Printer Friendly

Association of ACE and NOS3 Gene Polymorphism with Blood Pressure in a Case Control Study of Coronary Artery Disease in Punjab, Pakistan.

Byline: Saleem Ullah Shahid, Shabana, Jackie A. Cooper, Abdul Rehman and Steve E Humphries

ABSTRACT

Single nucleotide polymorphisms (SNPs), ACE rs4341 and NOS3 rs1799983 have been reported to be associated with coronary artery disease (CAD) and blood pressure (BP)in many but not all studies. We aimed to investigate the effect of these SNPs on BP and CAD in people from Punjab, Pakistan. A total of 650 subjects (430 CAD cases and 220 controls) were genotyped by TaqMan/KASPar allelic discrimination technique. Two BP measurements were reordered and their mean was calculated. The results showed that the risk allele frequencies (RAFs) of both SNPs were higher in cases than controls but the difference was not statistically significant. For rs4341, RAF in cases and controls was 0.577 vs. 0.525, p = 0.08 and for rs1799983, the RAF was 0.202 vs. 0.178, p = 0.31. The SNPs were not associated with CAD. The CAD odds ratio of rs4341 (1.22,0.97-1.53, p = 0.09) and that of rs1799983 (1.15, 0.86-1.54, p=0.33) was not statistically significant.

Mean systolic blood pressure (SBP) and diastolic blood pressure (DBP) were significantly higher in cases than controls (p<0.05) and the SNPs showed a significant association with BP. Each risk allele of rs4341 (G) increased SBP by 10.040.8 mmHg and DBP by 2.50.6mmHg, while risk allele of rs1799983 (T), increased SBP and DBP by 16.40.9mmHg and 8.80.6mmHg respectively, all were statistically significant (pT missense variation located in the exon 7 of the gene (Hingorani et al., 1995). The substitution of the codon GAG to GAT in the 894 position (G894T), changes glutamate with aspartate (Glu298Asp) in the protein. A possible cause of reduction in NOS activity due to this polymorphism is that the 894Asp substitution might cause an increase in the susceptibility of the protein for degradation due to a tight run of alpha helix (Kelm, 2006).

This amino acid change may also affect protein-protein interaction and interaction of the protein with chaperon (Monti et al., 2003). The protein variant with this change has different susceptibility to cleavage, that is an amino terminal 35kDa and carboxy terminal 100 kDa fragments (Tesauro et al., 2000). A meta-analyses of 42 published studies comprising 13876 cases and 13042 controls revealed significant association of this polymorphism with CAD (OR 1.17, C.I 1.07-1.28, p=0.001) (Casas et al., 2006a). Similarly, the SNP was significantly associated with MI in Asians (Luo et al., 2014). In a recent large meta-analysis, including 132 studies from all over the world, the polymorphism was associated with CAD (OR range 1.28-1.52, p<0.00001) (Rai et al., 2014). This polymorphism was also associated with essential hypertension in two independent Japanese populations and the allele frequency of 298Asp was significantly high in hypertensive than normotensive subjects (Miyamoto et al., 1998).

The renin angiotensin system (RAS) maintains body fluid levels and cardiovascular functioning (Abdollahi et al., 2008). The angiotensin converting enzyme (ACE) is a major player of this system and converts angiotensin I to angiotensin II and inactivates bradykinin which is a vasodilator. Strong genetic control of ACE regulation has been reported (Cambien et al., 1988). The ACE gene is 21 kb in length consisting of 26 exons and 25 introns. Most of the common variants reported in this gene to date are in the noncoding region (Sayed-Tabatabaei et al., 2006). The gene contains an important polymorphism consisting of an ALU repeat of 287 base pairs in intron 16. The polymorphism is characterized by either an insertion (I) or deletion (D) of the repeat (Eisenmann et al., 2009). The DD genotype is associated with higher levels of the enzyme as compared to the II and ID genotype (Rigat et al., 1990).

The D allele of the SNP was found to be significantly associated (p=0.0005, OR 4.157) with hypertension in a study on Indian people (Choudhury et al., 2012). In a meta-analysis of 46 studies comprising of 32715 white individuals, the ID and DD allele conferred greater susceptibility (p<0.001) to ischemic disease than II allele (Agerholm-Larsen et al., 2000). Since the I/D polymorphism is in the non-coding/ intronic region, it is less likely to be a functional variant (Rigat et al., 1990). The polymorphism ACE rs4341 is in complete linkage disequilibrium (LD) with the I/D polymorphism of this gene and can be a best proxy for I/D polymorphism (Domingues-Montanari et al., 2010).

Both of these SNPs were identified in candidate gene studies predating genome wide association study (GWAS), however, these SNPs have now been studied in GWAS but were not found to be associated with CAD in GWAS (Casas et al., 2006). The reasons may be false associations in candidate gene studies, publication bias or the effect of the SNPs may be too small to reach GWAS significance threshold. The objective of the current study was to examine whether the common variants in the above mentioned genes having potential role in regulation of vascular physiology and RAS system are associated with HTN and CAD in Pakistani people.

MATERIALS AND METHODS

Study subjects

The study consisted of 430 CAD cases and 220 controls. The CAD cases were reported as ischemic heart disease patients based upon ECG, cardiac echo, radiological and biochemical markers of cardiac ischemia (CK-MB and troponinT/I levels). All cases were newly diagnosed and were not taking any lipid lowering or anti-hypertensive drugs. Controls were age, sex and ethnicity matched individuals without any history of cardiovascular disease. The exclusion criteria included the presence of chronic diseases like cancer, kidney or liver disease and any on-going acute infection. All the procedures were in compliance with the Helsinki declaration. The case history and other details were collected after obtaining an informed written consent. The study was approved by the institutional ethical committee, University of the Punjab, Lahore.

Genotyping

Genomic DNA was extracted from whole blood leucocytes using Promega Wizard(r) Genomic DNA purification kit. DNA was quantified using nanodrop (ND-8000, USA). The DNA samples were diluted to a fixed concentration (1.25ng/ul). A 4ul of this dilution was used to get a final working concentration of 5ng of DNA. The DNA arraying into 384 well plates was done by a liquid handling robotic system (Biomerk FX, Beckman Coulter). Specially designed plates (Micro Amp) suitable for fluorescence amplification were used. The NOS3 rs1799983 was genotyped by TaqMan allelic discrimination technique. The TaqMan reaction mixture consisted of 1X KAPA qPCR master mix (KAPABiosystems, USA), 100nM of each primer, 100nM of each probe, ROX high (0.4ul/20ul reaction mixture), 5ng DNA and PCR grade water as needed.

The PCR program consisted of an initial temperature of 50C for 2 min, denaturation/enzyme activation at 95C for 10 min followed by amplification for 40 cycles each consisting of denaturation at 95C for 15 sec and amplification at 60C for 1 min. The programme was run on BioRad C1000TM thermal cycler.

Table I.- Sequence of primers and probes used for rs1799983 assay.

SNP###40x###Primer and probe###Sequence of primers and probes

rs1799983###NOS3_G894T_F###Primers###GGCTGGACCCCAGGAAA

###NOS3_G894T_R###Primers###CACCCAGTCAATCCCTTTGGT

###NOS3_G894T_VIC###Probe VIC =T###CCCAGATGATCCCCCA

###NOS3_G894T_FAM###Probe FAM=G###CCAGATGAGCCCCCA

Table II.- Sequence of primers used for rs4341 assay.

SNP###Sequence, 50bp either side of the polymorphism [C/G].###FAM###VIC

rs4341###TCTCTGAGCTCCCCTTACAAGCAGARGTGAGCTAAGGGCTGGARCTYAAG[C/G]CATT###C###G

###CMAMCCCCTACCAGATSTGACGAATRTGATGGCCRCRTCCCGGAAA

The ACE rs4341 was genotyped by KASPar (KBiosciences Competitive Allele Specific PCR) technique. The assay mixture per plate consisted of 950ul of each of KASPar master mix and Sigma water and 26.4ul of SNP assay (consisting of allele specific primers and labelled probes). The touchdown thermal cycler program consisted of an initial denaturation/enzyme activation at 94C for 15 min, then 10 cycles comprising of 94C for 20 sec and annealing/extension temperature reducing from 65C to 57C lowering 0.8C per cycle. The final round consisted of 26 cycles each consisting of 94C for 20 sec and annealing/extension at 57C for 60 sec. The information about the primers and probes used in TaqMan and KASPar genotyping is available in Tables I, II.

After amplification, the results were analysed on ABI Prism 7900HT (Applied Biosystems/Life Technologies) and the genotypes were called using sequence detection software (SDS) version 2.0. The genotypes were also confirmed randomly by conventional direct DNA sequencing (source biosciences, UK) to check the accuracy of techniques and the results were always concordant.

Statistical analysis

Statistical analyses were performed using the Statistical Package for Social Sciences (SPSS version 22, IBM statistics). The student t-test was used to compare continuous variables between case and control groups. The normality of outcome variable (blood pressure) was checked by drawing normal distribution curve. The studied population was checked for Hardy Weinberg equilibrium (HWE) by a Chi-square goodness of fit test. Allele and genotype frequencies were calculated by an excel spread sheet (Johnson, 1975) and also confirmed by direct counting. Allele frequencies were compared between cases and controls using chi-squared test. As CAD is a binary variable, the association of genotypes with CAD (OR) were obtained by binary logistic regression taking "CAD status" as dependent variable and the "genotypes" as covariate. Similarly, the association of blood pressure with CAD was also examined using binary logistic regression.

The mean blood pressure levels across different genotypes were calculated by one way analysis of variance (ANOVA) taking blood pressure as the dependent variable and genotype as the factor. The effect sizes of the SNPs on blood pressure (b effect/b coefficients), which is the increase in blood pressure for each additional risk allele held were obtained by linear regression taking blood pressure as dependent variable and genotype as independent variable.

The power of the sample size used in study was calculated using an online calculator (https://www.dssresearch.com/KnowledgeCenter/toolkitc alculators/statisticalpowercalculators.aspx). A p-value <0.05 was considered significance cut-off for all measurements.

RESULTS

The general characteristics of the cases and controls are shown in Table III. As expected, cases had higher percentage of hypertension and diabetes than controls and smoking rate was also higher in cases than controls. The SBP and DBP were normally distributed and significantly different among cases and controls. The cases had higher blood pressure values as compared to the controls. Both systolic and diastolic blood pressures were significantly associated with CAD status as shown by their OR (Table IV).

Both SNPs showed good genotyping results call rates (~98%) and for both SNPs the population examined was in Hardy Weinberg equilibrium (Table VI). For the SNP ACE rs4341, the common allele G is the risk allele and the risk allele frequency (RAF) was higher in cases than controls but the difference was not significant statistically (0.57 vs. 0.525, p = 0.079). For NOS3 rs1799983, the minor allele T is the risk allele which was non-significantly (0.202 vs. 0.178, p = 0.332) higher in cases than controls (Table VI). Although the cases had higher number of risk allele for both SNPs but the association with CAD was not significant in the studied samples in either of additive, dominant and recessive models examined. The per allele CAD odds ratio (OR) of both the SNPs was not statistically significant (Table VI).

Table III.- Basic characteristics of the subjects under study.

Variables###Cases###Controls###p-value

Sample No.###430###220

Age (years)###59.112.6###5610.5###0.002

Sex

Males (n)###230###120###0.27

Females (n)###200###100

Diabetes (%)###64.6###13.6###5.1x10-34

Hypertension###62.1###16.4###8.9x10-28

(%)

Smoking (%)###29.5###10.5###7.3x10-08

Table IV.- Blood pressure levels in cases and controls and association with CAD.

###Systolic (mmHg)###Diastolic (mmHg)

Cases###139.916.1###88.09.6

Controls###128.714.8###85.311.3

P-value###<0.001###0.002

CAD OR*###1.05 (1.04-1.06)###1.03 (1.01-1.05)

P-value###G*###0.577###0.525###0.079###1.22###1.19###1.47

###(0.54-0.61)###(0.48-0.57)###(0.97-1.53) 0.089###(0.83-1.70) 0.337###(0.99-2.18)

###0.056

rs1799983###G>T*###0.202###0.178###0.312###1.15###1.15###1.20

###(0.17-0.23)###(0.14-0.21)###(0.86-1.54) 0.332###(0.53-2.48) 0.74###(0.85-1.71)

###0.30

Table VII.- Systolic and diastolic blood pressure values by genotypes.

SNP###Genotype###SBP###DBP

###(mmHg)###(mmHg)

rs4341###CC###124.213.2###83.510.7

###CG###135.412.9###87.48.9

###GG###144.518.3###88.711.4

###Se###10.040.8###2.50.6

###p-value###<0.001###<0.001

rs1799983###GG###129.814.1###83.89.4

###GT###145.611###91.56.8

###TT###16419###103.912

###Se###16.40.9###8.80.6

###p-value###<0.001###<0.001

Table VIII.- Coronary artery disease by combined genotype groups.

ACE###NOS3###N controls/###OR (95% CI)###p-

###cases###value

CC###GG###40/51###1.00###-

###GT###14/19###1.06 (0.48-2.38)###0.88

###TT###1/5###3.88 (0.41-190.0)###0.38

CG###GG###63/127###1 (0.95-2.64)###0.08

###GT###30/56###1.46 (0.80-2.69)###0.22

###TT###5/9###1.41 (0.39-5.78)###0.78

GG###GG###48/84###1.37 (0.80-2.37)###0.26

###GT###14/46###2.58 (1.25-5.33)###0.01

###TT###4/7###1.37 (0.32-6.83)###0.88

Table IX.- Blood pressure by combined genotype groups.

ACE###NOS3###N###SBP###DBP

CC###GG###91###117.8 (8.1)###80.4 (10.4)

###GT###33###136.1 (8.4)###90.3 (7.2)

###TT###6###154.8 (4.5)###93.8 (6.6)

CG###GG###190###130.9 (12.3)###85.6 (9.2)

###GT###86###142.6 (7.9)###90.0 (6.5)

###TT###14###152.0 (11.1)###97.4 (7.1)

GG###GG###132###136.4 (14.6)###83.7 (8.4)

###GT###60###155.0 (9.1)###94.5 (6.3)

###TT###11###184.2 (14.2)###117.6 (4.4)

The difference with respect to CAD association of our results with other studies conducted in the same region may be due to the genotyping techniques. We have genotyped the SNPs with fully automated high throughput fluorescence based techniques and randomly confirmed the results by direct DNA sequencing; hence the results are more reliable. The studied population was also in Hardy Weinberg equilibrium collectively as well as among cases and controls separately. The allele frequencies in our samples were also comparable to the allele frequencies of Pakistani Punjabi population from Lahore (PJL), a group of 96 subjects from Pakistan genotyped in 1000 genomes project phase three.

The study has a limitation which is the small sample size so modest effects of these SNPs on CAD could not be detected. The study power, as calculated, came out to be 81.7% with a sample size of 650. In order to have 100% power, the sample size needed was 1068. It is because of a small sample size than required, that we couldn't detect some significant associations evident from the nominal p-value for CHD association of the selected variants. While NOS3 variant is functional the ACE variant is not and may not be in such strong LD with the functional variant elsewhere in this gene as in UK Caucasians. It is concluded that for both the SNPs, risk alleles were associated with BP which may suggest that the SNPs are acting through controlling HTN in studied Pakistani population.

CONCLUSION

In conclusion, the SNPs ACE rs4341 and NOS3 rs1799983 were significantly associated with blood pressure in a dose response model in Pakistani subjects under study. The SNPs were not independently associated with CAD. The effect of SNPs was synergetic on blood pressure CAD.

ACKNOWLEDGEMENTS

SUS was funded by Higher Education Commission (HEC) of Pakistan under indigenous 5000PhD scholarship programme (Bm6-131) and international research support initiative programme (IRSIP) scheme (IRSIP 24 BMS 41). SEH was supported by the British Heart Foundation (RG 2008/008) and the Department of Health's National Institute for Health Research (NIHR) Biomedical Research Centres funding scheme.

Conflict of interest

The authors declare that they have no conflict of interest.

REFERENCES

Abdollahi, M. R., Huang, S., Rodriguez, S., Guthrie, P. A. I., Smith, G. D., Ebrahim, S., Lawlor, D. A., Day, I. N. and Gaunt, T. R., 2008. Homogeneous assay of rs4343, an ACE I/D proxy, and an analysis in the British Women's Heart and Health Study (BWHHS). Dis. Mark., 24: 11-17.

Agerholm-Larsen, B., Nordestgaard, B. G. and TybjArg-Hansen, A., 2000. ACE gene polymorphism in cardiovascular disease meta-analyses of small and large studies in whites. Arterioscl. Thromb. Vas. Biol., 20: 484-492.

Ben Ali, M., Messaoudi, S., Ezzine, H. and Mahjoub, T., 2015. Contribution of eNOS variants to the genetic susceptibility of coronary artery disease in a Tunisian population. Genet. Test. Mol. Biomark., 19: 203-208.

Butler, M., 2009. Genetics of hypertension. Current status. J. Med. Liban., 58: 175-178.

Cambien, F., Alhenc-Gelas, F., Herbeth, B., Andre, J., Rakotovao, R., Gonzales, M., Allegrini, J. and Bloch, C., 1988. Familial resemblance of plasma angiotensin-converting enzyme level: the Nancy Study. Am. J. Hum. Genet., 43: 774-780.

Casas, J.P., Cavalleri, G.L., Bautista, L.E., Smeeth, L., Humphries, S.E. and Hingorani, A.D., 2006a. Endothelial nitric oxide synthase gene polymorphisms and cardiovascular disease: a HuGE review. Am. J. Epidemiol., 164: 921-935.

Casas, J. P., Cooper, J., Miller, G. J., Hingorani, A. D. and Humphries, S.E., 2006b. Investigating the genetic determinants of cardiovascular disease using candidate genes and meta-analysis of association studies. Annls. Hum. Gen., 70: 145-169.

Choudhury, I., Jothimalar, R. and Patra, A. K., 2012. Angiotensin converting enzyme gene polymorphism and its association with hypertension in south indian population. Ind. J. Clin. Biochem., 27: 265-269.

Dickson, M. E. and Sigmund, C. D., 2006. Genetic basis of hypertension revisiting angiotensinogen. Hypertension, 48: 14-20.

Domingues-Montanari, S., Fernandez-Cadenas, I., Rio-Espinola, D., Mendioroz, M., Ribo, M., Obach, V., Marti-Fabregas, J., Freijo, M., Serena, J. and Corbeto, N., 2010. The I/D polymorphism of the ACE1 gene is not associated with ischaemic stroke in Spanish individuals. Eur. J. Neurol., 17: 1390-1392.

Eisenmann, J. C., Sarzynski, M. A., Glenn, K., Rothschild, M. and Heelan, K. A., 2009. ACE I/D genotype, adiposity, and blood pressure in children. Cardiovasc. Diabetol., 8: 14-20.

Freitas, S. R. S., Cabello, P. H., Moura-Neto, R. S., Dolinsky, L. C. and Boia, M. N., 2007. Combined analysis of genetic and environmental factors on essential hypertension in a Brazilian rural population in the Amazon region. Arq. Bras. Cardiol., 88: 447-451.

Gupta, Sumeet, Agrawal, B. K., Goel, R. K. and Sehajpal, P.K., 2009. Angiotensin-converting enzyme gene polymorphism in hypertensive rural population of Haryana, India. J. Emerg. Trauma Shock, 2: 150-154.

Hibi, K., Ishigami, T., Tamura, K., Mizushima, S., Nyui, N., Fujita, T., Ochiai, H., Kosuge, M., Watanabe, Y. and Yoshii, Y., 1998. Endothelial nitric oxide synthase gene polymorphism and acute myocardial infarction. Hypertension, 32: 521-526.

Hingorani, A., Jia, H., Stevens, P., Monteith, M. and Brown, M., 1995. A common variant in exon 7 of the endothelial constitutive nitric oxide synthase gene: Identification by single strand conformation polymorphism analysis. Clin. Sci., 88: 21P-21P.

Iqbal, M..P., Mahmood, S., Mehboobali, N., Ishaq, M., Fatima, T., Parveen, S. and Frossard, P., 2004. Association study of the angiotensin-converting enzyme (ACE) gene G2350A dimorphism with myocardial infarction. Exp. mol. Med., 36: 110-115.

Johnson, A. F., 1975. Statistics in medicine T. Colton. Little, Brown and Company, Boston, Mass. 02106, 1974, xii+ 372 pp. Paperback. Clin. Chem., 21: 789-790.

Keavney, B., McKenzie, C., Parish, S., Palmer, A., Clark, S., Youngman, L., Delepine, M., Lathrop, M., Peto, R. and Collins, R., 2000. Large-scale test of hypothesised associations between the angiotensin-converting-enzyme insertion/deletion polymorphism and myocardial infarction in about 5000 cases and 6000 controls. Lancet, 355: 434-442.

Kelm, M., 2006. Significance of vascular nitric oxide synthase pathways in coronary artery disease: a multiple-level biomarker strategy. J. Am. Coll. Cardiol., 48: 1175-1176.

Lifton, R.P., 1996. Molecular genetics of human blood pressure variation. Science, 272: 676.

Liu, Jielin, Wang, L., Liu, Y., Wang, Z., Li, M., Zhang, B., Wang, H., Liu, K. and Wen, S., 2014. The association between endothelial nitric oxide synthase gene G894T polymorphism and hypertension in Han Chinese: a case-control study and an updated meta-analysis. Annls. Hum. Biol., 42: 184-194.

Luo, J.-Q., Wen, J.-G., Zhou, H.-H., Chen, X.-P. and Zhang, W., 2014. Endothelial nitric oxide synthase gene G894T polymorphism and myocardial infarction: a meta-analysis of 34 studies involving 21068 subjects. PLoS One, 9: e87196.

Masud, R. and Qureshi, I. Z., 2011. Tetra primer ARMS-PCR relates folate/homocysteine pathway genes and ACE gene polymorphism with coronary artery disease. Mol. Cell. Biochem., 355: 289-297.

Miyahara, K., Kawamoto, T., Sase, K., Yui, Y., Toda, K., Yang, L. X., Hattori, R., Aoyama, T., Yamamoto, Y. and Ogoshi, S., 1994. Cloning and structural characterization of the human endothelial nitric-oxide-synthase gene. Eur. J. Biochem., 223: 719-726.

Miyamoto, Y., Saito, Y., Kajiyama, N., Yoshimura, M., Shimasaki, Y., Nakayama, M., Kamitani, S., Harada, M., Ishikawa, M. and Kuwahara, K., 1998. Endothelial nitric oxide synthase gene is positively associated with essential hypertension, Hypertension, 32: 3-8.

Monti, L. D., Barlassina, C., Citterio, L., Galluccio, E., Berzuini, C., Setola, E., Valsecchi, G., Lucotti, P., Pozza, G. and Bernardinelli, L., 2003. Endothelial nitric oxide synthase polymorphisms are associated with type 2 diabetes and the insulin resistance syndrome. Diabetes, 52: 1270-1275.

Morris, B. J. and Griffiths, L. R., 1998. Scanning the genome for essential hypertension loci. Clin. exp. Pharmacol. Physiol., 25: S72-S78.

Nadaud, S., Bonnardeaux, A., Lathrop, M. and Soubrier, F., 1994. Gene structure, polymorphism and mapping of the human endothelial nitric oxide synthase gene. Biochem. biophys. Res. Commun., 198: 1027-1033.

Nassar, B. A., Bevin, L. D., Johnstone, D. E., O'Neill, B. J., Bata, I.R., Kirkland, S. A. and Title, L. M., 2001. Relationship of the Glu298Asp polymorphism of the endothelial nitric oxide synthase gene and early-onset coronary artery disease. Am. Heart J., 142: 586-589.

Nawaz, S. K., Rani, A., Yousaf, M., Noreen, A. and Arshad, M., 2015. Genetic etiology of coronary artery disease considering NOS3 gene variant rs1799983. Vascular, 23: 270-276.

Nishevitha, N., Angeline, T. and Jeyaraj, N., 2009. Endothelial nitric oxide synthase (eNOS) Glu298- Asp polymorphism (G894T) among South Indians. Indian J. med. Res., 129: 68-71.

Perry, I., Whincup, P. and Shaper, A., 1994. Environmental factors in the development of essential hypertension. Br. med. Bull., 50: 246-259.

Rai, H., Parveen, F., Kumar, S., Kapoor, A. and Sinha, N., 2014. Association of endothelial nitric oxide synthase gene polymorphisms with coronary artery disease: An updated meta-analysis and systematic review. PLoS One, 9: e113363.

Rice, T., Rankinen, T., Province, M. A., Chagnon, Y. C., Perusse, L., Borecki, I. B., Bouchard, C. and Rao, D., 2000. Genome-wide linkage analysis of systolic and diastolic blood pressure the Quebec family study. Circulation, 102: 1956-1963.

Rigat, B., Hubert, C., Alhenc-Gelas, F., Cambien, F., Corvol, P. and Soubrier, F., 1990. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J. clin. Invest., 86: 1343.

Samani, N. J., Thompson, J. R., O'Toole, L., Channer, K. and Woods, K. L., 1996. A meta-analysis of the association of the deletion allele of the angiotensin-converting enzyme gene with myocardial infarction. Circulation, 94: 708-712.

Sameer, A. S., Syeed, N., Tak, S. A., Bashir, S., Nissar, S. and Siddiqi, M.A., 2010. ACE I/D polymorphism in hypertensive patients of Kashmiri population. Cardiol. Res., 1: 1-7.

Sayed-Tabatabaei, Houwing-Duistermaat, J.J., van Duijn, C. M. and Witteman, J.C., 2003. Angiotensin-converting enzyme gene polymorphism and carotid artery wall thickness a meta-analysis. Stroke, 34: 1634-1639.

Sayed-Tabatabaei, Oostra, B., Isaacs, A., Van Duijn, C. and Witteman, J., 2006. ACE polymorphisms. Circ. Res., 98: 1123-1133.

Shimasaki, Y., Yasue, H., Yoshimura, M., Nakayama, M., Kugiyama, K., Ogawa, H., Harada, E., Masuda, T., Koyama, W. and Saito, Y., 1998. Association of the missense Glu298Asp variant of the endothelial nitric oxide synthase gene with myocardial infarction. J. Am. Coll. Cardiol., 31: 1506-1510.

Taqddus, A., Saad, A. B. A., Pasha, B., Latif, M., Safdar, S., Shaikh, R. S., Ali, M. and Iqbal, F., 2014. Association of endothelial nitric oxide synthase (eNOS) gene polymorphism (Glu 298 Asp) with coronary artery disease in subjects from Multan, Pakistan. Pak. J. pharm. Sci., 27: 357-363.

Tesauro, M., Thompson, W., Rogliani, P., Qi, L., Chaudhary, P. and Moss, J., 2000. Intracellular processing of endothelial nitric oxide synthase isoforms associated with differences in severity of cardiopulmonary diseases: cleavage of proteins with aspartate vs. glutamate at position 298. Proc. natl. Acad. Sci., 97: 2832-2835.

Williams, R.R., Hunt, S.C., Hopkins, P.N., Wu, L.L. and Lalouel, J.M., 1994. Evidence for single gene contributions to hypertension and lipid disturbances: definition, genetics, and clinical significance. Clin. Genet., 46: 80-87.
COPYRIGHT 2016 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:angiotensin-converting enzyme; nitric oxide synthase
Author:Shahid, Saleem Ullah; Shabana; Cooper, Jackie A.; Rehman, Abdul; Humphries, Steve E.
Publication:Pakistan Journal of Zoology
Article Type:Report
Geographic Code:9PAKI
Date:Aug 31, 2016
Words:4487
Previous Article:Engineering Transferrin and Epirubicin onto Magnetic Nanoparticles for Targeting Drug Delivery Through Transferrin Receptors.
Next Article:Estimation of Losses in Some Advanced Sorghum Genotypes Incurred by Red Flour Beetle, Tribolium castaneum L. (Herbst.) (Tenebrionidae: Coleoptera).
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters