44.6 (C-13), 42.8 (C-24), 39.7 (C-20), 39.3 (C-12), 36.9 (C-4), 36.9 (C-10), 34.6 (C-1), 33.0 (C-25), 30.1 (C-2), 28.6 (C-16), 23.4 (C-13), 20.9 (C-21), 20.6 (C-15), 19.9 (C-26), 19.6 (C-27), 18.2 (C-19), 17.5 (C-28), 12.9 (C-18); ESI-MS: m/z 429.3236 [[M].sup.+], 451.3242 [[M+Na].sup.+], 427.3275 [[M-H].sup.-]; (calcd. for [C.sub.28][H.sub.44][O.sub.3], 428.3251).

2-Methyl-3-hydroxyl indole (4)

Light yellow powder, m.p. 133-135 C; UV (Me0H) [[lambda].sub.max] (log[epsilon]) 257 (4.02), 276 (1.34), 301 (4.04) rim; (1)H NMR (CD[Cl.sub.3], 600 MHz) [delta] 6.34 (1H, d, J = 1.8), 6.26 (1H, di= 1.8), 5.99 (1H, s), 5.90 (1H, s), 2.08 (3H, s); (13)C NMR (CD[Cl.sub.3], 150 MHz) [delta] 145.8 (C-2), 138.5 (C-9), 134.3 (C-3), 128.1 (C-6), 116.1 (C-4), 116.0 (C-5), 111.1 (C-7), 104.4 (C-3), 9.5 (C-10); ESI-MS: m/z 146.1370 [[M-H].sup.-] (calcd. for [C.sub.9][H.sub.9]ON, 147.1376).

Antifungal assay

The plant pathogens E. turcicurn, F. oxysporium f. sp. cucumeris, C lunata, F. graminearum, and F. moniliforme were used in the antifungal assay. Cultures were obtained from the Plant Pathology Laboratory ofJilin Agricultural University. The minimum inhibitory concentrations (MICs) were performed using a modified version of the 2-fold serial dilution method (Pongcharoen et al. 2008). Compounds 1-4 were dissolved in DMSO. Serial 2-fold dilutions of the test extract were mixed with melted sabouraucl's dextrose agar medium in the ratio of 1:50 in microtiter plates with flat-bottomed wells. Final concentrations in agar ranged between 100 and 1.56[micro]g/ml for the compounds. Inoculum suspensions were spotted on the compound amended agar surface ([10.sup.6] CFU per spot). The inoculated plates were incubated at 28[degrees]C for 48 h. The MICs were recorded by reading the lowest concentrations that inhibited visible growth. Growth controls were performed on agar containing DMSO.

Cytotoxicity bioassays

MFC (gastric cancer cells in mice) and H22 (hepatic cancer cells in mice) cell lines were obtained from the Basic Medical Experimental Animals Laboratory of Jilin University. Cytotoxicity of compounds 1-4 were tested against each cell line using the micro-culture tetrazolium assay as described previously (Ashour et al. 2006). All experiments were carried out in triplicate and repeated three times, and the target compounds were diluted into different concentrations and calculate their respective inhibition ratio. Their inhibition ratio was used as the Y-axis and the concentration as the X-axis by drawing standard curve for determination of IC50. As controls, media with 0.1% EGMME/DMSO were included in the experiments.

Results and discussion

The endophytic fungus Chaetomium globosum strain L18 was isolated from the leaves of the medicinal plant Curcuma wenyujin. The fungus was identified based on analyses of the nucleotide sequence of the nuclear ribosomal ITS region and morphological characteristics. The nucleotide sequence obtained in this study has been lodged in GenBank (accession number GU564156). An analysis of DNA sequence similarity among sequences lodged in GenBank revealed that the ITS1-5.8S-ITS2 region of L18 showed 97-99% homology to that of C globosum reference strains (GenBank accession numbers GQ906953, EU918706, AB511978, FN598936, HQ316556, GU062299). Morphological features (colony shape and color, and characteristics of the ascocarp, ascomal hairs, ascus and ascospores) also indicated the isolated strain L18 was closely related to Chaetomium globosum. An ascocarp, ascus and ascospores of strain L18 are illustrated in Fig. 1.

A crude broth extract of C globosum L18 was separated with a silica gel column, Sephaclex LH-20 and preparative TLC to yield a novel compound 1 (named chaetoglobosin X) as well as three known compounds 2, 3 and 4 (erogosterol, ergosterol 5[alpha],8-perosicle and 2-methyl-3-hydroxy indole). Compounds 2 and 3 are known metabolites previously isolated from endophytic fungi from the mangrove trees and Spartina aherniflora (Wei et al. 2008; Shao et al. 2007), whereas compound 4 was isolated for the first time from a fungal source.

Compound 1 was isolated as an orange powder whose ESI-MS exhibited a strong peak at iniz 415.1951 [[M].sup.+], 437.1948 [[M+Na].sup.+], and 459.1945 [[M+CI].sup.-], indicating a molecular formula of [C.sub.23][H.sub.26][O.sub.7] (414.1948) and the Lieberman-Burchard reaction was positive. It melted at 195-198[degrees]C with [[alpha]][D.sup.25] -123[degrees](c 1.2, CH[Cl.sub.3]) and exhibited an UV absorption band at 254, 340, and 369 nm. A hydroxyl absorption band was found at 3450.6, 2967.5 [cm.sup.-1] while a double bond absorption band was observed at 1774.0, 1678.2, 1619.5, and 1515.4 [cm.sup.-1] in the IR spectrum. The (1)H NMR spectroscopic data (Table 1) displayed six sets of methyne protons [[delta] 3.41 (1H, m), 2.28 (1H, m), 8.59 (1H, s), 6.46 (1H, d, J= 15.6 Hz), 6.81 (1H, s), 6.63 (1 H, dd, J= 7.8, 15.6 Hz), 3.55 (1 H, m)], five sets of methyl protons [6 0.85 (3H, t, J=7.2 Hz), 1.04 (3H, d, J=6.6 Hz), 1.62 (3H, s), 0.97 (3H, s), 0.98 (3H, d, J=1.8 Hz)] and a methylene proton [[delta] 1.41 (2H, m)].

The (13)CNMR and DEPT spectra (Table 1) showed 13 signals with unsaturated carbons in a low magnetic field, two carbonyl groups, four tertiary carbons, seven quaternary carbons and five primary carbons, a secondary carbon, three tertiary carbons, and a quaternary carbon in a higher magnetic field.

Based on HMQC, carbon-hydrogen correlation was found, and the HMBC spectrum (Table 1) showed correlations from [delta] 0.85 and 1.04 (H-3) and 2.28 (H-1) to [delta] 28.9 (C-4, C-19, C-20); [delta] 0.85 (H-3) and 3.41 (H-1) to [delta] 201.3 (C-2, C-4, C-5); 6 3.41 (H-1) to [delta] 38.6 (C-2, C-5, C-6); [delta] 3.41 (H-1) to [delta] 70.0 (C-2, C-23); [delta] 1.41 (H-2) and 1.04, 1.62 (H-3) to [delta] 140.6 (C-4, C-5, C-8, C-20, C-21) and 126.3 (C-5, C-8, C-9, C-20, C-21). However, these HMBC data could not place the position of four methynes in the structure of compound 1, and four olefinic carbons may exist in its structure.

According to its degree of unsaturation of 11, it was deduced to contain an oxygen ring. Based on these and other data, the planar structure of compound 1 was elucidated as shown in Fig. 2. It is not reported as yet and its structure has not been searched in CA Scifinder, but compound 1 showed some similarities to chaetoglobosin A based on comparison with published spectroscopic data (Ni et al. 2008) and was also obtained from Chaetomium globosum. Therefore compound 1 was named chaetoglobosin X.

In addition, three known compounds 2, 3 and 4 isolated from extracts of liquid cultures of Chaeromium globosum L18 were identified as erogosterol, ergosterol 5[alpha],8-peroside and 2-methyl-3-hydroxy indole respectively, based on their UV, (1)H, (13)C NMR, and MS data and comparison with published data (Li et al. 2003; Gao et al. 2000; Xie et al. 2007; Ding and Yang 1999).

Compounds 1-4 were evaluated against the plant pathogens Exserohilum turcicum, Fusarium oxysporum f. sp. Cucumerinum, Curvularia lunata, Fusarium graminearum, and Fusarium moniliforme using the 2-fold serial dilution method. Compounds 2, 3, and 4 showed no significant antibiotic activity against the five fungal strains. Compound 1 exhibited the highest antifungal activity against E. turcicum, F. oxysporium f. sp. cucumeris and C. lunata with a MIC value of 3.125 [micro]g/ml and showed moderate antifungal activity against F. graminearum and F. moniliforme with a MIC value of 6.25 [micro]g/ml.

Biological evaluation of compounds 1-4 was also carried out using MFC (Gastric cancer cells in mice) and H22 (hepatic cancer cells in mice) cell lines. The four compounds exhibited clear differences in cytotoxic activity toward MFC and H22 cells. Compound 1 displayed the strongest cytotoxicity against H22 cells (IC50 3.125 [micro]g/ml) and exhibited moderate cytotoxicity against MFC cells (IC50 6.25 [micro]g/ml), whereas the other compounds were inactive against H22 and MFC cells.

Conclusions

The isolated endophytic fungus strain L18 was identified as Chaetomium globosum from its morphological characteristics and rDNA ITS sequence analysis. A novel compound 1 (chaetoglobosin X) was isolated from C. globosum L18 together with three known compounds 2, 3 and 4 (erogosterol, ergosterol 5[alpha],8-peroside and 2-methyl-3-hydroxy indole). Compound 4 was isolated from a fungal source for the first time. Additionally, antimicrobial activity and cytotoxic activity tests shows compound 1 presents a broader antifungal spectrum and a more effective antifungal activity and shows an obvious inhibitory effect on MFC and H22 cell lines. Thus C. globosum L18 is a potential fungal candidate for use in biological control and exploitation for anticancer drug development. This is an intriguing subject for further studies.

Acknowledgements

Y.H. Wang thanks the Scientific Research Starting Foundation of Jilin Agricultural University (grant no. 201110) and Scientific and Technological Planning of Zhejiang province, China (grant no. 200503019) for financial support. We gratefully acknowledge support from teachers of the Department of Pharmacology, Wenzhou Medical College and College of Agronomy in Jilin Agriculture University. We also thank colleagues from the Laboratories of Immunology, Pharmacology, and Biochemistry from the TCM Academy of Jilin Province, and the Integrated Research Unit for cytotoxicity tests.

* Corresponding author. Tel.: +86 0431 8451 7904; fax: +86 0431 8451 0955. E-mail address: yanhong-w@163.com (X. Wu).

References

Aly, A.H., Edrada-Ebel, R., Wray, V., Muller, W.E.G., Kozytska, S., Kozytska, U., Proksch, P., Ebel, R.. 2008. Bioactive metabolites from the endophytic fungus Ampelomyces sp. isolated from the medicinal plant Urospermum picroides. Phytochemistry 69, 1716-1725.

Ashour, M., Edrada, R.A., Ebel, R., Wray, V., Watjen, W., Padmakumar, K., Muller. W.E.G., Lin, W.H., Proksch, P., 2006. Kahalalide derivatives from the indian sacoglossan mollusk Elysia grandifolia. J. Nat. Prod. 69, 1547-1553.

Chomcheon, P., Sriubolmas, N., Wiyakrutta, S., Ngamrojanavanich, N., Chaichit, N., Mahidol, C., Ruchirawat. S., Kittakoop. P., 2006. Cyclopentenones, scaffolds for organic synthesis produced by the endophytic fungus, mitosporic Doth-ideornycete sp LRUB20. J. Nat. Prod. 69, 1351-1353.

Ding, D.Q.. Yang, J.S., 1999. Analytical Chemistry Handbook (Book Seven), second ed. Chemical Industry Press, 5.

Gunatilaka, A.A.L., 2006. Natural products from plant-associated microorganisms:distribution, structural diversity, bioactivity, and implications of their occurrence. J. Nat. Prod. 69.509-526.

Gao, J.M., Dong, Z.J., Liu, J.K., 2000. The constituents of the Basidiomycetes Russula cyanoxantha. Acta Botanica Yunnanica 22. 85-89.

Kithsiri Wijeratne, E.M., Turbyville, T.J., Fritz, A., Whitesell, L., Leslie Gunatilakaa, A.A., 2006. A new dihydroxanthenone from a plant-associated strain of the fungus Chaetomium globosum demonstrates anticancer activity. Bioorg. Med. Chem. 14, 7917-7923.

Li, W.C., Zhou, J., Guo, S.Y.. Guo, L.D., 2007. Endophytic fungi associated with lichens in Baihua mountain of Beijing. Chin. Fungal Divers. 25, 95-106.

Li. J.Y., Strobel. G.A., Harper, J.K.. Lobkovsky. E., Clardy. J., 2000. Cryptocin, a potent tetramic acid antimycotic from the endophytic fungus Cryptosporiopsis ef. quercina. Org. Lett. 2, 767-770.

Li, J.X., Xu, L.Z., Yang, Si., Zou, Z.M., 2003. Studies on chemical constituents of Cordyceps sinensis(Berk) Sacc. Chin. Pharm. J. 38.499-501.

Muroga, Y., Yamada. T., Numata, A., Tanaka, R., 2009. Chaetomugilins I-O, new potent cytotoxic metabolites from a marine-fish-derived Chaetomiurn species stereochemistry and biological activities. Tetrahedron 65, 7580-7586.

Mau, J.L., Lai, E.Y.C., Wang, N.P., Chen, C.C., Chang, C.H., Chyau, C.C., 2003. Composition and antioxidant activity of the essential oil from Curcuma zedoaria. Food Chem. 82, 583-591.

Ni, Z.W., Li, G.H., Zhao, P.J., Shen, Y.M., 2008. Antimicrobial components of the endophytic fungal Strain Chaetomium globosum Ly50' from Maytenus hookeri. Nat. Prod. Res. Dev. 20, 33-36.

Prachya, S., Wiyakrutta, S., Sriubolmas, N., Ngam rojanavanich, N., Mahidol. C., Ruchirawat, S., Kittakoop, P., 2007. Cytotoxic mycoepoxydiene derivatives from an endophytic fungus Phomopsis sp isolated from Hydnocarpus anthelminthicus. Planta Med. 73, 1418-1420.

Pongcharoen, W., Rukachaisirikul. V., Phongpaichit. S., Kuhn. T., Pelzing, M., Sakayaroj, J., Taylor, W.C., 2008. Metabolites from the endophytic fungus Xylaria sp. PSU-D14. Phytochernistry 69, 1900-1902.

Qin, J.C., Zhang, Y.M., Gao, J.M., Bai, M.S., Yang, S.X., Laatsch, H., Zhang, A.L., 2009. Bioactive metabolites produced by Chaetomium globosum, an endophytic fungus isolated from Ginkgo biloba. Bioorg. Med. Chem. Lett. 19, 1572-1574.

Stierle. A., Strobel. G., Stierle, D., 1993. Taxol and taxane production by Taxomyces andreanae, an endophytic fungus of Pacific yew. Science 5105, 214-216.

Shao, Z.Y., Feng, Y.H., Deng, Y.X., Xu, D.Q., Hong, F., 2007. Metabolites of endophytic fungus Fusarium sp.F4 from Spartina aherniflora. Chin. J. Nat. Med. 5, 108-110.

Wei, M.Y., Li, S.D., Shao, C.L., Yu, Z.G., Lin, Y.C., 2008. Secondary metabolites from mangrove endophytic fungus 350#. J. Guangdong Med. College 26, 503-504.

Wei, J.C., 1979. Manual of Identification in Fungus [M]. Shanghai Science and Technology Press, Shanghai.

White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, pp. 315-322.

Xuan, Q., Zhang, L.Q., 2007. Separation and identification of endophytic fungi from rhizorna curcuma. Chin. J. Ethnomed. Ethnopharm. 84, 45-46.

Xie, C.H., Ruan, L.j., Xia, H.Z., Chen, D.J., Ge, M., 2007. Fermentation products of endophyte HCCB00167. J. Shenyang Pharm. Univ. 24, 245-248.

Yang, S.X., Gao, J.M., Zhang. Q., Laatsch, H., 2011. Toxic polyketides produced by Fusarium sp, an endophytic fungus isolated from Melia azedarach. Bioorg. Med. Chem. Lett. 21. 1887-1889.

Yamada, T., Doi, M., Shigeta, H., Muroga, Y., Hosoe, S., Numata, A., Tanaka, R., 2008. Absolute stereostructures of cytotoxic metabolites, chaetonnigilins A-C, produced by a Chaetomium species separated from a marine fish. Tetrahedron Lett. 49,4192-4195.

Zhang, Z., Schwartz, S., Wagner. L., Miller, W., 2000. A greedy algorithm for aligning DNA sequences. J. Comput. Biol. 7,203-214.

Yanhong Wang (a), Lei Xu (b), Weiming Ren (a), Dan Zhao (a), Yanping Zhu (a), Xiaomin Wu (c), *

(a.) Ginseng and Velvet Ander Products Quality Supervision &Test Center Certificated by Ministry of Agriculture, Jilin Agricultural University, 130118 Changchun, PR China

(b.) College of China Medicinal Material in Jilin Agriculture University, 130118 Changchun, PR China

(c.) The Affiliated Hospital of Jilin Agricultural University, 130118 Changchun, PR China

0944-7113/$ - see front matter [c] 2011 Elsevier GmbH. All rights reserved.

doi:10.1016/j.phymed.2011.10.011
COPYRIGHT 2012 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Short communication
Author:Wang, Yanhong; Xu, Lei; Ren, Weiming; Zhao, Dan; Zhu, Yanping; Wu, Xiaomin
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Geographic Code:9CHIN
Date:Mar 1, 2012
Words:4830
Previous Article:Salidroside inhibits migration and invasion of human fibrosarcoma HT1083 cells.
Next Article:Pharmacokinetic, tissue distribution and excretion of ginsenoside-Rd in rodents.
Topics:

Terms of use | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters