Printer Friendly

Assessment of cell free mitochondrial DNA as a biomarker of disease severity in different viral infections.

Byline: Zain Ali, Shahid Waseem, Riffat Aysha Anis and Mariam Anees

KEYWORDS: HIV, HBV, HCV, Mitochondrial DNA, Interleukin-6.

INTRODUCTION

Assessment of inflammation at molecular level is a hallmark of disease progression studies. Mitochondria plays an important role in cellular homeostasis and inflammatory response in viral infection.1 Mitochondria shares genetic homology with prokaryotes and the recognition of mitochondrial genome in extracellular environment by immune system initiates an inflammatory response.2 Role of mitochondria in damage associated molecular patterns(DAMPs) is well established. Role of Cell free mitochondrial DNA(CF mt-DNA) in disease physiology is an emerging field in the study of new biomarkers but it still need exploration.3 In case of infections, inflammatory response by the cells respond by increasing different biomarkers i.e. C-Reactive Protein(CRP), IL-6, TNF-alpha and many others.4

CF mt-DNA has shown induction of TNF-alpha and IL-6 in murine models.5 Elevation of IL-6 many folds in different pathophysiological conditions is well documented.6 Viral load in case of HIV, HBV and HCV represents the replication potential of virus and disease progression to a certain extent. Viral load is predominantly first choice as a diagnostic parameter, but it may diminish within few weeks of infection.7 The need to explore biomarkers to serve the purpose of diagnosis as well as disease progression and severity requires rigorous exploring.

The present study investigates the correlation of elevated CF mt-DNA levels with IL-6 and viral load in viral infections i.e. HIV, HBV and HCV and the possibility of a potential role for CF mt-DNA as a marker for disease severity and disease progression in viral infections.

METHODS

Sample Collection: Before the commencement of study, Ethical Approval was obtained from the Bio-Ethical Committee of Quaid-i-Azam University, Islamabad(BEC-FBS-QAU2018-74, Dated: 18-01-18). Individuals(n=30) with HIV infection were recruited from HIV treatment centers at Pakistan Institute of Medical Sciences(PIMS), Islamabad and Peshawar. Clinical information was recorded on a structured questionnaire. HBV and HCV infected serum samples(n=30 each) were collected from diagnostic centers in Islamabad. Healthy controls(n=30) were also included in the study. All the samples we acquired in the span of January 2018 to December 2018. Written informed consent was obtained from the subjects for collection and utilization of their samples for research purpose. Age, region and gender of the participants recruited in this study are provided in Table-I.

Table-I: Clinical parameters of HIV, HBV and HCV infected individuals along with healthy controls.

###HIV###HBV###HCV###Control

###No of Patients(n)###30###30###30###30

###Male(%)###73.3###66.7###100###53.3

###Female(%)###26.7###33.3###0###46.7

###Mean age +- SD###33.167 +- 5.546###29.867 +- 12.719###30.300 +- 12.531###28.168 +- 5.552

###Age range###25 - 45###06 A 55###06 - 57###19 - 44

###Median age###32###28###29###27

###Punjab province(%)###46.7###33.3###30.0###33.3

###AJK province(%)###13.3###26.7###30.0###13.3

###KPK province(%)###40.0###40.0###40.0###53.3

Extraction of nucleic acids for viral load estimation: Nucleic acids from serum samples of HIV, HBV and HCV infected individuals and healthy controls were extracted using a commercial kit(Machery-Nagel, Germany) according to the manufacturer's protocol. Extracted nucleic acids were stored at-20AdegC until further use.

Viral load estimation: Viremia in serum samples of HIV, HBV and HCV infected individuals was analyzed on Magnetic Induction Cycler(MIC) qPCR(BMS, Australia). Serum samples(HIV, HBV and HCV) were acquired on FAM channel while internal controls, provided in the kit, were detected on HEX channel for HBV and HCV, and on ROX channel for HIV(GeneProof and QIAGEN, Germany). Standards were included in the run to generate standard curve. Viral copies were quantified using the standard curve.

DNA extraction for CF mt-DNA analysis: DNA was extracted from 600ul serum of HBV and HCV infected as well as healthy individuals(control) by using organic method with slight modifications.8 Serum and plasma both were used in case of HIV patients. DNA was eluted in 80ul of distilled water and stored at-20AdegC until further use.

Reference and target genes for qPCR: Primers were used to amplify regions from mitochondrial and human genomic DNA as reported earlier.9 Human beta2 microglobulin(hB2M) was used as a reference to determine the fold expression of CF mt-DNA in healthy control and patient samples. hB2M primers used were hB2M F1: TGTTCCTGCTGGGTAGCTCT and hB2M R1: CCTCCATGATGCTGCTTACA. Sequence to amplify mitochondrial DNA was hmito F3: CACTTTCCACACAGACATCA and hmito R3: TGGTTAGGCTGGTGTTAGGG. Levels of CF mt-DNA were calculated with reference to the hB2M gene of cell free nuclear DNA in the serum of same samples.

Quantification of CF mt-DNA: Freely circulating mitochondrial and nuclear DNA contents in plasma and serum were quantified by qPCR(Magnetic Induction Cycler; BMS, Australia). Each run was monitored by a negative(no template) and a positive control. All the analyses were performed in triplicate. Real-time PCR was carried out using Eva green qPCR Master mix(Solis Biodyne, Estonia). Fold expression of CF mt-DNA was assessed by amplifying a unique mitochondrial fragment relative to hB2M gene as reference. CF mt-DNA fold expression was analyzed by Pfaffle method.10

ELISA of IL-6: IL-6 was quantified in serum samples of HIV, HBV and HCV infected individuals and healthy controls by IL-6 ELISA detection kit(Solar Bio, China) according to the manufacturer's protocol. Absorbance was measured at 450 nm on Multi-Skan Go(ThermoFisher Scientific, USA).

Statistical Analysis: Descriptive statistics were computed as mean +- SEM along with range using Statistical Package for Social Sciences(SPSS) version 22. Difference of CF mt-DNA in serum and plasma was calculated by t-test. Means of CF mt-DNA, IL-6 and viral load were compared using Analysis of Variance(ANOVA). Means of groups were further separated using Tukey's post-hoc test. Correlations among various parameters were drawn using the Spearman Rho correlation coefficient. A p value of <0.05 was considered significant and <0.001 was taken as highly significant.

RESULTS

Expression of CF mt-DNA in serum of HIV, HBV and HCV infected individuals: CF mt-DNA levels were calculated as 'fold increase' in comparison to healthy controls by real time PCR. A significant elevation of CF mt-DNA represented as mean +- SEM was observed in the serum of HIV(7.412 +-1.023), HBV(104.900 +- 26.335) and HCV patients(125.000 +- 13.391) as depicted in Fig.1A and Table-II. Presence of CF mt-DNA was significantly higher in HBV(p<0.001) and HCV(p<0.001) samples as compared to HIV as determined by One-way ANOVA and Tukey's post-hoc tests. There was no significant difference between the expression levels of CF mt-DNA in HBV and HCV patients(p=0.684).

Quantification of viral load in serum of HIV, HBV and HCV infected individuals: Viral loads were determined in all the three infections. Their comparison exhibited highest viral copy number for HCV represented as mean +- SEM(4.658 x 104 +- 0.682 x 104) followed by HBV(3.022 x 104 +- 0.545 x 104) and HIV(2.722 x 104 +- 0.674 x 104) as shown in Fig.1B and Table-II. High viral loads mean either the infection is untreated, or the body is not responding to the therapy. Although a trend was observed among the viral loads of HIV, HBV and HCV; however, the differences among the three groups were not statistically significant as determined by ANOVA probably due to high variance.

Measurement of IL-6 in serum of HIV, HBV and HCV infected individuals: IL-6 levels were measured in the serum of healthy controls as well as HIV, HBV and HCV infected individuals. Lowest IL-6 levels were observed in the healthy controls represented as mean +- SEM(4.833 +- 1.647 pg/ml) and a gradual increase was witnessed in HIV(9.320 +- 2.897), HBV(13.153 +- 1.765) and HCV(20.367 +- 4.536) infected individuals(Fig.1C and Table-II). Difference of IL-6 expression remained non-significant between HIV and HBV patients(p=0.795) and HBV and HCV patients(p=0.313); however, the difference between HIV and HCV patients was statistically significant(p=0.045). The control group IL-6 levels were lower than all infected groups but significantly lower than HCV patients only(p=0.002).

Table-II: Levels of CF mt-DNA, viral load and IL-6 in serum samples of HIV, HBV and HCV infected individuals.

###Infection###CF mt-DNA###Viral Load###Interleukin 6

###(fold increase)###(copy number)###(pg/ml)

###HIV###7.412 +- 1.023a###27,218.182 +- 6,736.226###9.320 +- 2.897

###7.0b(1-34)c###17,000(5,700-150,000)###5(0.20-87)

###HBV###104.900 +- 26.335###30,219.6667 +- 5,449.475###13.153 +- 1.765

###91.0(3-769)###17,500(1,000-98,000)###13(0.20-58)

###HCV###125.000 +- 13.391###46,584.500 +- 6,824.206###20.367 +- 4.536

###145.0(12-267)###45,339(1,200-98,000)###22(0.10-141)

Comparative expression of CF mt-DNA in HIV serum and plasma: Levels of CF mt-DNA in plasma and serum samples of HIV infected individuals were calculated. Comparative analysis showed significantly higher(p<0.0001) levels of CF mt-DNA in plasma(27.309 +- 5.029) of HIV infected individuals than their serum samples(7.413 +- 1.024) as shown in Fig.2A. However, both the values were independent of each other and the data did not indicate any significant correlation of CF mt-DNA in the serum and plasma samples of HIV infected individuals(Fig.2B).

Correlation between viral load and CF mt-DNA in serum samples of HIV, HBV and HCV: Spearman Rho correlation coefficient was used to see the relationship between CF mt-DNA and viral load. The viral load and CF mt-DNA both were elevated in infected individuals as compared to healthy controls; however, there existed no significant correlation between viral load and CF mt-DNA in serum of HIV, HBV and HCV infected persons as shown in Fig.3A-C and Table-III. Both the entities of viral load and CF mt-DNA were independent of each other.

Correlation between CF mt-DNA and IL-6 in serum samples of HIV, HBV and HCV: Presence of CF mt-DNA was also correlated with the inflammation marker IL-6. Despite of observing high CF mt-DNA and IL-6 in all the three infections as compared to healthy controls, a direct significant correlation was observed between the two entities only in HBV patients(R=0.432; p=0.017). No significant correlation was seen between CF mt-DNA and IL-6 in HIV and HCV infected individuals as depicted in Fig.3D-F and Table-III.

Table-III: Spearman Rho correlations among the CF mt-DNA, IL-6 and viral load in three infectious groups.

###Variables###HIV###HBV###HCV

###CF mt-DNA###IL-6###CF mt-DNA IL-6###CF mt-DNA###IL-6

###Interleukin 6###0.186a###0.432###0.056

###0.407b###0.017*###0.768

###Viral Load###-0.071###0.163###-0.234###0.135###0.144###0.034

###0.755###0.496###0.213###0.477###0.449###0.858

Correlation between viral load and IL-6 in serum samples of HIV, HBV and HCV: Viral load is naturally higher in viral infections and we saw high copy numbers in all the three infections. IL-6 levels were also higher in HIV, HBV and HCV as compared to healthy controls. However, no correlation of viral load and IL-6 was found in serum of HIV, HBV and HCV infected individuals as given in Fig.3G-I and Table-III.

DISCUSSION

HIV, HBV and HCV infections are a serious health burden in Pakistan.11-14 Diagnosis and point of care strategies require thorough understanding of infection's severity in the Pakistani population. Elevated CF mt-DNA levels have been observed in different pathophysiological conditions.15 This role of CF mt-DNA in different diseases make it an ideal candidate for its assessment in viral pathophysiology.

This study is the first to report the comparative analysis of CF mt-DNA in the serum of HIV, HBV and HCV infected individuals from Pakistan. We found higher CF mt-DNA levels in all infected individuals. A significant correlation was observed between CF mt-DNA and IL-6 in HBV infection while no such correlation was observed in HIV and HCV infections. Viral load was not significantly correlated to CF mt-DNA in any of the studied infections.

Elevated levels of CF mt-DNA in HCV infection is related to chronic and acute phases with progression into Hepatocellular carcinoma.16 Platelet activation is generally associated with elevated CF mt-DNA levels in serum.17 Platelet activation is increased in viral infections i.e. HIV and HBV which in turns is responsible for elevated CF mt-DNA levels.18 In case of HIV infection, integration of viral RNA into the host genome does not dictate the cell damage as it is evident in HBV and HCV infection. HIV induces apoptosis in the infected CD4 cells.19 During apoptosis, cellular contents are visualized, preventing CF mt-DNA to leach into the serum which may be a possible reason for less CF mt-DNA levels in serum of HIV than HBV and HCV in the present study. CF mt-DNA levels in plasma of HIV were higher than any other infection's serum CF mt-DNA levels. Plasma contains cellular artifacts and remnants of platelets mitochondrial content which can be reason for higher CF mt-DNA levels.

IL-6 is generally known to play a dual role in inflammation by acting as anti-inflammatory cytokine through classic signaling and pro-inflammatory cytokine through trans-signaling. In the present study, IL-6 levels were also elevated in HIV, HBV and HCV infected individuals in comparison to healthy controls. IL-6 levels in HBV were elevated possibly due to suppressed antigen processing by Kupffer cells as reported earlier.20

Levels of IL-6 in HCV infected individuals have been reported to increase in chronic cases, prior to IFN-Gamma therapy and in non-responders to therapy.21 Serum and plasma levels of IL-6 also rise in HIV infection because of its primary role in the increased differentiation of polyclonal beta cells.22 HCV infected individuals exhibited higher levels of IL-6 in the serum than HBV and HIV. IL-6 is produced in response to infection and its levels are increased in most of the infections.23 HCV infection induces the production of IL-6 through the enhanced expression of Toll Like Receptor 4(TLR-4).24 Higher IL-6 levels also indicate liver cirrhosis and liver fibrosis in chronic cases of HCV infection.25 While in case of HBV infection, increased replication of HBV decreases the levels of IL-6 due to the unabated nucleo-capsid formation.26

Increased levels of IL-6 in HCV infected individuals and decreased levels in HBV infected individuals both suggest the severity of these infections independent of their viral load, while IL-6 levels in HIV infected individuals suggest lower virulence of HIV among the infected individuals. No causal relationship between viral load and IL-6 levels has been reported earlier.27

Limitations of the study: Only patients with mono-infection were recruited for this study. Other infections i.e. HCV, HBV and TB which are commonly associated with HIV infection among Pakistani population are not represented in this study. Also, all the patients in this study were therapy-naive. To further elucidate the role of CF mt-DNA as a biomarker for disease severity, patients on therapy should be included to assess the effectiveness of therapy and alterations in the levels of CF mt-DNA.

CONCLUSION

The present study is the first to elucidate the levels of CF mt-DNA in HIV, HBV and HCV infections among Pakistani population. Higher levels of CF mt-DNA were associated with viral infections. Elevated levels of CF mt-DNA did not co-relate with viral load in all the studied infections among the Pakistani population. This requires further investigation of the genetic variability of viral genomes which can be related to drug resistance and a possible link to increased inflammation resulting in the elevated levels of CT mt-DNA.

Declaration of interest statement: The authors declare no conflicts of interest.

Funding Source: The project has been supported financially by Higher Education Commission Grant No. NRPU 4481 to M. A. Research associate funding is being provided to Z.A. in the same project.

REFERENCES

1. West AP, Shadel GS, Ghosh S. Mitochondria in innate immune responses. Nat Rev Immunol. 2011;11(6):389-402. doi: 10.1038/nri2975

2. Boyapati RK, Rossi AG, Satsangi J, Ho G-T. Gut mucosal DAMPs in IBD: from mechanisms to therapeutic implications. Mucosal Immunol. 2016;9(3):567-582. doi: 10.1038/mi.2016.14

3. Arnalich F, Maldifassi MC, Ciria E, Codoceo R, Renart J, Fernandez-Capitan C, et al. Plasma levels of mitochondrial and nuclear DNA in patients with massive pulmonary embolism in the emergency department: a prospective cohort study. Crit Care. 2013;17(3):R90.doi: 10.1186/cc12735

4. Frank MO. Circulating Cell-Free DNA Differentiates Severity of Inflammation. Biol Res Nurs. 2016;18(5):477-488. doi: 10.1177/1099800416642571

5. Collins LV, Hajizadeh S, Holme E, Jonsson I-M, Tarkowski A. Endogenously oxidized mitochondrial DNA induces in vivo and in vitro inflammatory responses. J Leukoc Biol. 2004;75(6):995-1000. doi: 10.1189/jlb.0703328

6. Breen EC, Rezai AR, Nakajima K, Beall RT, Mitsuyasu RT, Hirano T, Kishimoto T, et al. Infection with HIV is associated with elevated IL-6 levels and production. J Immunol. 1990;144(2):480-484.

7. Selik RM, Linley L. Viral loads within 6 weeks after diagnosis of HIV infection in early and later stages: Observational study using national surveillance data. J Med Internet Res. 2018;20(11):1-12. doi: 10.2196/10770

8. Sambrook J, Russell DW. Purification of Nucleic Acids by Extraction with Phenol: Chloroform. Cold Spring Harb Protoc. 2006;2006(1):4455. doi: 10.1101/pdb.prot4455

9. Malik AN, Shahni R, Rodriguez-de-Ledesma A, Laftah A, Cunningham P. Mitochondrial DNA as a non-invasive biomarker: Accurate quantification using real time quantitative PCR without co-amplification of pseudogenes and dilution bias. Biochem Biophys Res Commun. 2011;412(1):1-7. doi: 10.1016/j.bbrc.2011.06.067

10. Pfaffl MW. Relative expression software tool(REST(C)) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002;30(9):e36. doi: 10.1093/nar/30.9.e36

11. Rai MA, Warraich HJ, Ali SH, Nerurkar VR. HIV/AIDS in Pakistan: The battle begins. Retrovirology. 2007;4:3-5. doi: 10.1186/1742-4690-4-22

12. Asif A, Ayub S, Komal A, Noor S, Jalal U. Prevalence of human immunodeficiency virus anhepatitis(B and C) among drug users in a tertiary care public hospital. Pak J Med Sci. 2019:35(2):459-463. doi: 10.12669/pjms.35.2.500

13. Maan M, Hussain F, Jamil M. Prevalence and risk factors of HIV in Faisalabad, Pakistan-A retrospective study. Pak J Med Sci. 2014;30(1):32-35. doi: 10.12669/pjms.301.4176

14. Asad M, Ahmed F, Zafar H, Farman S. Frequency and determinants of Hepatitis B and C virus in general population of Farash Town, Islamabad. Pak J Med Sci. 2015;31(6):1394-1398. doi: 10.12669/pjms.316.7047

15. Bonacini M, Louie S, Bzowej N, Wohl AR. Survival in patients with HIV infection and viral hepatitis B or C: A cohort study. Aids. 2004;18(15):2039-2045. doi: 10.1097/00002030-200410210-00008

16. Lipschitz DA, Udupa KB, Milton KV, Thompson CO. Effect of Age on Hematopoiesis in Man. Blood J. 2019;63(3):502-509. doi: 10.1182/blood.V63.3.502.502

17. Lida M., Lizuka N, Sakaida I, Moribe T, Fujita N, Miura T, et al. Relation between serum levels of cell-free DNA and inflammation status in hepatitis C virus-related hepatocellular carcinoma. Oncol Rep. 2008;20:761-765. doi: 10.3892/or_00000071

18. Fusegawa H, Shiraishi K, Ogasawara F, Shimizu M, Haruki Y, Miyachi H, et al. Platelet activation in patients with chronic hepatitis C. Tokai J Exp Clin Med. 2002;27(4):101-106.

19 Turhan O, Coban E, Inan D, Yalcin AN. Increased mean platelet volume in chronic hepatitis B patients with inactive disease. Med Sci Monit. 2010;16(4):202-205.

20. Heinz D, Peters M, Prange R, Gerken G. Possible role of human interleukin-6 and soluble interleukin-6 receptor in hepatitis B virus infection. J Viral Hepat. 2001;8(3):186-193. doi: 10.1046/j.1365-2893.2001.00281.x

21. Lapinski TW. The levels of IL-1beta, IL-4 and IL-6 in the serum and the liver tissue of chronic HCV-infected patients. Arch Immunol Ther Exp(Warsz). 2001;49(4):311-316.

22. Honda M, Kitamura K, Mizutani Y, Oishi M, Arai M, Okura T, et al. Quantitative analysis of serum IL-6 and its correlation with increased levels of serum IL-2R in HIV-induced diseases. J Immunol. 1990;145(12):4059-4064.

23. Borges AH, O'Connor JL, Phillips AN, Ronsholt FF, Pett S, Vjecha MJ, et al. Factors Associated with Plasma IL-6 Levels during HIV Infection. J Infect Dis. 2015;212(4):585-595. doi: 10.1093/infdis/jiv123

24. Hirano T, Yasukawa K, Harada H, Taga T, Watanabe Y, Matsuda T, et al. Complementary DNA for a novel human interleukin(BSF-2) that induces B lymphocytes to produce immunoglobulin. Nature. 1986;324:73-76. doi: 10.1038/324073a0

25. Machida K, Cheng KTH, Sung VM-H, Levine AM, Foung S, Lai MMC. Hepatitis C Virus Induces Toll-Like Receptor 4 Expression, Leading to Enhanced Production of Beta Interferon and Interleukin-6. J Virol. 2006;80(2):866-874. doi: 10.1128/jvi.80.2.866-874.2006

26. Nakagawa H, Maeda S, Yoshida H, Tateishi R, Masuzaki R, Ohki T, et al. Serum IL-6 levels and the risk for hepatocarcinogenesis in chronic hepatitis C patients: An analysis based on gender differences. Int J Cancer. 2009;125(10):2264-2269. doi:10.1002/ijc.24720

27. Shah S, Ma Y, Scherzer R, Huhn G, French A, Plankey M, et al. Association of HIV, HCV and Liver Fibrosis Severity with IL-6 and CRP levels. AIDS. 2015;29(11):1325-1333. doi: 10.1097/QAD.0000000000000654
COPYRIGHT 2020 Knowledge Bylanes
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2020 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Zain Ali, Shahid Waseem, Riffat Aysha Anis and Mariam Anees
Publication:Pakistan Journal of Medical Sciences
Geographic Code:9PAKI
Date:Aug 8, 2020
Words:3846
Previous Article:Artificial intelligence in medical education: Are we ready for it?
Next Article:Comparison of mean pain score using topical and oral metronidazole in post milligan morgan hemorrhoidectomy patient; A randomized controlled trial.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |