Printer Friendly

Association of interleukin-18 gene polymorphism with Susceptibility to visceral leishmaniasis in endemic Area of Bihar, an Indian population.

1. Introduction

Visceral leishmaniasis (VL) is a potentially fatal infectious disease caused by the intracellular protozoan parasites Leishmania donovani and Leishmania infantum (chagasi). VL is responsible for significant morbidity and mortality in the Indian subcontinent and Brazil. The secondary infections, responsible for many deaths maybe due to the immunocompromised status of VL patients. The mechanisms preventing clearance of the infection and underlying the predisposition of VL patients to secondary infections are not well known.

A key immunological feature of VL is the inability of peripheral blood mononuclear cells (PBMCs) to proliferate or to produce interferon-[gamma] (IFN-[gamma]) in response to leishmanial antigens [1, 2]. Interleukin-18 (IL-18) is a member of the IL-1 cytokine family and plays an important role in both kinds of immunity, innate and acquired. Initially it was characterized by its capacity to promote Th1 responses in synergy with IL12 [3]. Th1-type immunity triggers enhanced leishmanicidal activity in infected macrophages, thus playing a protective role. IL-18 has been described for broader properties in the acquired immune responses. It was shown to induce proliferation of T-cell, IL-12R[alpha] expression, IFN-[gamma], TNF-[alpha], and GM-CSF production by Th1 clones [4]. However, at early stages of T cell differentiation, IL-18 can promote either Th1 or Th2 responses independently of IL-4 or IL-12, suggesting its broader role in functional T cell differentiation [5].

IL-18 also was shown to induce IFN-[gamma] production by NK cells, suggesting its involvement in the innate responses [6]. After exposure to IFN-[gamma], intracellular killing in macrophages involves mono-xidative mechanisms through the generation of nitric oxide and its metabolites from L-arginine in presence of nitric oxide synthase [7]. Previous studies demonstrated that IL18 upregulates the expression of intracellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) on the endothelial cells that play important role in inflammation process [8].

Several studies in other disease models have shown the association of differential plasma level of IL-18 with the single nucleotide polymorphisms (SNPs) in its encoding region [9-11]. Such studies clearly point towards possibility of the gene polymorphisms in affecting susceptibility or protection towards the same disease in different individuals [12-14]. Recently, Moravej et al. has found the association of IL-18 gene polymorphism with VL in Iranian population [15]. The importance of IL-18 in the defence against VL and the effect of gene polymorphism on its production in other diseases inspired us to investigate the probable association between IL-18 gene polymorphism and VL disease susceptibility in Indian population.

2. Materials and Methods

2.1. Subjects. A total of 471 subjects were enrolled for the study. 204 parasitologically confirmed VL patients were admitted at Kala-Azar Medical Research Centre in Muzaffarpur, Bihar. Characteristics of all the subjects are shown in Table 1. The inclusion criteria included subjects aged more than two years with sign and symptoms of VL and confirmed by microscopic identification of parasite in their splenic biopsies. Healthy controls were the subjects living in the endemic area with no history of VL, aged more than 18 years and also with negative serology.

The study was approved by the Ethical Committee of the Institute of Medical Sciences, Banaras Hindu University, Varanasi. Written informed consents were obtained from all participating subjects.

2.2. Sample Collection and Storage. Peripheral blood was drawn from each subject and collected in citrate vacutainers (BD Biosciences) and stored at 4[degrees]C until DNA isolation. 5 mL blood was drawn from 13 cases and 13 controls for isolation of PBMC and stored in RNAlater (Qiagen, Hilden) at -80[degrees]C until RNA extraction.

2.3. DNA and RNA Extraction. DNA was isolated from 200 [micro]L peripheral blood using QIAamp Blood DNA mini kit (Qiagen) while RNA was isolated from PBMC using RNeasy mini kit (Qiagen, Hilden) as per the manufacturer's protocol. All the samples were quantified using NanoDrop 2000c and aliquoted in triplicate to avoid damage during repeated freeze thawing and stored.

2.4. IL-18 Expression Study. 1 pg RNA was isolated from PBMC, was reverse transcribed in a 20 [micro]L reaction using High Capacity cDNA Reverse Transcription Kit (Invitrogen USA), and was diluted 10 times with RNase free water for final concentration of 5 ng/[micro]L. TaqMan gene expression assays (Applied Biosystems USA) for IL-18 (Hs01038788) were used to perform expression studies with 18S rRNA (P/N 4319413E) used as an endogenous control and run on 7500 Real-Time PCR System (Applied Biosystems USA). All samples were run in duplicate along with no template master mix as negative controls in each plate. Results were analysed by 7500 software v.2.0.1 (Applied Biosystems) and Graph pad prism 5. Unpaired two-tailed t-tests were used to compare IL-18 expression level in cases and controls.

2.5. Genotyping. PCR-RFLP based method was used to detect polymorphism in IL-18 gene. Three SNPs, rs1946519 (-656 G/T) and rs187238 (-137 G/C) of promoter region and rs549908 (+105 A/C) of codon region, were selected for the study. For each polymorphism, a specific PCR-RFLP was done using method described previously [13] with few modifications (Table 2). PCR was performed in 25 [micro]L reaction mixture using 100 ng genomic DNA with 1.5 U Taq DNA polymerase (New England Bio labs, UK) supplemented with 10X Taq DNA polymerase buffer, 1.5 mM Mg[Cl.sub.2], 25 [micro]M dNTPs, and 10 pM of forward and reverse primers. Each amplified product was digested by specific restriction enzymes (Fermentas) and electrophoresed on a 3% (w/v) ethidium bromide (Merck, Mumbai) stained agarose gel (Sigma-Aldrich, St. Louis, USA) and visualised on UV transilluminator.

2.6. Statistical Analysis. Allele and genotype frequencies of three SNPs were estimated by observing the digested fragments. All the data was entered into EPI info 2,000. [chi square] test, odds ratio, and 95% confidence interval were calculated by GraphPad prism 5 and SPSS software version 16. SNPStats software was used to estimate the haplotypes frequencies and Hardy-Weinberg equilibrium. The P values < 0.0015 were considered as statistically significant after Bonferroni correction for multiple tests. The linkage disequilibrium (LD) measurings, [R.sup.2] and D', were estimated by LD2SNPing program V 2.0 (http://bio.kuas.edu.tw/LD2SNPing/).

3. Results and Discussion

Quantitative real-time RT-PCR was done to observe expression level of IL-18 in PBMC collected from 13 patients and 13 controls and it was found significantly upregulated in controls (P < 0.0377) (Figure 1).

PCR-RFLP methods were used to analyse the IL-18 gene SNPs and the electrophoretic pattern was shown in Figure 2.

The frequency of G allele at position -656 was found significantly higher in the control group as compared to cases (70.60 versus 56.86%, P < 0.0001, OR = 0.549, 95% CI = 0.419-0.719 and study power 99.2%), while frequency of G allele at -137 was found significantly higher in cases (78.19 versus 71.91% P = 0.02, OR = 1.40, 95% CI = 1.03-1.89 and study power 59.42%). At position +105 both A and C alleles were equally distributed in cases and controls (76.03%, P = 0.80, OR = 1.03, 95% CI = 0.76-1.40 and study power 3.70%). The distributions of genotypes were according to the Hardy-Weinberg equilibrium.

At the position -656 the TT genotype frequency was significantly higher in cases while at other positions -137 and +105 no significant difference was found between cases and controls. The genotypes -656 GG, -137 GG, +105 AA were frequently distributed in both cases and controls (Table 3). The distribution of haplotypes in IL-18 polymorphism showed that the frequency of GGA at positions -656, -137, and +105 was higher in control (38.31%, P = 0.23, OR = 0.792, 95% CI = 0.54-1.161 and study power 22.12%). GGA haplotypes were the most frequently distributed in all the subjects, while haplotypes TGA were higher in cases (28.33 versus 14.49%, P = 0.0002, OR = 2.30, 95% CI = 1.47-3.68 and study power 95.52%).

32 double haplotypes were constructed in the present study. The frequencies of the commonly distributed haplogenotypes were shown in Table 4 and those haplotypes having frequencies less than 5% were omitted from the table. The distribution of TGA/GGA haplogenotypes was found to be higher in cases (18.63 versus 11.24%, P = 0.02, OR = 1.80, 95% CI = 1.07-3.03 and study power 61.58%), but the P value could not tolerate Bonferroni correction. The haplogenotypes GGC/GGA were found more frequently distributed in controls (11.16 versus 6.37%, P = 0.05, OR = 0.05, 95% CI = 0.26-1.08 and study power 49.03%).

The strong LDs were detected between all SNPs in both controls and cases (Figures 3 and 4).

IL-18 has been classified in the IL-1 family in virtue of structural similarity to IL-1[beta]. Its ability to induce IFN-[gamma] from Th1 and NK cell separates it from IL-1. Thus IL18 was originally identified as an IFN-[gamma] inducing factors. Some studies revealed that IL-18 induces the production of Th2 cytokines from T-cell, NK cell, basophiles, and mast cells [16-20]. Moreover, IL-18 can directly enhance the proliferation and cytotoxicity of Tc cell and NK cell [21-24]. Thus IL-18 is a pleotropic cytokine which regulates both natural and acquired immune response. The major source is macrophages, although many other are also capable of producing IL-18 [25, 26].

Although the production of IL-18 is affected by many factors, it could also be affected by genetic variants in its promoter region. It is tempting to speculate that polymorphisms in the IL-18 promoter could affect its expression. Changes in IL-18 expression levels might disturb the balance between Th1 and Th2 cytokine responses.

Considering the involvement of IL-18 in affecting the course of infection, investigating the common genetic variants in IL-18 gene could provide important genetic determinants of VL. This can lead to new immune-based therapies by targeting cytokine signalling pathways. Taking the role of IL-18 in VL pathogenesis and the effect of known polymorphisms in the promoter region in affecting its expression levels, we wanted to investigate the relationship between IL-18 gene variants and susceptibility and/or protection to Leishmania infection in North Indian population.

Previously studies revealed that the higher production of IL-18 and IFN-[gamma] is associated with the presence of nucleotides G and A at the positions -137 and +105, respectively [9-11]. So we assumed that these alleles must be more frequent in control group as compared to VL cases, but we did not get any significant differences in the distribution of these alleles between cases and controls. Contrary to the two aforementioned polymorphic sites, the frequency of G allele at the position -656 was significantly higher in controls than the cases. Thus, G allele at -656 could be considered as a protective factor for the VL in our population.

In addition to the genotypes and alleles, inherited combination of SNPs and polymorphic haplotypes can influence predisposition to different diseases. The frequency of haplotypes GGA was higher in controls, while frequency of TGA was significantly higher in cases of VL. The inheritance of GGC/GGA haplotypes was significantly distributed in control (P < 0.052), while TGA/GGA was more frequent in cases (P < 0.02). It can be supposed that the inheritance of TGA/GGA haplogenotypes might be major genetic risk factor for the occurrence of VL.

Previously, other published reports revealed association of IL-18 gene polymorphisms with susceptibility to VL in Iranian population, with different allele [15]. Because of population specific differences in allele and disease frequency, the genetic associations become more meaningful when replicated in varied ethnic populations. Likewise, several studies have reported the association of IL-18 gene variants and susceptibility to infectious and noninfectious diseases like Brucella infection [27], HBV infection [28], type-1 diabetes [29], periodontitis [13].

4. Conclusion

The frequency of G allele at position -656 (rs1946519) was significantly associated with protection to VL in our north eastern population. Thus presence of G allele at position -656 can be considered as a potential candidate as protective allele for VL.

http://dx.doi.org/10.1155/2014/852104

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

Authors' Contribution

Dinesh Kumar, Puja Tiwary, and Jaya Chakravarty conceived, designed, and performed the experiments; Dinesh Kumar, Puja Tiwary, and Jaya Chakravarty analyzed the data; Shyam Sundar contributed reagents/materials/analysis tools; and Dinesh Kumar and Puja Tiwary wrote the paper. All of the authors read and approved the final paper.

Acknowledgments

The authors would like to thank all the staff of Kala Azar Medical Research Centre (KAMRC), a unit of Sitaram Memorial Trust, for their assistance in collection of samples used in this study. This work was supported by NIAID, NIH Grant no. 1P50AI074321. Dinesh Kumar and Puja Tiwary want to thank Council of Scientific and Industrial Research (CSIR), New Delhi, India, for providing fellowships.

References

[1] D. L. Sacks, S. L. Lal, S. N. Shrivastava, J. Blackwell, and F. A. Neva, "An analysis of T cell responsiveness in Indian Kala-azar," The Journal of Immunology, vol. 138, no. 3, pp. 908-913, 1987

[2] A. C. White Jr., M. Castes, L. Garcia, D. Trujillo, and L. Zambrano, "Leishmania chagasi antigens recognized in cured visceral leishmaniasis and asymptomatic infection," American Journal of Tropical Medicine and Hygiene, vol. 46, no. 2, pp. 123-131, 1992.

[3] M. Munder, M. Mallo, K. Eichmann, and M. Modolell, "Murine macrophages secrete interferon y upon combined stimulation with interleukin (IL)-12 and IL-18: a novel pathway of autocrine macrophage activation," The Journal of Experimental Medicine, vol. 187, no. 12, pp. 2103-2108, 1998.

[4] H. Okamura, S.-I. Kashiwamura, H. Tsutsui, T Yoshimoto, and K. Nakanishi, "Regulation of interferon-y production by IL-12 and IL-18," Current Opinion in Immunology, vol. 10, no. 3, pp. 259-264, 1998.

[5] D. Xu, V. Trajkovic, D. Hunter et al., "IL-18 induces the differentiation of Th1 or Th2 cells depending upon cytokine milieu and genetic background," European Journal of Immunology, vol. 30, no. 11, pp. 3147-3156, 2000.

[6] K. Takeda, H. Tsutsui, T Yoshimoto et al., "Defective NK cell activity and Th1 response in IL-18-deficient mice," Immunity, vol. 8, no. 3, pp. 383-390, 1998.

[7] S. J. Green, M. S. Meltzer, J. B. Hibbs Jr, and C. A. Nacy, "Activated macrophages destroy intracellular Leishmania major amastigotes by an L-arginine-dependent killing mechanism," Journal of Immunology, vol. 144, no. 1, pp. 278-283, 1990.

[8] J. C. M. Morel, C. C. Park, J. M. Woods, and A. E. Koch, "A novel role for interleukin-18 in adhesion molecule induction through NF [kappa]B and phosphatidylinositol (PI) 3-kinase-dependent signal transduction pathways," Journal of Biological Chemistry, vol. 276, no. 40, pp. 37069-37075, 2001.

[9] X. H. Liang, W. Cheung, C. K. Heng, and D. Y. Wang, "Reduced transcriptional activity in individuals with IL-18 gene variants detected from functional but not association study," Biochemical and Biophysical Research Communications, vol. 338, no. 2, pp. 736-741, 2005.

[10] V.Giedraitis, B. He, W.-X. Huang, and J. Hillert, "Cloning and mutation analysis of the human IL-18 promoter: a possible role of polymorphisms in expression regulation," Journal of Neuroimmunology, vol. 112, no. 1-2, pp. 146-152, 2001.

[11] J. Arimitsu, T Hirano, S. Higa et al., "IL-18 gene polymorphisms affect IL-18 production capability by monocytes," Biochemical and Biophysical Research Communications, vol. 342, no. 4, pp. 1413-1416, 2006.

[12] M. Kalani, M. Rasouli, A. Moravej, S. Kiany, and H. R. Rahimi, "Association of interleukin-15 single nucleotide polymorphisms with resistance to brucellosis among Iranian patients," Tissue Antigens, vol. 78, no. 5, pp. 352-358, 2011.

[13] M. Folwaczny, J. Glas, H.-P. Toroket al., "Polymorphisms of the interleukin-18 gene in periodontitis patients," Journal of Clinical Periodontology, vol. 32, no. 5, pp. 530-534, 2005.

[14] A. Moravej, M. Rasouli, M. Kalani et al., "IL-1[beta] (-511T/C) gene polymorphism not IL-1[beta] (+3953T/C) and LT-[alpha] (+252A/G) gene variants confers susceptibility to visceral leishmaniasis," Molecular Biology Reports, vol. 39, no. 6, pp. 6907-6914, 2012.

[15] A. Moravej, M. Rasouli, S. Asaei, M. Kalani, and Y. Mansoori, "Association of interleukin-18 gene variants with susceptibility to visceral leishmaniasis in Iranian population," Molecular Biology Reports, vol. 40, no. 6, pp. 4009-4014, 2013.

[16] T Yoshimoto, H. Tsutsui, K. Tominaga et al., "IL-18, although antiallergic when administered with IL-12, stimulates IL-4 and histamine release by basophils," Proceedings of the National Academy of Sciences of the United States of America, vol. 96, no. 24, pp. 13962-13966, 1999.

[17] T Yoshimoto, H. Mizutani, H. Tsutsui et al., "IL-I 8 induction of IgE: dependence on CD4+ T cells, IL-4 and STAT6," Nature Immunology, vol. 1, no. 2, pp. 132-137, 2000.

[18] T Hoshino, R. H. Wiltrout, and H. A. Young, "IL-18 is a potent coinducer of IL-13 in NK and T cells: a new potential role for IL-18 in modulating the immune response," The Journal of Immunology, vol. 162, no. 9, pp. 5070-5077, 1999.

[19] K. Nakanishi, T Yoshimoto, H. Tsutsui, and H. Okamura, "Interleukin-18 is a unique cytokine that stimulates both Th1 and Th2 responses depending on its cytokine milieu," Cytokine and Growth Factor Reviews, vol. 12, no. 1, pp. 53-72, 2001.

[20] T Hoshino, H. Yagita, J. R. Ortaldo, R. H. Wiltrout, and H. A. Young, "In vivo administration of IL-18 can induce IgE production through Th2 cytokine induction and up-regulation of CD40 ligand (CD154) expression on [CD4.sup.+] T cells," European Journal of Immunology, vol. 30, no. 7, pp. 1998-2006, 2000.

[21] M. G. Netea, B. J. Kullberg, I. Verschueren, and J. W. M. van der Meer, "Interleukin-18 induces production of proinflammatory cytokines in mice: no intermediate role for the cytokines of the tumor necrosis factor family and interleukin-1 beta," European Journal of Immunology, vol. 30, no. 10, pp. 3057-3060, 2000.

[22] C. A. Dinarello and G. Fantuzzi, "Interleukin-18 and host defense against infection," Journal of Infectious Diseases, vol. 187, no. 2, pp. S370-S384, 2003.

[23] H. Helmby and R. K. Grencis, "IL-18 regulates intestinal mastocytosis and Th2 cytokine production independently of IFN-[gamma] during Trichinella spiralis infection," The Journal of Immunology, vol. 169, no. 5, pp. 2553-2560, 2002.

[24] X.-Q. Wei, B. P Leung, H. M. L. Arthur, I. B. McInnes, and F. Y. Liew, "Reduced incidence and severity of collagen-induced arthritis in mice lacking IL-18," The Journal of Immunology, vol. 166, no. 1, pp. 517-521, 2001.

[25] K. Akita, T. Ohtsuki, Y. Nukada et al., "Involvement of caspase1 and caspase-3 in the production and processing of mature human interleukin 18 in monocytic THP1 cells," Journal of Biological Chemistry, vol. 272, no. 42, pp. 26595-26603, 1997.

[26] H. Okamura, H. Tsutsui, T Komatsu et al., "Cloning of a new cytokine that induces IFN-[gamma] production by T cells," Nature, vol. 378, no. 6552, pp. 88-91, 1995.

[27] M. Rasouli, M. Kalani, A. Moravej, and S. Kiany, "Interleukin-18 single nucleotide polymorphisms contribute to the susceptibility to brucellosis in Iranian patients," Cytokine, vol. 54, no. 3, pp. 272-276, 2011.

[28] P-A. Zhang, J.-M. Wu, Y. Li, and X.-S. Yang, "Association of polymorphisms of interleukin-18 gene promoter region with chronic hepatitis B in Chinese Han population," World Journal of Gastroenterology, vol. 11, no. 11, pp. 1594-1598, 2005.

[29] N. A. C. Tavares, M. M. S. Santos, R. Moura et al., "Interleukin 18 (IL18) gene promoter polymorphisms are associated with type 1 diabetes mellitus in Brazilian patients," Cytokine, vol. 62, no. 2, pp. 286-289, 2013.

Dinesh Kumar, Puja Tiwary, Jaya Chakravarty, and Shyam Sundar

Infectious Disease Research Laboratory, Department of Medicine, Institute of Medical Sciences, Banaras Hindu University, Varanasi, Uttar Pradesh 221 005, India

Correspondence should be addressed to Shyam Sundar; drshyamsundar@hotmail.com

Received 30 July 2014; Revised 24 September 2014; Accepted 25 September 2014; Published 22 October 2014

Academic Editor: Hidenori Ohnishi

TABLE 1: Characteristics of the subjects.

Characteristic                 Case (n = 204)    Control (n = 267)

Age (mean [+ or -] SD) (yr)    24.9 [+ or -]     35.2 [+ or -] 12.6
                                 12.1
Sex (no. males/no. females)    94/110                  124/143
Fever history (mean            45.5 [+ or -]
  [+ or -] SD) (days)            47.7
Spleen size (mean              3.80 [+ or -]
  [+ or -] SD) (cm)              1.92
HIV status                     Negative                Negative

TABLE 2: Polymerase chain reaction (PCR) primers and
condition for IL-18 gene amplification.

SNPs     PCR primers                               Annealing
                                                  temperature
                                                  ([degrees]C)

+105     F: AGATTTAATGTTTATTGTAGAAAACCTGGGACTC         55
(A/C)    R: CAGTCATATCTTCAAATAGAGGCCG

-656     F: AGGTCAGTCTTTGCTATCATTCCAGG                 60
(G/T)    R: CTGCAACAGAAAGTAAGCTTGCGGAGAGG

-137     F: CACAGAGCCCCAACTTTTTACGGCAGAGAA             60
(G/C)    R: GACTGCTGTCGGCACTCCTTGG

SNPs     Restriction     Fragment
           enzymes       sizes (bp)

+105        Dde I        A:109 + 32
(A/C)                      C: 141

-656        Mwo I        G: 96 + 24
(G/T)                      T: 120

-137        Mbo II      G: 116 + 39
(G/C)                      C: 155

TABLE 3: IL-18 genotype and alleles frequencies in
VL cases and controls.

Genotypes and     Patient    n (%)    Control    n (%)     [chi
alleles                                                   square]

+105
Genotypes
  AA                114      55.88      145      54.31     0.116
  CC                 5        2.45       6        2.25     0.021
  AC                 85      41.67      116      43.45     0.149
Alleles
  A                 313      76.72      406      76.03     0.060
  C                  95      23.28      128      23.97
-656
Genotypes
  GG                 89      43.63      133      49.81     1.776
  TT                 61      29.90       23       8.61     35.76
  GT                 54      26.47      111      41.57     11.59
Alleles
  G                 232      56.86      377      70.60      19.1
  T                 176      43.14      157      29.40
-137
Genotypes
  GG                128      62.75      136      50.94     6.546
  CC                 13       6.37       19       7.12     0.101
  GC                 63      30.88      112      41.95     6.064
Alleles
  G                 319      78.19      384      71.91     4.812
  C                  89      21.81      150      28.09

Genotypes and     P value        OR (95% CI)        Study
alleles                                             power

+105
Genotypes
  AA               0.7335    1.066 (0.739-1.538)    4.82%
  CC               0.8846    1.093 (0.329-3.633)    2.68%
  AC               0.6989    0.930 (0.643-1.345)    5.42%
Alleles
  A                0.8062    1.039 (0.767-1.407)    3.70%
  C
-656
Genotypes
  GG               0.1827    0.780 (0.541-1.125)    26.42%
  TT              <0.0001    4.525 (2.685-7.628)     100%
  GT              <0.0007    0.506 (0.341-0.751)    93.11%
Alleles
  G               <0.0001    0.549 (0.419-0.719)    99.20%
  T
-137
Genotypes
  GG               0.0105    1.622 (1.119-2.353)    72.77%
  CC               0.7507    0.888 (0.428-1.844)    4.46%
  GC               0.0138    0.618 (0.421-0.908)    69.55%
Alleles
  G                0.0283     1.40 (1.036-1.893)    59.42%
  C

TABLE 4: Frequently occurrence of IL-18 single and double
haplotypes distributions in cases and controls.

Haplotypes             Cases        Control       [chi      P value
                                                 square]

Single haplotypes
  GGA               67 (32.97)    102 (38.31)     1.444      0.2296
  TGA               58 (28.33)     39 (14.49)     13.52      0.0002
  GCA               23 (11.06)     36 (13.67)     0.5148     0.4731
  GGC                19 (9.45)     40 (14.94)      3.39      0.0656
  TCA                9 (4.35)      26 (9.56)      4.769      0.029
  TGC                15 (7.43)     11 (4.17)      2.318      0.1279
  GCC                7 (3.38)      10 (3.68)     0.03276     0.8564
  TCC                6 (3.02)       3 (1.18)      2.038      0.1534
Double haplotypes
  GGA/GGA           22 (10.78)     39 (14.61)      1.49       0.22
  TGA/GGA           38 (18.63)     30 (11.24)      5.11       0.02
  GCA/GGA            15 (7.35)     28 (10.49)      1.36      0.242
  GGC/GGA            13 (6.37)     31 (11.61)      3.74      0.052

Haplotypes               OR (95% CI)        Study
                                             power

Single haplotypes
  GGA                0.792 (0.54-1.161)     22.12%
  TGA                2.333 (1.477-3.684)    95.52%
  GCA                0.785 (0.449-1.375)    12.96%
  GGC                0.594 (0.334-1.058)    42.71%
  TCA                0.430 (0.196-0.945)    58.07%
  TGC                1.845 (0.832-4.089)    33.77%
  GCC                0.916 (0.34-2.467)      2.81%
  TCC                2.608 (0.663-10.263)   30.53%
Double haplotypes
  GGA/GGA             0.70 (0.40-1.23)      22.75%
  TGA/GGA             1.80 (1.07-3.03)      61.58%
  GCA/GGA             0.67 (0.35-1.30)      21.02%
  GGC/GGA             0.05 (0.26-1.08)      49.03%
COPYRIGHT 2014 Hindawi Limited
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Kumar, Dinesh; Tiwary, Puja; Chakravarty, Jaya; Sundar, Shyam
Publication:The Scientific World Journal
Article Type:Report
Geographic Code:9INDI
Date:Jan 1, 2014
Words:4002
Previous Article:LED context lighting system in residential areas.
Next Article:PEEP role in ICU and operating room: from pathophysiology to clinical practice.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |