Printer Friendly

Association of IS605 and CAG-PAI of Helicobacter pylori isolated from patients with gastrointestinal diseases in Taiwan.

1. Introduction

Infection with Helicobacter pylori is one of the most common bacterial infections in humans [1]. It has been closely linked with chronic gastritis, peptic ulcer, gastric carcinoma, and mucosa-associated lymphoid tissue (MALT) lymphoma [2]. The cag pathogenicity island (cag-PAI), a major determinant of H. pylori virulence, has been well studied [3, 4]. cag-PAI is an ~40-kb region in the H. pylori genome that contains a cluster of around 30 genes, including a type IV secretion system (T4SS) and the cytotoxin-associated gene A (CagA) [5]. Translocation of CagA into gastric epithelial cells requires delivery by T4SS and subsequent induction of cell signaling, which contributes to the development of pathogenesis in gastric mucosa [6].

An insertion sequence (IS) element, IS605, found in some strains disrupts an otherwise-uninterrupted cag-PAI unit, thereby splitting it into 2 regions (Figure 1). These regions, termed cag I and cag II, contain at least 14 and 16 open reading frames (orfs), respectively [7]. Insertion of IS605 between cag I and cag II generates H. pylori strains with different levels of virulence [8, 9]. Censini et al. reported that the cagA gene is closely linked to the intact cag-PAI [4]. However, the presence of the cagA gene does not guarantee the existence of an intact cag -PAI [10-12].

Diversity within cag-PAI is noted between the people belonging to the Eastern and Western hemispheres [13]. Only one-half to two-thirds of the isolates from the western world carry cag-PAI. In contrast, nearly all East Asian isolates carry cag -PAI [14,15]. Therefore, cagA and other genes comprising the cag-PAI should be individually investigated. Moreover, cag-PAI appears to be disrupted in the majority of isolates globally [14]. Partial deletion of cag -PAI has been reported in 4%-88% isolates [12-14,16]. However, the clinical relevance of strains with an intact cag-PAI remains controversial [17]. The aim of this study was to evaluate the impact of IS605 and cag-PAI on H. pylori strains isolated from Taiwanese patients with respect to disease severity.

2. Materials and Methods

2.1. Study Subjects. The study between January 2001 and September 2009 comprised patients who were examined for gastric ulcer, duodenal ulcer, chronic gastritis, or gastric carcinoma, as well as those who were clinically diagnosed with upper gastrointestinal problems. All had completed a self-administered questionnaire prior to being enrolled in the study. Patients were excluded from the investigation if they presented with any of the following: inability to give written informed consent, bleeding tendency (platelet count <50,000/[mm.sup.3], prothrombin time 3 seconds more than controls, if on anticoagulants), or having taken [H.sup.2]-receptor antagonists or proton pump inhibitors within 2 weeks of enrollment. The study was approved by the Clinical Research Committee of the Veterans General Hospital, Taipei, Taiwan.

2.2. H. pylori Strains and Bacterial Culture. H. pylori isolates were cultured from gastric biopsy specimens and were identified by their positive reactivity for catalase, urease, and oxidase activities [18]. The isolates were cultured at 37[degrees]C on brain heart infusion (BHI) agar plates supplemented with 7% horse blood (containing nalidixic acid 10 [micro]g/mL; trimethoprim 5 [micro]g/mL, vancomycin 3 [micro]g/mL, and amphotericin 2 [micro]g/mL) under 12% C[O.sub.2] with high humidity as in our previously reported study [19]. The rapid urease test was performed using an in-house urease test at room temperature for color change up to 24 hours. The test was defined as positive if the color changed from yellow to red [19, 20].

2.3. Polymerase Chain Reaction. After obtaining positive cultures from thebiopsyspecimens, 6isolated colonies from a single culture plate were tested for genotypes with polymerase chain reaction (PCR). These colonies were homogenized in guanidinium isothiocyanate, using a sterile micropestle. DNA were extracted, washed, and eluted in 100 [micro]L of 10 mM Tris-Hcl (pH 8.3). Two microliters of the purified DNA was used for each PCR reaction. Eight primers were employed to assess the upstream and downstream of cag-PAI and IS605: cagA, cagE, cagM, cagT, orf10, orf13, and IS605 (tnpA and tnpB) (Table 1 and Figure 1). PCR was performed under the following conditions: 30 cycles at 94[degrees]C for 1min, at 50.9[degrees]C-63[degrees] C for 2 min, and at 72[degrees]C for 1 min, and a final extension at 72[degrees]C for 5 min. PCR products were analyzed on 1.0% agarose gels. Mixed infection was defined if there was different cagA, cagE, cagT, cagM, and orf 10, orf 13 among the 6 isolates from one plate.

2.4. Statistical Analysis. Descriptive statistics are reported as the proportion for categorical variables with 95% confidence intervals (CI), and means [+ or -] standard deviation for continuous variables. The CIs for all proportions are calculated using the standard approximation of binomial. The Chi-square test with Fisher's exact test was used to compare the clinical variables and results. A P value of less than 0.01 was considered significant.

3. Results

Between January 2001 and September 2009, 449 patients (37 patients with chronic gastritis, 101 had duodenal ulcer, 140 with gastric ulcer, and 171 with gastric carcinoma) were enrolled in this study underwent endoscopic examination and H. pylori culture studies. Of the enrolled subjects, 234 patients were positive for H. pylori infection: 25 (68%) with chronic gastritis, 66 (65%) with duodenal ulcer, 77 (55%) with gastric ulcer, and 66 (39%) with gastric carcinoma. Among those patients, we randomly selected 99 subjects (16 patients with chronic gastritis, 31 with duodenal ulcer, 32 with gastric ulcer, and 20 with gastric carcinoma) for further analysis of their H. pylori isolates. Six distinct, well-separated colonies were obtained from each patient making a total of 594 isolates for H. pylori genotyping. In the 99 subjects, mixed infections of H. pylori strains were found in 11 (11.1%) patients.

Our data showed that cagA, cagE, cagM, cagT, orf10, and orf 13 were present in between 90.0% and 100% of the isolates (Table 2). There were no differences in the cag-PAI status among isolates from patients with various clinical outcomes. Total deletion of cagA, cagE, cagM, cagT, orf10, and orf13 was found in 1 (1.0%) isolate from a patient with gastric carcinoma. There was only 1 isolate from patient with gastric ulcer had cagA deletion. Deletion of cagM, cagT, orf10, and orf13 was found in 2 (2.0%) isolates (1 isolate from patient with gastric carcinoma and 1 isolate with gastric ulcer), and cagE deletion was found in 4 (4.0%) isolates (each isolated from patient with gastric carcinoma, gastric ulcer, duodenal ulcer, or chronic gastritis, resp.).

IS605 was found to be present in 15.2% (15/99) of the isolates in this study (Table 3). The presence of IS605 was significantly higher in the H. pylori strains isolated from patients with gastric carcinoma (5/20,25.0%) than in patients with duodenal ulcer (2/31, 6.5%) or chronic gastritis (1/16, 6.3%) (P < 0.001). It was also higher in isolates from patients with gastric ulcer (7/32, 21.9%) compared to those with duodenal ulcer and chronic gastritis (P < 0.01).

4. Discussion

The total number of isolates used in this study was 594, and cag-PAI was found to be present in more than 96% of isolates, which is similar to that reported previously for eastern populations [12, 21-23]. Previous studies from the USA reported that cagA and cagE were detected in 66% and 62% H. pylori strains, respectively [24]. In other studies, cagA, cagE, cagM, and cagT were detected in 93%-100% of Korean and 80%-82% of the Colombian populations [13]. The presence of cagA and cagE in H. pylori isolated from Chinese, Indian, and Malay patients in Singapore ranged from 92.3% to 100% [12]. In southern Taiwan, cagA, cagE, and cagT were previously found to be present in 100% of the domestic strains [21]. Our present study of H. pylori isolates from patients in northern Taiwan yielded similar results, with cagA, cagE, cagM, and cagT being present in more than 96% of the isolates tested.

Patients with intact cag-PAI are thought to be associated with more severe clinical outcomes [10, 25]. Maeda et al. from Japan reported that strains with partial deletions within the cag-PAI were only derived from patients with nonulcer dyspepsia, whereas strains with an intact cag-PAI originated only from patients with gastric carcinoma [11]. Jenks et al. reported that intact cag-PAI was found in 85% and 53% of duodenal ulcer and nonulcer dyspepsia isolates, respectively, [10]. They indicated that the clinical outcome of H. pylori infection was not reliably predicted by any gene of the cag-PAI [10]. However, since the deletion of cag-PAI has been observed in patients with peptic ulcer and nonulcer dyspepsia, the pathogenicity of H. pylori may therefore not be determined by cag -PAI, as suggested by Kawamura et al. [25].

IS605 is located between cag I and cag II in the prototype H. pylori and is thought to be closely related to cag-PAI [4]. However, a recent study has suggested that IS605 is not related to the cag-PAI status [26]. In a previous study involving the Taiwanese population, all isolates were reported as positive for the cag-PAI, but only 36% of these isolates carried an IS605 insertion [21]. The previous controversial study [21] may have used pooled cultures for the analysis, and the actual positive rate of IS605 maybe lower because of the possibility of mixed infections.

Owen et al. reported that the distribution of genomic IS605 inserts varied widely with respect to patient disease severity [27]. In this study, IS605 was detected at an overall frequency of 15.2% of isolates and in 25.0% of isolates from patients with gastric carcinoma (Table 3). Thus the presence of IS605 was found to be higher in H. pylori from patients with gastric carcinoma. It was also higher in isolates from patients with gastric ulcer (21.9%) compared to those with duodenal ulcer (6.5%) and chronic gastritis (6.3%). These results were consistent with previous findings by Deguchi et al. who indicated that the presence of IS605 was more frequently associated with the cag13 gene in gastric cancer patients [9]. Kersulyte et al. report that the IS605 element family has homology at the protein level with orfB (putative transposase gene) [28]; this gene is present in a Salmonella prophage and contributes to virulence during bacterial infection [29]. This evidence suggests that the presence of the IS605 element may have a possible modifying role with respect to strain pathogenicity [4]. However, the function of IS605 in relation to H. pylori cag-PAI and the severity of gastric diseases still remain unclear. Further studies are required to clarify the role of IS605 in the development of gastric carcinoma.

In conclusion, a majority of patients infected with H. pylori contained intact cag-PAI. However, the presence of the cagA gene does not guarantee the presence of intact cag-PAI. The presence of IS605 is significantly higher in isolates from patients with gastric carcinoma compared to those with duodenal ulcer and chronic gastritis.

http://dx.doi.org/10.1155/2013/356217

Authors' Contribution

C.-L. Perng is the co-first author.

Conflict of Interests

All authors have no conflict of interests to declare.

Acknowledgments

This work was supported by the Tomorrow Medicine Foundation and the National Science Council, Taiwan, (NSC99-2314-B-038-034-MY2 and NSC101-2314-B-038-007). The authors thank Tzu-En Lin, Tze-Yu Tung, Austin Jen-Liang Lin, and Jen-Hao Lin for their expert technical assistance.

References

[1] M. J. Blaser, "Ecology of Helicobacter pylori in the human stomach," The Journal of Clinical Investigation, vol. 100, no. 4, pp. 759-762, 1997.

[2] B. E. Dunn, H. Cohen, and M. J. Blaser, "Helicobacter pylori" Clinical Microbiology Reviews, vol. 10, no. 4, pp. 720-741, 1997

[3] Y. Yamaoka, "Pathogenesis of Helicobacter pylori-related gastroduodenal diseases from molecular epidemiological studies," Gastroenterology Research and Practice, vol. 2012, Article ID 371503, 9 pages, 2012.

[4] S. Censini, C. Lange, Z. Xiang et al., "cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors," Proceedings of the National Academy of Sciences of the United States of America, vol. 93, no. 25, pp. 14648-14653, 1996.

[5] D. E. Taylor, "Helicobacter pylori and its genome: lessons from the treasure map," Canadian Journal of Gastroenterology, vol. 13, no. 3, pp. 218-223, 1999.

[6] M. Hatakeyama, "Helicobacter pylori and gastric carcinogenesis," Journal of Gastroenterology, vol. 44, no. 4, pp. 239-248, 2009.

[7] E. Slater, R. J. Owen, M. Williams, and R. E. Pounder, "Conservation of the cag pathogenicity island of Helicobacter pylori: associations with vacuolating cytotoxin allele and IS605 diversity," Gastroenterology, vol. 117, no. 6, pp. 1308-1315, 1999.

[8] N. S. Akopyants, S. W. Clifton, D. Kersulyte et al., "Analyses of the cag pathogenicity island of Helicobacter pylori" Molecular Microbiology, vol. 28, no. 1, pp. 37-53, 1998.

[9] R. Deguchi, M. Igarashi, K. Watanabe, and A. Takagi, "Analysis of the cag pathogenicity island and IS605 of Helicobacter pylori strains isolated from patients with gastric cancer in Japan," Alimentary Pharmacology and Therapeutics, vol. 20, supplement 1, pp. 13-16, 2004.

[10] P J. Jenks, F. Megraud, and A. Labigne, "Clinical outcome after infection with Helicobacter pylori does not appear to be reliably predicted by the presence of any of the genes of the cag pathogenicity island," Gut, vol. 43, no. 6, pp. 752-758, 1998.

[11] S. Maeda, H. Yoshida, T. Ikenoue et al., "Structure of cag pathogenicity island in Japanese Helicobacter pylori isolates," Gut, vol. 44, no. 3, pp. 336-341, 1999.

[12] H. M. A. Schmidt, S. Andres, C. Nilsson et al., "The cag PAI is intact and functional but HP0521 varies significantly in Helicobacter pylori isolates from Malaysia and Singapore," European Journal of Clinical Microbiology and Infectious Diseases, vol. 29, no. 4, pp. 439-451, 2010.

[13] P. I. Hsu, I. R. Hwang, D. Cittelly et al., "Clinical presentation in relation to diversity within the Helicobacter pylori cag pathogenicity island," American Journal of Gastroenterology, vol. 97, no. 9, pp. 2231-2238, 2002.

[14] F. Kauser, A. A. Khan, M. A. Hussain et al., "The cag pathogenicity island of Helicobacter pylori is disrupted in the majority of patient isolates from different human populations," Journal of Clinical Microbiology, vol. 42, no. 11, pp. 5302-5308, 2004.

[15] M. Ali, A. Khan, S. K. Tiwari, N. Ahmed, L. V. Rao, and C. M. Habibullah, "Association between cag-pathogenicity island in Helicobacter pylori isolates from peptic ulcer, gastric carcinoma, and non-ulcer dyspepsia subjects with histological changes," World Journal of Gastroenterology, vol. 11, no. 43, pp. 6815-6822, 2005.

[16] M. Sozzi, M. L. Tomasini, C. Vindigni et al., "Heterogeneity of cag genotypes and clinical outcome of Helicobacter pylori infection," Journal of Laboratory and Clinical Medicine, vol. 146, no. 5, pp. 262-270, 2005.

[17] H. Lu, Y. Yamaoka, and D. Y. Graham, "Helicobacterpylori virulence factors: facts and fantasies," Current Opinion in Gastroenterology, vol. 21, no. 6, pp. 653-659, 2005.

[18] C. H. Lai, C. H. Kuo, Y. C. Chen et al., "High prevalence of cagA- and babA2-positive Helicobacter pylori clinical isolates in Taiwan," Journal of Clinical Microbiology, vol. 40, no. 10, pp. 3860-3862, 2002.

[19] H. J. Lin, W. C. Lo, C. L. Perng, G. Y. Tseng, A. F. Y. Li, and Y. H. Ou, "Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers," World Journal of Gastroenterology, vol. 11, no. 3, pp. 382-385, 2005.

[20] S. Redeen, F. Petersson, E. Tornkrantz et al., "Reliability of diagnostic tests for Helicobacter pylori infection," Gastroenterology Research and Practice, vol. 2011, Article ID 940650, 6 pages, 2011.

[21] S. M. Sheu, B. S. Sheu, H. B. Yang, C. Li, T. C. Chu, and J. J. Wu, "Presence of iceA1 but not cagA, cagC, cagE, cagF, cagN, cagT, or orf13 genes of Helicobacter pylori is associated with more severe gastric inflammation in Taiwanese," Journal of the Formosan Medical Association, vol. 101, no. 1, pp. 18-23, 2002.

[22] C. L. Perng, H. J. Lin, W. C. Lo, G. Y. Tseng, I. C. Sun, and Y. H. Ou, "Genotypes of Helicobacter pylori in patients with peptic ulcer bleeding," World Journal of Gastroenterology, vol. 10, no. 4, pp. 602-605, 2004.

[23] C. Chomvarin, W. Namwat, K. Chaicumpar et al., "Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA and babA2 genotypes in Thai dyspeptic patients," International Journal of Infectious Diseases, vol. 12, no. 1, pp. 30-36, 2008.

[24] R. P. Podzorski, D. S. Podzorski, A. Wuerth, and V Tolia, "Analysis of the vacA, cagA, cagE, iceA, and babA2 genes in Helicobacter pylori from sixty-one pediatric patients from the Midwestern United States," Diagnostic Microbiology and Infectious Disease, vol. 46, no. 2, pp. 83-88, 2003.

[25] O. Kawamura, M. Murakami, O. Araki et al., "Relationship between gastric disease and deletion of cag pathogenicity island genes of Helicobacter pylori in gastric juice," Digestive Diseases and Sciences, vol. 48, no. 1, pp. 47-53, 2003.

[26] F. Antonio-Rincon, Y. Lopez-Vidal, G. Castillo-Rojas et al., "Pathogenicity island cag, vacA and IS605 genotypes in Mexican strains of Helicobacter pylori associated with peptic ulcers," Annals of Clinical Microbiology and Antimicrobials, vol. 10, article 18, 2011.

[27] R. J. Owen, T. M. Peters, R. Varea, E. L. Teare, and S. Saverymuttu, "Molecular epidemiology of Helicobacter pylori in England: prevalence of cag pathogenicity island markers and IS605 presence in relation to patient age and severity of gastric disease," FEMS Immunology and Medical Microbiology, vol. 30, no. 1, pp. 65-71, 2001.

[28] D. Kersulyte, N. S. Akopyants, S. W. Clifton, B. A. Roe, and D. E. Berg, "Novel sequence organization and insertion specificity of IS605 and IS606: chimaeric transposable elements of Helicobacter pylori" Gene, vol. 223, no. 1-2, pp. 175-186, 1998.

[29] T. L. Stanley, C. D. Ellermeier, and J. M. Slauch, "Tissue-specific gene expression identifies a gene in the lysogenic phage Gifsy1 that affects Salmonella enterica serovar typhimurium survival in Peyer's patches," Journal of Bacteriology, vol. 182, no. 16, pp. 4406-4413, 2000.

Chih-Ho Lai, (1) Chin-Lin Perng, (2,3) Keng-Hsin Lan, (2,3) and Hwai-Jeng Lin (4,5)

(1) Department of Microbiology, School of Medicine, China Medical University, Taichung 40402, Taiwan

(2) Division of Gastroenterology, Department of Medicine, Taipei Veterans General Hospital, Taipei 11217, Taiwan

(3) School of Medicine, National Yang-Ming University, Taipei 11221, Taiwan

(4) Division of Gastroenterology and Hepatology, Department of Internal Medicine, Taipei Medical University Hospital, Taipei 11031, Taiwan

(5) School of Medicine, Taipei Medical University, Taipei 11031, Taiwan

Correspondence should be addressed to Hwai-Jeng Lin; buddhistlearning@gmail.com

Received 4 September 2012; Revised 26 December 2012; Accepted 19 January 2013

Academic Editor: Vikram Kate

Table 1: PCR primers used to detect CagA, CagE,
CagM, CagT, orf10, orf13, TnpA, and TnpB in H.
pylori isolates.

Genes   Primers      Nucleotide sequences       Length
                           (5'-3')              of PCR
                                               products

cagA    cagA-F      GATAACAGGCAAGCTTTTGAGG       349
        cagA-R      CTGCAAAAGATTGTTTGGCAGA
cagE    cagE-F    GTTACATCAAAAATAAAAGGAAGCG      735
        cagE-R    CAATAATTTTGAAGAGTTTCAAAGC
cagM    cagM-F    ACAAATACAAAAAAGAAAAAGAGGC      587
        cagM-R    ATTTTTCAACAAGTTAGAAAAAGCC
cagT    cagT-F    TCTAAAAAGATTACGCTCATAGGCG      490
        cagT-R    CTTTGGCTTGCATGTTCAAGTTGCC
orf10   orf10-F   AATAGTGCTTTCTTTAGGATTAGCG      658
        orf10-R   CCGATTTAATCCTTTCGCTTATGTG
orf13   orf13-F   CGTTCATGTTCCATACATCTTTGGC      617
        orf13-R   GATTTATAGCGATCTAAGAAACCGC
tnpA    tnpA-F    ATCAGTCCAAAAAGTTTTTTCTTTCC     338
        tnpA-R    TAAGGGGGTATATTTCAACCAACCG
tnpB    tnpB-F    CGCTCTCCCTAAATTCAAAGAGGGC      578
        tnpB-R    AGCTAGGGAAAAATCTGTCTATGCC

Genes   Primers   Location in
                   genome of
                   reference
                  ([dagger])

cagA    cagA-F    14994-15342
        cagA-R
cagE    cagE-F    12342-13076
        cagE-R
cagM    cagM-F     4815-9264
        cagM-R
cagT    cagT-F     1182-1671
        cagT-R
orf10   orf10-F    8970-9627
        orf10-R
orf13   orf13-F    704-1320
        orf13-R
tnpA    tnpA-F      154-541
        tnpA-R
tnpB    tnpB-F     954-1531
        tnpB-R

([dagger]) GenBank accession number. AF282853.1.

Table 2: Prevalence of H. pylori virulence factors
among isolates from patients with gastric carcinoma,
gastric ulcer, duodenal ulcer, and chronic gastritis.

Diagnosis        GC            GU            DU
([dagger])

Number of        20            32            31
isolates

CagA         20 (100.0%)   31 (96.8%)    31 (100.0%)
CagE         19 (95.0%)    31 (96.9%)    30 (96.8%)
CagM         19 (95.0%)    31 (96.8%)    31 (100.0%)
CagT         19 (95.0%)    31 (96.8%)    31 (100.0%)
orf10        18 (90.0%)    32 (100.0%)   31 (100.0%)
orf13        18 (90.0%)    32 (100.0%)   31 (100.0%)

Diagnosis        CG          Total
([dagger])

Number of        16            99
isolates

CagA         16 (100.0%)   98 (99.0%)
CagE         15 (93.8%)    95 (96.0%)
CagM         15 (93.8%)    96 (97.0%)
CagT         16 (100.0%)   97 (98.0%)
orf10        16 (100.0%)   97 (98.0%)
orf13        16 (100.0%)   97 (98.0%)

([dagger]) GC: gastric carcinoma; GU: gastric ulcer;
DU: duodenal ulcer; CG: chronic gastritis.

Table 3: Prevalence of IS605 in H. pylori
isolated from patients with gastric carcinoma,
gastric ulcer, duodenal ulcer, and chronic
gastritis.

Diagnosis        Number (%) of IS605
([dagger])        positive isolates

GC (n = 20)          5 (25.0) *
GU (n = 32)         7 (21.9) (#)
DU (n= 31)             2 (6.5)
CG (n = 16)            1 (6.3)
Total (n = 99)        15 (15.2)

([dagger]) GC: gastric carcinoma; GU: gastric
ulcer; DU: duodenal ulcer; CG: chronic gastritis.

* P < 0.001, GC versus DU; GC versus CG.

(#) P < 0.01, GU versus DU; GU versus CG.
COPYRIGHT 2013 Hindawi Limited
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Clinical Study; cag pathogenicity island
Author:Lai, Chih-Ho; Perng, Chin-Lin; Lan, Keng-Hsin; Lin, Hwai-Jeng
Publication:Gastroenterology Research and Practice
Article Type:Report
Geographic Code:9TAIW
Date:Jan 1, 2013
Words:3451
Previous Article:Functional dyspepsia in review: pathophysiology and challenges in the diagnosis and management due to coexisting gastroesophageal reflux disease and...
Next Article:Sodium valproate inhibits the growth of human cholangiocarcinoma in vitro and in vivo.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters