Printer Friendly

BETA-CAROTENE MODULATES OXIDATIVE STRESS-INDUCED CELL APOPTOSIS IN MDCK CELLS THROUGH REGULATION OF BCL-2MRNA AND CASPASE-3 ACTIVITIES.

Byline: Fahmida Parveen, Saba Parveen, Zaheer Ahmed Nizamani, Dildar Hussain Kalhoro, Mansoor Tariq, Riaz Ahmed and Alam Zeb Khan

SUMMARY: Oxidative stress induced apoptosis plays an important role in the pathogenesis of cell injury during AFB1 exposure. In this test, defensive effect of beta-carotene was investigated in opposition to apoptosis induced by AFB1 in MDCK cells. We found increased level of LPO in AFB1 group which intimately resulted in increased level of caspase-3 activity and decreased in GSH level. The level of GSH (an antioxidant) was significantly decreased in AFB1 group as compare to controls.

Activity of Caspase-3 (an apoptotic marker) was absolutely interrelated with LPO whereas negatively interrelated with GSH in AFB1 treated MDCK cells. Additionally, Bcl-2 mRNA was considerably declined in AFB1 treated group. Caspase-3 activity levels and LPO were considerably decreased while the levels of GSH were significantly elevated in AFB1+beta-carotene group in contrast to the group treated only with AFB1.

It was concluded that, AFB1 was responsible for apoptosis because of interruption in oxidant/antioxidant equilibrium. Beta-carotene is an effective agent which normalize the impaired antioxidants status, and boosts the intensity of antioxidants.

KEY WORDS: Aflatoxin B1, Bcl-2, Beta- carotene, Caspase-3, MDCK cells.

INTRODUCTION

Beta-carotene(BC) is a plant origin colored pigment and is a source of vitamin- A [1]. It is a radical scavenger [2, 3] and is an important sequence breaking antioxidant which inhibits lipid peroxidation by reducing singlet oxygen [4].

As compared to other antioxidative agents which prevent the establishment of lipid peroxidation, beta-carotene traps free radicals and thus stop chain reaction.

Aflatoxins (AF) are lethal secondary metabolites formed as a result of infestation of food by the Aspergillus species. A large number of foods are contaminated by AFB1 and produce various harmful effects on human and animal health. [5]. Most important style of its action is oxidative stress results the damage to DNA, proteins and lipids, also it can cause disturbance in calcium metabolism, and damage to mitochondria. [6].

Aflatoxin is responsible for increased oxidative stress and DNA fragmentation which can stimulate programmed cell death [7]. Oxidative stress is responsible for aging, degenerative diseases leading to cancer. There is a strong requirement to develop the ways to reduce unwanted effects of oxidative stress through free radical scavenger. Supplementation of food with antioxidant agents is helpful for proper cure against aflatoxicosis.

Therefore the use of vitamins as antioxidants can alleviate the signs related to oxidative stress and normalize the intensity of antioxidative enzymes. Nutritional therapy with antioxidant agents can therefore be a significant tool in aflatoxicosis. In this situation, the intake of antioxidant agents as feed additives is considered as indicators of good eating practice and a healthy way of life (George et al., 2004). The aim of current study was to observe the intensity of caspase-3, lipid peroxidation Bcl-2 mRNA, and Glutathione, in MDCK cell lysates after the treatment through AFB1 and the protection exerted through beta-carotene.

Besides this, the correlation among caspase-3 activity, Bcl-2 mRNA and indicators of oxidative stress was also evaluated in the group treated with AFB1. It was assumed that AFB1 could be responsible for oxidative stress related apoptosis in MDCK cells and the beta-carotene may act as regulator of cellular pathways involved in apoptosis by adjusting ROS production within the cells. For analysis of the assumption, the effects of different concentrations of beta-carotene on AFB1 treated MDCK cells was tested. To measure the oxidative stress different parameters like mRNA level of Bcl-2, caspase-3 activity in MDCK cells after beta carotene or beta carotene+AFB1 treatment were checked. Cytopathological alterations stimulated by these processes were also investigated through the staining of MDCK cells with haematoxylin and eosin.

MATERIAL AND METHODS

Chemicals

Chemicals, reagents, and reagent kits used in the current work were acquired from Sigma-Aldrich USA, NJBI and KeyGENBioTECH China. All chemicals were of analytical grade.

Cell culture

T-25 cell culture flasks were used to culture the monolayer of MDCK cells. The cells were supplemented with Dulbecco's Modified Eagle's Medium, mixture of penicillin and streptomycin and 10% fetal calf serum. The cells were passaged every three days during which humidified atmosphere was maintained with 37C temperature and 5% CO2.

Beta-carotene treatments and cell viability assay

The cells at concentration of 1.2x103 were cultured in 96-well plate. After 24 hours various concentrations of beta-carotene were added to the cells and were cultured for 24 or 48 hours to determine appropriate dosage of beta-carotene. At the end of experimental period, 20ul MTT was added to every well and the plates were agitated on a shaker for five minutes. The absorbance of purple formazan crystals were measured on the wavelength 490nm/630nm.

Protective effect of beta-carotene against AFB1

To estimate the defensive effect of beta-carotene towards AFB1 induced cytotoxicity, MDCK cells were incubated with the beta-carotene for 24 hours. After the replacement of media containing 0.25 ug/ ml AFB1, the cells were further incubated for 48 hour. Cell viability was measured with MTT assay.

Cytopathological examination

MDCK cells at the concentration of 1x105 were cultured on glass cover slips coated with Poly-L-Lysine, and were treated with beta-carotene and aflatoxin as illustrated in the above section. the slides were then fixed for 20 minutes with 95% ethanol on room temperature, and were examined under microscope after staining with H and E [8].

Preparation of cell lysates

In six wells plate, the cells were cultured either with only beta-carotene or beta-carotene +Aflatoxin B1 as described above. Upon confluence, the cells were harvested with 300ul of PBS. The mixture was sonicated on ice and the supernatants were collected in 1.5 ml Eppendroff tubes after centrifugation for 15minutes at 4C at the speed of 12000xg. The supernatant was then used for the determination of MDA, GSH and caspase-3 activity.

Intracellular MDA and GSH assay

Intracellular MDA and GSH were calculated through spectrophotometer as described by [9, 10]. The results were corrected for total protein concentration and expressed as nanomoles per milligram protein.

Caspase-3-activity

Commercially available kit from KeyGENBioTECH China was used to measure the activity of caspases-3. Briefly, the cells were homogenized with lysis buffer and the lysates were centrifuged at 4C under 10,000 g speeds for 1 minute. The supernatants were mixed with 5ul caspase-3 substrate (Ac- DEVDpNA)(2 mM) and were incubated for 4 hours at 37 C. Measurement was teken with the help of spectrofluorometer at the wavelength of 405 nm.

Bcl-2 mRNA quantification

Total RNA was removed from MDCK cells by means of Trizol (Invitrogen) as described by company. Possible contamination of DNA was eliminated by the use of DNA- Free kit (TAKARA BIO INC.) and the quality of RNA was assessed through spectrophotometer (A260/A280). First- strand cDNA was Produced from 2 ug of total RNA by means of oligo (dT) primers and reverse transcriptase M- MLV (TAKARA BIO INC.) as described by manufacturer.

The cDNA was diluted 10 times in DNase free water and preserved at the temperature of -20C. ABI-Prism7300 detection system (Applied Biosystems) was used to perform qPCR. The experiment was performed in a 25 ul reaction mixture including 2x SYBR Green I PCR Master Mix (12.5ul), cDNA (10 ul), 1 ul of each primer (10 uM), andPCR- grade water (0.5ul).

The primer series is given in Table 1. The program of qRT-PCR was planned on 95 C step for 30s followed by 40 cycles consisting of 95 C for 5s and 60 C for 31 seconds. A dissociation curve (DC) was carried out for each plate to verify the creation of a single product. By using GAPDH as the reference gene, the mRNA altitude of Bcl-2 genes was resolved through (DCt) method, through the deduction of average DCt of the sample from the DCt of the control the DDCt values were calculated and were converted to fold difference by raising 2 to the power DDCt (2^DDCt).

Table 1.

###Canine###Accession###Oligos(5-3)###Product size

###Genes###number###(bp)

###F:CATGCCAAGAGGGAAACACCAGA

###Bcl-2###NM 001002949###76

###R:GTGCTTTGCATTCTTGGATGAGGG

###F: GTGATGCTGGTGCTGAGTATGT

###GAPDH###NM_001003142.1###233

###R:ATGGATGACTTTGGCTAGAGGA

STATISTICAL ANALYSIS

The collected data were expressed by mean S.E.M. The groups are compared by one way ANOVA, and the difference between groups was compared by Duncan test. Significant level was accepted as Pless than 0.05.

RESULTS

Protective effect of beta-carotene

To evaluate is there any beneficial effect of beta-carotene on MDCK cells, the cell were grown for either 24h or 48h with different concentrations of beta-carotene. According to Fig. 1 (a and b), 0.1uM of beta-carotene has shown significant protection for MDCK cells. Considerable reduction in cell viability was observed from 1uM concentration. The trend of protection for both 24 and 48 hours were same hence we can say there is no effect of time duration on the protective effect.

Protective effect of beta-carotene against AFB1 induced toxicity

To estimate the defensive role of beta-carotene in opposition to AFB1 toxicity; five different doses of beta-carotene were used along with IC50 dose of AFB1. In Fig. 2 it could be observed that beta-carotene protected the cells from toxin and greatest protection was found at the concentration of 0.4 uM.

Cytopathological examination

Reductions in cell number, uneven shape and loss of cell-to- cell connection were observed in the culture group treated with AFB1 (Fig. 3). Pretreatment with beta-carotene reduced apoptotic changes and improved cell number. Concentration ranges between 0.4-0.8 uM showed better protection. In beta- carotene group the number of cells and their morphology was better than the control group.

Effect of AFB1 and beta-carotene on MDA release

In contrast to the control group, the MDA level (an apoptotic marker) was extensively increased in the toxin group (Fig. 4). Treatment of cells with beta-carotene protected against stress and the level of MDA remained in the same range as in control group. Addition of beta-carotene within the cells before AFB1 caused a considerable * (Pless than 0.05.) decrease in MDA intensity as compared to toxin group.

Effect of AFB1 and beta-carotene on intracellular GSH

For the estimation of redox tone in MDCK cells after treatment with AFB1 and beta-carotene the level of GSH was measured. A considerable reduction in GSH level was observed in toxin group as compared to control. Beta-carotene caused considerable increase in the level of GSH and its administration before toxin improved the GSH level as compared to toxin group (Fig. 5).

Caspase-3-activity

The activity of Caspase-3 in MDCK cells following AFB1 and beta-carotene is described in Fig. 6. It could be seen that the activity of caspase-3 significantly increased with AFB1 treatment. Pre-treatment of the cells with beta-carotene could recovered antioxidant status which consequently diminished the apoptotic rate and extensively decrease caspase-3 activity as compared to the toxin group.

Bcl2 mRNA quantification

For the analysis of molecular pathways involved in the protection of AFB1 induced apoptosis through beta-carotene, mRNA level of an apoptosis blocking protein Bcl-2 was investigated. It was observed Bcl-2 mRNA decreased in AFB1 group as compared to control (Fig. 7). Pre-treatment of cells with beta-carotene for 24 hours protected from the effects of oxidative stress on Bcl-2, it was observed that mRNA level of Bcl-2was in similar range as in control group.

DISCUSSION

In this study we calculated the oxidative stress prospective of AFB1 and the resulting apoptosis and its possible protection through beta-carotene in kidney cell culture model. We established that with the treatment of AFB1 the level of antioxidative enzymes like GSH decreased which result the decrease in cell viability, meanwhile the level of MDA which is an oxidative stress parameter were considerably increased through AFB1 treatment. Due to these changes the cells develop apoptosis and a significant alteration in apoptotic markers was observed, increase in caspase-3 activity and decrease in Bcl-2 mRNA occurred in the cells treated with AFB1. These findings were also supported through histopathological findings. Treatment with beta-carotene can reverse the changes associated with oxidative stress and notably improves cell viability. From our work it could be suggested that beta- carotene act as a potential antioxidative agent which could improve AFB1 induced oxidative stress resulting apoptosis.

To estimate the protective effect of beta-carotene on the cell viability, different doses of beta-carotene were tested on MDCK cell through 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyl tetrazolium bromide (MTT) assay for either 24 or 48 hours. The dose ranges from 0.05uM to 0.8uM were safe for the cells of 24 h and 48 h experimental groups. Maximum boost in cell viability was noted at 0.1uM of beta-carotene. Hence from our experimental group the dose ranges from0.05uM to 0.8uM were used in opposition to the IC50 dose of AFB1, which was based on our previous study [11]. The outcome of this study showed that beta-carotene significantly sheltered the cells from cytotoxicity induced by AFB1.

MDA is the major lipid peroxide and is considered as a powerful indicator for oxidative stress [12]. In current experiment, AFB1 treatment significantly increased MDA levels in MDCK cells in contrast to the control cells.

A significant increase in MDA was possibly the consequence of AFB1 stimulated cytotoxicity and dropping the ability of cellular defense system to manage the production of elevated level of free radicals. Free radicals cause lipid peroxidation in the cell membrane thus cause elevation of MDA level [13]. These results are in accordance with earlier studies [14, 15], where by lipid peroxidation significantly increased within the rats treated with AFB1. In our experiment it was found that Pre-treatment of the cells with Beta-carotene significantly reduces TBARS concentration in AFB1 group. This was possibly due to the structure of beta-carotene containing several double bonds associated with plasmatic membrane; hence it could decrease neighboring lipid peroxidation and control oxidative stress.

Additionally this effect was also achieved in supplemented control group which made Beta- carotene a potential tool for the treatment as well as prevention of pathologies related to oxidative stress. These results are in accordance with [16] who observed that APAP related production of MDA was significantly decreased within the rats treated with beta-carotene.

As a result of lipid peroxidation, the intensity of free radicals reaches at saturation level [17]. GSH-Px is a group of enzymes which defend the body from these destructive radicals and initiate a reaction which eliminate hydrogen peroxides through reduced glutathione. It protect the cell membranes from the injury through lipid peroxidation [18].

An important intracellular thiol Glutathione peroxidase does not only decompose H2O2 but also could work together with lipid peroxidation [19]. A significant reduction in the level of GSH was observed in AFB1 supplemented group during our study. In our experiment 0.25 ug/ml toxin caused a significant reduction in the GSH level of MDCK cells, which was probably the result of lipid peroxidation due to AFB1. Pre-treatment of the cells through beta-carotene cause a significant reduction in lipid peroxidation and the level of GSH reach at the level near to the normal healthy cells. These results are in accordance to [14] who observed that beta- carotene stabilized GSH in male Wistar rats treated with AFB1.

Shape and structural changes due to DNA fragmentation and denaturation is the result of oxidative stress which can mediate a signal responsible for the beginning of apoptosis [9]. Decrease in cell number, shrinkage of cells, fragmentation DNA and cytoplasm along with the congestion of nucleus was observed in our experimental group treated with AFB1. A significant improvement in the number and morphology of cells was observed in the toxin group pre- treated with beta-carotene. Defensive property of beta- carotene against apoptosis was in accordance with [20], who achieved 50% protection within 2 hours and 35% within 4 hours treatment with 50 uM beta-carotene, whereas with 100 uM higher protection was observed at 4 hours treatment.

The caspases as a novel group of 10 cysteine proteases are the major enzymes involved in the process of apoptosis [21] and are responsible for execution of apoptosis [22]. It has been suggested that ROS act as a second messenger and are capable to activate caspases [23]. Caspase-3 is an enzyme responsible for the control of DNA break down and structural changes associated with apoptosis [24], hence the immunostaining of active caspases-3 is extremely sensitive method useful to illustrate different locations for caspases-3 activation during the transformation of protein within cytoplasm and nucleus [25]. Our results confirmed that in AFB1 treated cells reactive oxygen species increased extensively within the cell and resulted apoptosis, and increased the activity of caspase-3.

Elevation in the activity of caspase-3 following AFB1 confirmed the findings of others [26, 27] who found that the activity of caspase-3 increased in the liver of rats after the treatment of AFB1. Pre-treatment through beta-carotene showed significant protection towards AFB1 treated MDCK cells and reduced the activity of caspase-3 and protected from apoptosis.

These findings are in accordance with [20] who found that the beta- carotene blocked the mitochondrial permeability transition (MPT) and decreased the activation of Caspase 3. Bcl-2 is the group of proteins which together with caspases plays an important part in modulating apoptosis [28]. It is responsible to stop intracellular oxidation through declining the formation of reactive oxygen species, hence control cell death [29]. Its anti-apoptotic effect was mediated by preventing the release of cytochrome c from mitochondria resulting their activation [30]. Various in-vitro as well as in- vivo studies demonstrated that over-expression of Bcl-2 defends the cells and animals from apoptosis and if there is any interference in bcl-2 function, it could predispose the cells towards apoptosis [31-33].

A considerable decrease in Bcl-2 mRNA following AFB1 treatment was noted in our study which is in agreement with [34], where 7-21 days administration of AFB1 to broilers significantly (p less than 0.01) decreased the expression of Bcl-2 in thymus tissue.

ACKNOWLEDGEMENT

This work is supported by Higher Education Commission (HEC) of Pakistan under the project "Strengthening and Development of Sindh Agriculture University Tandojam".

CONFLICT OF INTEREST

No conflict of interest exits in the submission of this manuscript.

REFERENCES

1. Peto, R., et al., Can dietary beta-carotene materially reduce human cancer rates? Nature, 290(5803): p. 201-8. (1981).

2. Olson, J.A., Benefits and liabilities of vitamin A and carotenoids. J Nutr, 126(4 Suppl): p. 1208S-12S. (1996).

3. Hojo, Y., et al., Direct evidence for in vivo hydroxyl radical generation in blood of mice after acute chromium(VI) intake: electron spin resonance spin- trapping investigation. Biol Trace Elem Res, 76(1): p. 75-84. (2000).

4. Krinsky, N.I., Effects of carotenoids in cellular and animal systems. Am J Clin Nutr, 53(1 Suppl): p. 238S-246S. (1991).

5. Kobayashi, T., et al., Genomics of Aspergillus oryzae. Bioscience Biotechnology and Biochemistry, 71(3): p. 646. (2007).

6. Souza, M., A. Tome, and V. Rao, Inhibition by the Bioflavonoid Ternatin of Aflatoxin B1-induced Lipid Peroxidation in Rat Liver. Journal of pharmacy and pharmacology, 51(2): p. 125-129. (1999).

7. Schindowski, K., et al., Age-related changes of apoptotic cell death in human lymphocytes. Neurobiol Aging, 21(5): p. 661-70. (2000).

8. Zhu, L., et al., Expression of heat shock protein 60 in the tissues of transported piglets. Cell Stress Chaperones, 14(1): p. 61-9. (2009).

9. Sivanesan, D. and V.H. Begum, Preventive role of Gynandropsis gynandra L., against aflatoxin B1 induced lipid peroxidation and antioxidant defense mechanism in rat. Indian J Exp Biol, 45(3): p. 299-303. (2007).

10. Arthur, J., The glutathione peroxidases. Cellular and Molecular Life Sciences CMLS, 57(13-14): p. 1825- 1835. (2001).

11. Parveen, F., et al., Protective effect of selenomethionine on aflatoxin B1-induced oxidative stress in MDCK cells. Biol Trace Elem Res, 157(3): p. 266-74. (2014).

12. Draper, H.H. and M. Hadley, A review of recent studies on the metabolism of exogenous and endogenous malondialdehyde. Xenobiotica, 20(9): p. 901-7. (1990).

13. Eraslan, G., et al., The antioxidant effects of pumpkin seed oil on subacute aflatoxin poisoning in mice. Environmental Toxicology, (2011).

14. Kheir Eldin, A.A., T.M. Motawi, and N.A. Sadik, Effect of some natural antioxidants on aflatoxin B1- induced hepatic toxicity. (2008).

15. Meki, A.-R.M., S.K. Abdel-Ghaffar, and I. El- Gibaly, Aflatoxin B1 induces apoptosis in rat liver: protective effect of melatonin. Neuroendocrinology Letters, 22(6): p. 417-426. (2001).

16. Morakinyo, A., et al., Anti-oxidative and hepatoprotective effect of beta-carotene on acetaminophen-induced liver damage in rats. Biology and Medicine, 4(3). (2012).

17. Sivanesan, D. and V.H. Begum, Preventive role of Gynandropsis gynandra L., against aflatoxin B~ 1 induced lipid peroxidation and antioxidant defense mechanism in rat. Indian journal of experimental biology, 45(3): p. 299. (2007).

18. Verma, R., Aflatoxin cause DNA damage. International Journal of Human Genetics, 4(4): p. 231. (2004).

19. Venkateswaran, P., I. Millman, and B. Blumberg, Effects of an extract from Phyllanthus niruri on hepatitis B and woodchuck hepatitis viruses: in vitro and in vivo studies. Proceedings of the National Academy of Sciences, 84(1): p. 274-278. (1987).

20. Gumpricht, E., et al., Beta-carotene prevents bile acid-induced cytotoxicity in the rat hepatocyte: Evidence for an antioxidant and anti-apoptotic role of beta-carotene in vitro. Pediatr Res, 55(5): p. 814- 21. (2004).

21. Cohen, G.M., Caspases: the executioners of apoptosis. Biochem J, 326 ( Pt 1): p. 1-16. (1997).

22. Holubec, H., et al., Assessment of apoptosis by immunohistochemical markers compared to cellular morphology in ex vivo-stressed colonic mucosa. J Histochem Cytochem, 53(2): p. 229-35. (2005).

23. Hampton, M.B. and S. Orrenius, Dual regulation of caspase activity by hydrogen peroxide: implications for apoptosis. FEBS Lett, 414(3): p. 552-6. (1997).

24. Slee, E.A., C. Adrain, and S.J. Martin, Executioner caspase-3, -6, and -7 perform distinct, non- redundant roles during the demolition phase of apoptosis. J Biol Chem, 276(10): p. 7320-6. (2001).

25. Bressenot, A., et al., Assessment of apoptosis by immunohistochemistry to active caspase-3, active caspase-7, or cleaved PARP in monolayer cells and spheroid and subcutaneous xenografts of human carcinoma. J Histochem Cytochem, 57(4): p. 289- 300. (2009).

26. Meki, A.R., S.K. Abdel-Ghaffar, and I. El-Gibaly, Aflatoxin B1 induces apoptosis in rat liver: protective effect of melatonin. Neuro Endocrinol Lett,. 22(6): p. 417-26. (2001)

27. Meki, A.R., et al., Caspase-3 and heat shock protein-70 in rat liver treated with aflatoxin B1: effect of melatonin. Toxicon, 43(1): p. 93-100. (2004).

28. Kirkin, V., S. Joos, and M. Zornig, The role of Bcl-2 family members in tumorigenesis. Biochim Biophys Acta, 1644(2-3): p. 229-49. (2004).

29. Kane, D.J., et al., Bcl-2 inhibition of neural death: decreased generation of reactive oxygen species. Science, 262(5137): p. 1274-7. (1993).

30. Petros, A.M., E.T. Olejniczak, and S.W. Fesik, Structural biology of the Bcl-2 family of proteins. Biochim Biophys Acta, 1644(2-3): p. 83-94. (2004).

31. Vaux, D.L., Toward an understanding of the molecular mechanisms of physiological cell death. Proc Natl Acad Sci U S A, 90(3): p. 786-9. (1993).

32. Nunez, G., et al., Deregulated Bcl-2 gene expression selectively prolongs survival of growth factor- deprived hemopoietic cell lines. J Immunol, 144(9): p. 3602-10. (1990).

33. Bissonnette, R.P., et al., Apoptotic cell death induced by c-myc is inhibited by bcl-2. Nature, 359(6395): p. 552-4. (1992).

34. Chen, K., et al., Protective role of sodium selenite on histopathological lesions, decreased T-cell subsets and increased apoptosis of thymus in broilers intoxicated with aflatoxin B(1). Food Chem Toxicol, 59: p. 446-54.(2013).
COPYRIGHT 2016 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Science International
Article Type:Report
Date:Aug 31, 2016
Words:4145
Previous Article:STATUS OF SERUM 25-HYDROXY VITAMIN D IN PATIENTS WITH GASTRO INTESTINAL TRACT CANCER.
Next Article:DESIGN AND DEVELOPMENT OF A PROGRAMMABLE LOGIC CONTROLLER BASED INDUSTRIAL ROBOT FOR SORTING ITEM BOXES.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |