Printer Friendly

Asociacion del gen ELMO1 (snp rs1345365) con el desarrollo de diabetes mellitus tipo 2 en poblacion mestiza Mexicana.

Association of the ELMO1 gene (snp rs1345365) with development of type 2 diabetes mellitus in the Mexican mestizo population.

INTRODUCCION

La diabetes mellitus tipo 2 (DM2) es una enfermedad multifactorial con umbral, que depende de la interaccion entre genes y el medio ambiente. Dado que la DM2 es un problema de salud publica, se han identificado prioritariamente numerosos factores de riesgo. Una de las estrategias empleadas en la busqueda de genes candidatos son los estudios epidemiologicos. En este sentido existen diferentes ejes como factores de predisposicion, tales como la resistencia a la insulina, disfuncion de las celulas beta asi como defectos del sistema incretinico (1). Sin embargo, hay que considerar que la complejidad de la DM2 estriba en la sobre-posicion, en una misma familia, con otras formas de diabetes. Las frecuencias de formas puras asi como de co-herencia de diabetes no se han estimado, de tal manera que muchos de los estudios de asociacion reportados arrojan cierto sesgo de informacion (2). Por otra parte, trabajos de genes asociados a DM2 en Mexico estan justificados considerando dos premisas; la primera es la diversidad genetica de la poblacion, tambien teniendo en cuenta que los estudios previos no evidencian la exclusion de formas superpuestas. En una revision que recopila los resultados de los estudios realizados de la genetica en DM2 durante los ultimos 15 anos se muestra que, en Mexico, los estudios de genes candidatos han sido enfocados en estudiar variantes polimorficas relacionadas con el desbalance energetico, metabolismo de lipidos, resistencia a la insulina, disfuncion de las celulas beta, asi como morfogenesis del pancreas (2). Entre los genes asociados encontrados estan: CPN10 en poblacion/cohorte de la region del norte-oeste, APOE, BGLAP, CPN10, hIAPP, SCARB1, asi como TNFA que se identificaron en poblaciones de la region occidente. En la region del centro del pais los genes ABCA1, APOE, CPN10, LOC87761, MGEA5 y TCFL2. Mientras que en el sur estan asociados CPN10, INS, IRS1 e INRS; se conocen a la fecha mas de 50 genes asociados (2-15).Dado el componente poligenico de la DM2 que muestra una gran heterogeneidad molecular, se requiere explorar nuevos genes relacionados con otras vias metabolicas. En este sentido, un eje de trabajo retomado en el estudio de la DM2 son los genes candidato relacionadas con el metabolismo de la matriz extracelular (ME).

La ME esta conformada por moleculas interactuantes de la membrana celular y del citoesqueleto. Algunas de ellas son: colagena tipo I, fibronectina, elastina, fribrilina, laminina A/C. La evidencia que sugiere la participacion de estas proteinas en la DM2 son los reportes de variantes en LMNA. Estas mutaciones producen lipodistrofia congenita con resistencia a la insulina y la progeria de Hutchinson-Gilford, que cursa con rasgos del sindrome metabolico (16-18). Por lo anterior se propone al gen ELMO1 (engulfment and cell motility protein 1) como candidato para DM2 por los siguientes motivos: 1. la proteina de inmersion y motilidad celular es regulada por los niveles de glucosa; 2. porque media la activacion transcriptional del TGF[beta]1, el cual a su vez incrementa la expresion de mas genes de la ME como colagena tipo 1, LMNA y fibronectina (19-20); 3. porque ELMO1 presenta diferentes polimorfismos localizados en los intrones 13, 19, 18 y 17 (rs1345365, rs1558688, rs741301 y rs7799004), algunos de ellos identificados previamente como factores de riesgo para nefropatia diabetica como el SNP rs 1345 3 65 (19-22). Sin embargo, no se ha establecido asociacion de esta variante con DM2. Por ello en el presente estudio, el objetivo fue estudiar si el polimorfismo rs1345365 de ELMO1 es un factor de susceptibilidad para el desarrollo de DM2.

PACIENTES Y METODOS

a) Seleccion de pacientes. De un total de 900 pacientes masculinos diabeticos de recien diagnostico captados en enero de 2003, con seguimiento mensual a diciembre 2013, se seleccionaron 148 diabeticos tipo 2 con los siguientes criterios: Grupo 1 (n=296 cromosomas); evolucion de la diabetes de 9 anos o mas, edad de inicio entre los 35-55 anos, manejo exclusivo con metformina (850 mg/cada 12 h, hemoglobina glucosilada A1c del 6,5%, historia familiar negativa para DM tipo 1, DM con sordera, DM neonatal, DM latente autoinmune, asi como para diabetes del adulto en jovenes (MODY). Tambien se considero historia familiar negativa de lupus eritematoso, tiroiditis, endocrinopatias, DM gestacional, enfermedad renal terminal o hepatopatia cronica. En cuanto a los estudios de laboratorio, se eligieron aquellos que presentaran datos negativos o dentro del rango normal los siguientes: auto-anticuerpos contra la descarboxilasa del acido glutamico (GAD65), auto-anticuerpos contra el receptor de insulina y auto-anticuerpos contra la tiroperoxidasa (anti-TPO). La prueba para la deteccion de microalbuminuria y mucopolisacaridos (MPS) urinarios negativos durante los ultimos 5 anos en su control bimestral. Peso al nacimiento entre 2,83,5 kilogramos.

Por otra parte, para formar 2 grupos control, se incluyeron 425 pacientes con edad comprendida entre 35-55 anos con los mismos antecedentes heredo familiares que el grupo anterior; un primer grupo conformado por 156 pacientes (312 cromosomas) sin diabetes pero con tres o mas factores de riesgo cardiovascular (sindrome metabolico o SM) (23) durante los ultimos 10 anos en su historia clinica (colesterol total >220 mg/dL, trigliceridos totales >170 mg/dL, presion arterial [mayor que o igual a] 140/90 mmHg, indice de masa corporal >25, AST (aspartato amino transferasa) y ALT (alanina amino transferasa) tres veces aumentadas sobre el valor normal). Un segundo grupo conformado por 269 (538 cromosomas) personas sanas. Ambos grupos con test negativos para anticuerpos anti-GAD65, anti-TPO, anti-receptor de insulina, microalbuminuria y MPS. Este ultimo grupo corresponde a personas previamente enroladas en el estudio "Polimorfismo g.37190613 G>A del gen ELMO1 en poblacion mexicana, marcador potencial para la patologia clinico-quirurgica"

Todas las personas incluidas en el presente estudio fueron de ancestria mestiza, nacidas en Mexico, con un apellido de origen espanol y ancestros de origen mexicano tres generaciones hacia atras. Todos firmaron la carta de consentimiento informado. Este trabajo formo parte del proyecto Estudio de Tamizaje Poblacional para la Identificacion de Factores de Riesgo Ambientales y Geneticos Asociados al Desarrollo de Enfermedades Complejas Relacionadas con la Nutricion en Poblacion del Sur y del Occidente de Mexico, con numero de registro IISSP/BAMM/03, aprobado por los comites de Investigacion, Etica y Bioseguridad. El presente estudio se llevo a cabo acorde a la declaracion de Helsinki, revisada en el 2008.

b) Caracterizacion bioquimica. La cuantificacion de colesterol, trigliceridos totales AST y ALT fueron determinados espectrofotometricamente usando los kits de Biosytem, la hemoglobina glucosilada A1c se cuantifico por turbimetria y la microalbuminuria se detecto por tira reactiva MicroalbuPHAN. Los anticuerpos anti-GAD65 (normal 0,0-1,45 U/mL), contra el receptor de insulina (<0,5 U/mL) y anti-TPO (Normal 0,03-9U/mL) se realizaron por radioinmunoanalisis, el primero y los dos ultimos por enzimo-inmuno ensayo. La identificacion de MPS en orina se realizo mediante la prueba de la albumina acida, y el aislamiento de mucopolisacaridos se realizo por la precipitacion con el cloruro de cetilpiridinio, bajo las condiciones reportadas por Pennock y Graddock (24-26).

c) Caracterizacion molecular. Se obtuvieron cinco mililitros de sangre periferica de cada probando y se transfirieron en un tubo con EDTA para posteriormente aislar el DNA mediante un kit comercial (Gene Catcher, Invitrogen). El SNP rs1345365 se determino por PCR amplification of specific alleles (PASA) con los iniciadores, programa de amplificacion, mezcla de reaccion y electroforesis en geles de poliacrilamida (PAGE), reportadas previamente (27,28). Iniciadores: 5 CACTTCTTCCCCTACAACACTGA'3, R35GAGGAACTTTAGAAGAATGTA-3 '. En los controles, asi como poblacion general, las reacciones de PCR y electroforesis fueron realizadas por triplicado para corroborar el genotipificado. Programa de amplificacion: 25 ciclos; 95[grados]C 3 min (desnaturalizacion inicial), 95[grados]C, 30 seg (desnaturalizacion), 52[grados]C, 45 seg (hibridacion), 72[grados]C, 30 seg (polimerizacion), extension final de 72[grados]C, 3 min. Mezcla de reaccion: KCl 1,5 [micron]L (1X), Mg[Cl.sub.2] 0,45 [micron]L (1,5 mM), 0,3 [micron]l de dNTPs (0,2 mM), 1 [micron]L de cada iniciador (12,5 pmoles), 2 [micron]L de templado de ADN (200ng), DNA Pol Taq 0,3 [micron]L (1,5 U) (Invitrogen), 10,45 [micron]L de agua. Electroforesis: Los productos de PCR se analizaron en geles de poliacrilamida, proporcion 19:1 al 7%, con buffer TBE 1X, con un corrimiento de 2,5 horas a 180 volts y 66 mA. La visualizacion de los productos de PCR en los geles, se realizo mediante tincion con nitrato de plata 0,1 g/100 mL. Los productos se diferenciaron por los tamanos; el de 198 pb corresponde al alelo G, mientras que el de 203 pb revelo al alelo A.

d) Analisis estadistico. Se estimo la frecuencia alelica y genotipica en los grupos de estudio por conteo directo; su distribucion en los grupos de estudio analizados se evaluo al considerar las diferencias en las frecuencias observadas asi como las esperadas mediante una [X.sup.2]>3,84 y una p<0,05. El equilibrio Hardy Weinberg (EHW) se considero cuando las diferencias en las frecuencias genotipicas observadas y esperadas no fueron significativas, con un valor de [X.sup.2]<3,84, p>0,05 (29).

Desde el punto de vista epidemiologico se analizaron dos aspectos; por una parte, la medicion de la asociacion del SNP rs1345365 con el desarrollo de DM2 y, por otra, la identificacion del impacto -como factor de riesgo- que tienen los alelos y/o genotipos derivados de este SNP (30).

La evaluacion de la asociacion se realizo bajo diferentes modelos; dominante, recesivo, sobre dominante, para-dominante, co-dominante asi como aditivo para obtener la razon de riesgo (31). El grado de asociacion se establecio acorde a la escala de Hanler para la razon de riesgo (ORs) (32). Para este caso, se consideraron significativos valores de [X.sup.2]>9,21, p<0,01 para dos colas; el intervalo de confianza aceptable fue de 99%.

El impacto del SNP rs 1345365 se realizo estimando el valor relativo de la fraccion prevenible en la poblacion (FPP), fraccion prevenible en expuestos (FPE), asi como la tasa de desarrollo o fraccion etiologica en la poblacion o riesgo atribuible (FEP). La FEP es un valor porcentual que permite identificar que porcion de casos que aparecen en una comunidad son atribuibles a la exposicion del factor de riesgo (30). La FPP es tambien un valor porcentual, estima cuando el factor de exposicion (alelo y/o genotipo) produce una disminucion en el riesgo (30). La FPE es un valor que se estima en poblacion de expuestos en un estudio de casos y control, representando la proporcion reducida en la tasa de incidencia del evento en salud (DM2) si se eliminara la exposicion en los portadores de los diferentes alelos y genotipos (30).

Para obtener los valores de parametros de asociacion de impacto, anteriormente citados, se utilizo el programa estadistico Epi-Info version 7.1.5 (https://wwwn.cdc.gov/epiinfo/7/index.htm). En los casos en los que se presentaban valores <5 en las tablas de contingencia, la asociacion e impacto se valido por la X2 con correccion de Yates.

RESULTADOS

a) Distribucion de alelos: Al comparar la distribucion de alelos del SNP rs1345365 se encontro que el alelo G estuvo presente con una mayor frecuencia en los diabeticos (60%), mientras que el alelo A fue mayor en personas con SM (72%) y en individuos sanos (84%) (Fig. 1A). Estas diferencias en la distribuciones alelicas, al estimar la razon de riesgo, mostraron una asociacion debil, siendo el alelo A un factor protector para DM2 con valores de ORs=0,7 y 0,65 respectivamente, explicando una FPE entre el 23-34,57% (Tabla I).

b) Distribucion de genotipos: Al comparar la distribucion de genotipos entre los grupos de estudio se muestra el heterocigoto con mayor frecuencia en los diabeticos (75%), asi como tambien en controles con SM (66%). Los homocigotos A/A tienen una frecuencia menor en personas sanas (34%) (Fig.1B). El homocigoto G/G corresponde al 2,6% del grupo de estudio asi como al 1,3 % de la poblacion total y es exclusivo de los diabeticos (Fig. 1B).La distribucion genotipica se encontro en EHW en la poblacion total; [X.sup.2]<3,84, p=0,05, mientras el grupo DM2 presento desviacion del equilibrio X26,99, p=0,001.

c) Analisis de asociacion e impacto epidemiologico entre diabeticos y controles con SM: El analisis de asociacion de genotipos del SNP rs1345365 mostro que el modelo dominante explica mejor el desarrollo de DM2 con una asociacion moderada ORs=0,5768. Lo que sugiere que una unica copia del alelo A es suficiente como factor protector (Tabla IA). Mientras que el modelo para-dominante explica que la presencia de un alelo G es determinante como factor de riesgo ORs=1,5 (Tabla IA). Los resultados de los modelos co-dominante y sobredominante mostraron una asociacion moderada, siendo el genotipo homocigoto A/A protector para el desarrollo de DM2; ORs=0,5858 y 0,5976, respectivamente. La limitante para este ultimo modelo es que no se detectaron homocigotos G/G en los controles con SM (Tabla II).

Los genotipos del SNP rs 1345365 mostraron valores mas significativos para el modelo dominante y para-dominante, con una FPP del 14,06% y una FPE de 42,32%, asi como FPP de 36,38 y FEP 27,62%, respectivamente (Tabla IA).

d) Analisis de asociacion e impacto epidemiologico entre diabeticos y controles sanos: La asociacion de genotipos del SNP rs 1345365 entre diabeticos y controles sanos mostro que el alelo A es un factor de proteccion para DM2 mediante los modelos dominante, sobre-dominante, co-dominante y recesivo (p<0,01)(Tabla IB). Mientras el modelo para-dominante mostro una tendencia como factor de predisposicion (p=0,05178) (Tabla IB). El modelo con mayor impacto fue el modelo dominante, el cual mostro al genotipo homocigoto A/A como factor de proteccion con una FPP del 16,37% y una FPE de 46,74%.

e) Analisis de asociacion e impacto epidemiologico entre personas sanas y controles con SM: Finalmente, al comparar la distribucion de genotipos del SNP rs1345365 en los grupos controles (personas con SM y sanas), se encontro asociacion moderada para SM mediante el modelo co-dominante en el cual el genotipo homocigoto A/A es protector p=0,0225 con un impacto de FPP del 56,10% y FPE de 58% (Tabla IC).

DISCUSION

Este es el primer estudio que sugiere asociacion, asi como impacto epidemiologico del SNP rs1345365 del gen ELMO1 con el desarrollo de DM2. Encontramos, por el modelo dominante, que el alelo silvestre (A) es un factor de proteccion, mientras que el alelo ancestral (G) es un factor de predisposicion. Por otra parte, el modelo para-dominante mostro que cuando se pierde una copia del alelo silvestre (A), como en el caso de los portadores heterocigotos, aumenta el riesgo. Un efecto similar se observo en el desarrollo de SM, (Tabla IA y IB), resultando el genotipo homocigoto A un factor protector. Estos resultados sugieren que el alelo ancestral (G) es un factor de predisposicion para DM2 y SM.

En afroamericanos, el alelo A del SNP rs1345365 es un factor protector para la nefropatia en pacientes diabeticos; sin embargo, en esta poblacion no se encontro asociacion con DM2 (21). En otros estudios se ha reportado perdida de la asociacion del SNP con nefropatia diabetica (19, 21,22). Estas diferencias estan relacionadas con la diversidad genetica, la heterogeneidad molecular y con la naturaleza multifactorial de la DM2 (1). Esto es lo esperado, considerando que el efecto aditivo entre genes y factores ambientales es lo que determina el umbral para el desarrollo de DM2 (2).

Los resultados sugieren una posible asociacion del SNP rs1345365 como factor de susceptibilidad para DM2 y para SM, dado que de eligieron controles sin dano renal sub-clinico o clinico, validado por la prueba negativa de microalbuminuria, asi como los ensayos negativos para los mucopolisacaridos y niveles bajos de hemoglobina glucosilada A1c, que son indicadores del grado de control metabolico (26,33). Aunque el genotipo homocigoto G/G es exclusivo en los diabeticos, no se puede aseverar que la doble dosis del alelo G aumente el riesgo, ya que esta ausente en los grupos control. En dos reportes previos de poblacion sana en Mexico, no se encontraron homocigotos G/G. Datos similares se han reportado en residentes de Los Angeles con ancestria mexicana, asi como en poblaciones asiatica, toscana italiana y residentes de Utah del norte y occidente con ancestria europea (Tabla II) (27,28).

Por lo anterior se propone que la baja frecuencia del genotipo homocigoto G/G en la poblacion mexicana, puede estar relacionada con los efectos del mestizaje que se dio entre amerindios, espanoles y africanos durante la conquista. Los heterocigotos aumentaron y conservaron la frecuencia de genotipos y alelos, como en algunas poblaciones con ancestria africana (Tabla II). Esto sugiere un efecto fundador en Africa para el polimorfismo SNP rs1345365 (28).

En estudios de casos y controles es comun que se reporten valores de la prueba equilibrio Hardy Weinberg (EHW), pero el sesgo de informacion estriba en que se consideran los controles como poblacion general, lo cual es erroneo porque es una poblacion seleccionada y, por lo tanto, de entrada el EHW esta desviado (29-31). En el presente trabajo no hay sesgo informativo ya que el EHW se estimo en la muestra total de probandos incluidos, considerando que los tres grupos de estudio pertenecen a una misma poblacion. Ademas, en este trabajo se incluyeron probandos enrolados en estudios previos realizados en Mexico, en los cuales ya se habia reportado el equilibrio EHW para SNP rs 1345365 (26,27).Estos estudios, en su conjunto, muestran que el marcador polimorfico tiene una alta verosimilitud para estudios de asociacion, descartandose tambien errores de genotipificacion. Del mismo modo en esta investigacion se reportan las frecuencias de alelos asi como de genotipos en pacientes con SM y DM2 de poblacion mexicana (Tablas I A, B y C), lo cual no se habia investigado previamente (Tabla II). El grupo con DM2 presento una desviacion EHW que permitio inferir el efecto que tiene un SNP en la enfermedad, incrementando o disminuyendo el numero de heterocigotos (Fig. 1B).

Hay que considerar que el SNP rs1345365 esta en desequilibrio de ligamiento con otros SNP en el intron 13 de ELMO1, region altamente conservada por lo que es posible que contenga elementos regulatorios transcripcionales (21). Esto podria llevar a un sesgo, ya que la DM2 podria estar no solamente asociada al SNP analizado, sino tambien a un haplotipo conformado con alelos de otros marcadores del mismo intron con los cuales segregan en bloque. Sin embargo, esta hipotesis en poblacion mexicana necesita ser explorada con analisis funcional de las secuencias conservadas durante la evolucion.

Para evitar sesgos de informacion en estudios de asociacion en diabetes, se deben considerar los elementos de la complejidad en el diseno metodologico, como los multiples ejes metabolicos, la co-existencia de diferentes tipos de diabetes en una misma familia y la impronta genetica (2). Desde el punto de vista epidemiologico, este estudio es el primero en el que solo fueron considerados para el analisis probandos cuyo componente fuera la resistencia a la insulina (DM2 puros). El hecho que se considere solo probandos para el analisis cuyo componente sea la resistencia a la insulina (DM2 puros), esto permite sugerir que el SNP rs1345365 es un factor de predisposicion, tal como se ha reportado para las variantes en LMNA (16-18). La inclusion de probandos entre los 35-55 anos nos permitio excluir a la diabetes MODY y la diabetes de inicio en el adulto mayor, eliminando los sesgos de confusion asi como de informacion (31).

El bajo peso al nacimiento esta relacionado con una disminucion de la masa de celulas beta e impronta como factores en la genesis de la DM2 (34). En el presente trabajo se pudo descartar parcialmente este efecto, ya que se excluyeron pacientes con bajo peso al nacimiento (35). Por otra parte, el sesgo del recuerdo esta eliminado ya que el peso al nacimiento fue verificado en el certificado de nacimiento (31).

Acorde con la escala Hanler, la asociacion moderada con DM2 del SNP rs1345365 de ELMO1 debera ser corroborada en otras poblaciones y replicada en Mexico por otros estudios de seguimiento a largo plazo (32). Si se considera el componente poligenico y la baja penetrancia de la DM2, un solo marcador genetico no puede explicar por completo todos los casos como se observo en el presente trabajo (2). El analisis de impacto, para el modelo dominante y para dominante al comparar DM2 y los controles con SM arrojo valores de FPP del 14,06% y una FPE de 42,32% asi como, FPP de 36,38 y FEP 27,62%.

El hecho que el SNP de ELMO1 analizado este asociado con DM no permite concluir contundentemente que es un agente causal que modifica el riesgo, pero si es sugestivo (31). Tres estudios apoyan tal sugerencia; uno realizado en mestizos Mexicanos de la ciudad de Mexico en los que se analizaron 24 genes asociados a DM2 en diferentes poblaciones europeas, en el cual se encontro correlacion con los SNP rs 13266634 (SLC30A8), rs7923837 (HHEX), rs 10811661 (CDKN2A/2B), rs4402960 (IGF2BP2), rs 12779790 (CDC123/CAMK1D) y rs2237892 (KCNQ1)(36). El segundo, del tipo de busqueda exhaustiva del genoma, realizado en 8214 Mexicanos y Latinos con 9,2 millones de polimorfismos revelo otros dos genes, SLC16A11 y SLC16A13. Este ultimo gen candidato esta relacionado con el metabolismo de lipidos (37). El tercer estudio, llevado a cabo en probandos de la Ciudad de Mexico, con variantes en 14 genes candidato para sindrome metabolico, mostro que las variantes en TCF7L2 estaban fuertemente correlacionadas con la DM2 y otro nuevo marcador asociado; el SNP rs4994 del gen ADRB3 (38).

Considerando las anteriores premisas y la diversidad de la poblacion mexicana, se requiere hacer mas estudios de replica de genes asociados, como el realizado en diabeticos de las ciudades de Guerrero y Mexico en el que solo se encontro asociacion para variantes en IRS1 y TCF7L2 (39). Sin embargo, tambien seran necesarios estudios funcionales in vivo asi como in vitro que demuestren un efecto biologico diferente de la variante ancestral en comparacion con el alelo mas frecuente, no solo para el polimorfismo rs1345365 de ELMO1 sino tambien para los otros SNP que se han encontrado asociados a la DM2 en los mexicanos.

Finalmente, hay que considerar que la mala alimentacion asi como la pobreza son factores de riesgo, en las sociedades postcoloniales como la mexicana, para el desarrollo de enfermedades complejas, incluyendo la DM2. Estas se caracterizan por la mala alimentacion, abundancia de comidas con alto contenido energetico y resistencia a la insulina (RI). La hipotesis del genotipo ahorrador postula que los genes responsables de la RI protegieron a los individuos durante periodos prolongados de ayuno en la cuarta glaciacion, al almacenar energia en forma de grasa en vez de glucogeno en el tejido muscular. Esto permitio la seleccion positiva de los pobladores migrantes. Este genotipo, heredado en las sociedades postcoloniales actuales, se convierte en un mecanismo de dano porque estos individuos no estan disenados para la ingesta abundante, lo cual se refleja en el aumento de la incidencia de obesidad, sobrepeso, dislipidemias, e hipertension arterial; el gen ELMO1 podria ser parte de este genotipo (2,40).

Por las mismas consideraciones, el alelo ancestral G podria ser tambien un factor de riesgo para el desarrollo de SM (Tabla II). Sin embargo, se requieren estudios que amplien la muestra poblacional de personas sanas y con SM (18).

En conclusion, el presente estudio sugiere la asociacion del SNP rs1345365 del gen ELMO1 con el desarrollo de DM2 clinicamente pura, cuyo fenotipo principal por mas de 10 anos ha sido la resistencia a la insulina, independientemente de la susceptibilidad genetica a la nefropatia diabetica. Ademas apunta al estado homocigoto A/A como protector para el desarrollo de SM.

Recibido: 9-07-2014 Aceptado: 24-09-2015

REFERENCIAS

(1.) Rosales-Gomez RC, Lopez-Jimenez J de J, Nunez-Reveles NY, Gonzalez-Santiago AE, Ramirez-Garcia SA. Type 2 diabetes nephropathy: a thresholds complex trait and chromosomal morbid map. Rev Med Inst Mex Seguro Social 2010; 48: 521-530

(2.) Ramirez-Garcia SA, Cabrera-Pivaral CE, Huacuja-Ruiz L, Flores-Alvarado LJ, Perez-Garcia G, Gonzalez-Rico JL, Lopez-Velazquez A, Topete-Gonzalez LR, Rosales-Gomez RC, Candelario-Mejia G, Villa-Ruano N. Implications in primary health care of medical genetics and genomic in type 2 diabetes mellitus. Rev Med Inst Mex Seguro Social 2013; 51: e6-e26.

(3.) Villarreal-Molina MT, Flores-Dorantes MT, Arellano-Campos O, Villalobos Comparan M, Rodriguez-Cruz M, Miliar-Garcia A, Huertas-Vazquez A, Menjivar M, Romero-Hidalgo S, Wacher NH, Tusie-Luna MT, Cruz M, Aguilar-Salinas CA. Association of the ATP-binding cassette transporter A1 R230C variant with early-onset type 2 diabetes in a Mexican population. Diabetes 2008;57(2): 509-513.

(4.) Del Bosque-Plata L, Aguilar-Salinas CA, Tusie-Luna MT, Ramirez-Jimenez S, Rodriguez-Torres M, AuronGomez M, Ramirez E, Velasco-Perez ML, Ramirez-Silva A, Gomez-Perez F, Hanis CL, Tsuchiya T, Yoshiuchi I, Cox NJ, Bell GI. Association of the calpain-10 gene with type 2 diabetes mellitus in a Mexican population. Mol Genet Metab 2004;81(2): 122-126.

(5.) Parra EJ, Cameron E, Simmonds L, Valladares A, McKeigue P, Shriver M, Wacher N, Kumate J, Kittles R, Cruz M. Association of TCF7L2 polymorphisms with type 2 diabetes in Mexico City. Clin Genet 2007; 71(4): 359-566.

(6.) Cameron EA, Martinez-Marignac VL, Chan A, Valladares A, Simmonds LV, Wacher N, Kumate J, McKeigue P, Shriver MD, Kittles R, Cruz M, Parra EJ. MGEA5-14 polymorphism and type 2 diabetes in Mexico City. Am J Hum Biol 2007;19(4): 593-596.

(7.) Gutierrez-Vidal R, Rodriguez-Trejo A, Canizales-Quinteros S, Herrera-Cornejo M, Granados-Silvestre MA, Montufar-Robles I, Ortiz-Lopez MG, Menjivar M. LOC387761 polymorphism is associated with type 2 diabetes in the Mexican population. Genet Test Mol Biomarkers 2011;15(1-2): 7983.8.-

(8.) Canizales-Quinteros S, Tusie-Luna MT. Role of the allelic E4 variant of apolipoprotein E in lipid concentrations in a Mexican rural indigenous population predisposed to type 2 diabetes mellitus. Rev Invest Clin 2000;52(3): 314-317.

(9.) Ruiz B, Godinez SA, Nuno GP, Panduro A. Genetic polymorphism of apolipoprotein E associated to type 2 diabetes mellitus in Mexican population. Diabetologia 2001; 44: A91.

(10.) Guzman-Flores J.M, Munoz-Valle J.F, Sanchez-Corona J, Cobian JG, Medina-Carrillo L, Garcia-Zapien AG, Cruz-Quevedo EG, Flores-Martinez SE. Tumor necrosis factor-alpha gene promoter -308G/A and -238G/A polymorphisms in Mexican patients with type 2 diabetes mellitus. Dis Markers 2011; 30(1):19-24.

(11.) Martin-Marquez BT, Heron PM, Sanchez-Hernandez PE, Enciso-Amoros E, Sandoval-Garcia F, Corona-Sanchez E, Vazquez del Mercado-Espinosa Monica. Asociacion del polimorfismo T188G en el gen del transportador lipidito CD36 con diabetes mellitus tipo 2 en mestizos mexicanos del occidente de Mexico. Archivos de Ciencia 2011; 3(1): 21.

(12.) Villafan-Bernal JR, Sanchez-Enriquez S, Llamas- Cobarrubias M, Guzman P, Munoz-Valle JF. El polimorfismo Hind III-180 C/T, nuevo marcador de susceptibilidad para diabetes mellitus tipo 2. Archivos de Ciencia 2011; 3(1): 53.

(13.) Sanchez-Corona J, Flores-Martinez SE, Machorro-Lazo MV, GalavizHernandez C, Moran-Moguel MC, Perea FJ, Mujica-Lopez KI, Vargas-Ancona L, Laviada-Molina HA, Fernandez V, Pardio J, Arroyo P, Barrera H, Hanson RL. Polymorphisms in candidate genes for type 2 diabetes mellitus in a Mexican population with metabolic syndrome findings. Diabetes Res Clin Pract 2004; 63(1): 47-55.

(14.) Dominguez-Lopez A, Miliar-Garcia A, Segura-Kato YX, Riba L, Esparza-Lopez R, Ramirez-Jimenez S, Rodriguez-Torres M, Canizales-Quinteros S, Cabrera-Vasquez S, Fragoso-Ontiveros V, Aguilar-Salinas CA, Altamirano-Bustamante N, CalzadaLeon R, Robles-Valdes C, Bravo-Rios LE, Tusie-Luna MT. Mutations in MODY genes are not common cause of early-onse ttype 2 diabetes in Mexican families. JOP [Internet] 2005; 6(3): 238-245.

(15.) Burguete-Garcia AI, Cruz-Lopez M, Madrid-Marina V, Lopez-Ridaura R, Hernandez-Avila M, Cortina B, Gomez RE, Velasco-Mondragon E. Association of Gly972Arg polymorphism of IRS1 gene with type 2 diabetes mellitus in lean participants of a national health survey in Mexico: a candidate gene study. Metabolism 2010;59(1): 38-45

(16.) Perez G, Ornelas ML, Sedano A. Lamininas nucleares, envejecimiento y progeria de Hutchinson-Gilford. En: Bioquimica; casos clinicos, correlacion clinica, bioquimica y genetica. Perez G, Ornelas ML, Martinez N, Perez M, Eds. Mexico: Graficos de Mexico; 2005: 208-217.

(17.) Steinle NI, Kazlauskaite R, Imumorin IG, Hsueh WC, Pollin TI, O'Connell JR, Mitchell BD, ShuldinerAR. Variation in the lamin A/C gene: associations with metabolic syndrome. Arterioscler Thromb Vasc Biol 2004; 24: 1708-1713.

(18.) Shackleton S, Lloyd DJ, Jackson SN, Evans R, Niermeijer MF, Singh BM, Schmidt H, Brabant G, Kumar S, Durrington PN, Gregory S, O'Rahilly S, Trembath RC. LMNA, encoding lamin A/C, is mutated in partial lipodystrophy. Nat Genet 2000; 24: 153-156.

(19.) Pezzolesi MG, Katavetin P, Kure M, Poznik GD, Skupien J, Mychaleckyj JC, Rich SS, Warram JH, Krolewski AS. Confirmation of genetic associations at ELMO1 in the GoKinD Collection supports its role as a susceptibility gene in diabetics nephropathy. Diabetes 2009; 58: 2698-2702

(20.) Shimazaki A, Tanaka Y, Shinosaki T, Ikeda M, Watada H, Hirose T, Kawamori R, Maeda S. ELMO1 increases expression of extracellular matrix proteins and inhibits cell adhesion to ECMs. Kidney Int 2006; 70: 1769-1776.

(21.) Leak TS, Perlegas PS, Smith SG, Keene KL, Hicks PJ, Langefeld CD, Mychaleckyj JC, Rich SS, Kirk JK, Freedman BI, Bowden DW, Sale MM. Variants in intron 13 of the ELMO1 gene are associated with diabetic nephropathy in African American. Ann Hum Genet 2009; 73: 152-159.

(22.) Shimazaki A, Kawamura Y, Kanazawa A, Sekine A, Saito S, Tsunoda T, Koya D, Babazono T, Tanaka Y, Matsuda M, Kawai K, Iiizumi T, Imanishi M, Shinosaki T, Yanagimoto T, Ikeda M, Omachi S, Kashiwagi A, Kaku K, Iwamoto Y, Kawamori R, Kikkawa R, Nakajima M, Nakamura Y, Maeda S. Genetic variation in the gene encoding ELMO1 are associated with susceptibility to diabetic nephropathy. Diabetes 2005; 54: 1171-1178.

(23.) Ramirez VE, Arnaud M del R, Delisle H. Prevalence of the metabolic syndrome and associated lifestyles in adult males from Oaxaca, Mexico. Salud Publica Mex 2007; 49: 94-102.

(24.) Pennock CA, Mott MG, Batstone GF. Screening for mucopolychsacaridosis. Clin Chim Acta 1970; 27:93.

(25.) Pncok CA, White F, Wharton BA. CPC precipitable uronic acid: creatinine ratio in random urine samples collected from normal children. Acta Paeditr Scand 1972; 61: 125.

(26.) Graddock JG Jr, Kerby GP. Urinary excretion of acid mucopolysaccharides by diabetic patients.J Lab Clin Med 1955; 46: 193-198.

(27.) Topete-Gonzalez LR, Ramirez-Garcia SA, Mazariegos MA, Charles-Nino C, Davalos-Rodriguez IP, Rincon AR, Cortes-Sanabria L, Villa-Runano N, MossoGonzalez C, Ramon CL, Garcia-Cruz D, Davalos Rodriguez NO. Polimorfismo G>A en el intron 13 del gen ELMO1 relacionado con nefropatia diabetica en poblacion mexicana. Archivos de Ciencia 2013; 5: 15.

(28.) Topete-Gonzalez LR,Ramirez-Garcia SA, Charles-Nino C,Villa-Ruano N, MossoGonzalez C, Davalos Rodriguez NO. Polimorfismo g.37190613 G>A del gen ELMO1 en poblacion Mexicana, marcador potencial para la patologia clinico-quirurgica. Cir Cir 2014; 82 (4): 403-412.

(29.) Khuory MJ, Beaty TH, Cohen BH. En Fundamentals of Genetic Epidemiology. New York: Oxford University Press; 1993

(30.) Moreno-Altamirano A, Lopez-Moreno S, Corcho-Berdugo A. Principales medidas en epidemiologia. Salud Publica Mex 2007; 42: 337-348.

(31.) Flores AE, Burgete AI, Salazar ME. Disenos de Investigacion en epidemiologia genetica. Rev PanamSaludPublica. 2012; 31: 88-94

(32.) Hanler A. Rosenberg D, MonahamC. En Analytic Methods in Maternal and Child Heart. Washington DC: HARSA-MCHB-UIC, 1998.

(33.) Van den Hoven MJ, Rops AL, Bakker MA, Aten J, Rutjes N, Roestenberg P, Goldschmeding R, Zcharia E, Vlodavsky I, van der Vlag J, Berden JH. Increased expression of heparanase in overt diabetic nephropathy. Kidney Int 2006; 70: 2100-2108.

(34.) Vaag A, Jensen CB, Poulsen P, Brans C, Pilgaard K, Grunnet L, Vielwerth S, AlibegovicA. Metabolic aspects of insulin resistance in individuals born small for gestational age. Horm Res 2006; 65: 137-143.

(35.) Millis RM. Epigenetics and Hypertension. Curr Hypertens Rep 2011; 13: 21-28.

(36.) Gamboa-Melendez MA, Huerta-Chagoya A, Moreno-Macias H, Vazquez-Cardenas P, Ordonez-Sanchez ML, Rodriguez-Guillen R, Riba L, Rodriguez-Torres M, Guerra-Garcia MT, Guillen-Pineda LE, Choudhry S, Del Bosque-Plata L, Canizales-Quinteros S, Perez-Ortiz G, Escobedo-Aguirre F, Parra A, LermanGarber I, Aguilar-Salinas CA, Tusie-Luna MT. Contribution of common genetic variation to the risk of type 2 diabetes in the Mexican Mestizo population. Diabetes 2012; 61: 3314-3321.

(37.) SIGMA Type 2 Diabetes Consortium, Williams AL, Jacobs SB, Moreno-Macias H, Huerta-Chagoya A, Churchhouse C, Marquez-Luna C, Garcia-Ortiz H, Gomez-Vazquez MJ, Burtt NP, Aguilar-Salinas CA, Gonzalez-Villalpando C, Florez JC, Orozco L, Haiman CA, Tusie-Luna T, Altshuler D. Sequence variants in SLC16A11 are a common risk factor for type 2 diabetes in Mexico. Nature 2014; 506: 97-101.

(38.) Cruz M, Valladares-Salgado A, GarciaMena J, Ross K, Edwards M, AngelesMartinez J, Ortega-Camarillo C, de la Pena JE, Burguete-Garcia AI, Wacher-Rodarte N, Ambriz R, Rivera R, D'artote AL, Peralta J, Parra EJ, Kumate J. Candidate gene association study conditioning on individual ancestry in patients with type 2 diabetes and metabolic syndrome from Mexico City. Diabetes Metab Res Rev 2010; 26: 261-270.

(39.) Martinez-Gomez LE, Cruz M, Martinez-Nava GA, Madrid-Marina V, Parra E, Garcia-Mena J, Espinoza-Rojo M, Estrada-Velasco BI, Piza-Roman LF, Aguilera P, Burguete-Garcia AI. A replication study of the IRS1, CAPN10, TCF7L2, and PPARG gene polymorphisms associated with type 2 diabetes in two different populations of Mexico. Ann Hum Genet 2011; 75(5): 612-620.

(40.) Baschetti R. Diabetes epidemic in newly westernized populations: is it due to thrifty

Sergio Alberto Ramirez-Garcia [1] Claudia Charles-Nino [2], Manuel Mazariegos-Rubi [3], Luz Rosalba Topete-Gonzalez [4], Luis Javier Flores-Alvarado [4], Jaime Leyva Santiago [5], Clemente Mosso-Gonzalez [5] y Nory Omayra Davalos-Rodriguez [2]. Grupo Multidisciplinario para el Estudio Integral de las Enfermedades Metabolicas e Infecciosas en poblacion Mexicana

[1] Instituto de Investigaciones Sobre la Salud Publica, Universidad de la Sierra Sur, Oaxaca, Mexico.

[2] Instituto de Genetica Humana, "Dr. Enrique Corona Rivera", Departamento de Biologia Molecular y Genomica, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara, Jalisco, Mexico.

[3] Universidad de Guadalajara, Jalisco, Mexico.

[4] Doctorado en Genetica Humana, Universidad de Guadalajara, Jalisco, Mexico.

[5] Maestria en Salud Publica, Universidad de la Sierra Sur, Oaxaca. Mexico.

Autor de correspondencia: Nory Omayra Davalos-Rodriguez, Instituto de Genetica Humana, Dr. Enrique Corona Rivera del Departamento de Biologia Molecular y Genomica, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara. Guadalajara, Jalisco, Mexico. Telefono 045+9511777250. Correo electronico: sergio7genetica@hotmail.com.

Leyenda: Fig. 1A: Frecuencias alelicas del SNP rs1345365 de ELMO1.

Leyenda: Fig. 1B: Frecuencias de los genotipos del SNP rs1345365 de ELMO1.
TABLA I

(A). ASOCIACION E IMPACTO DEL SNP RS 1345365 DE ELMO1
EN FUNCION DEL MODELO DE HERENCIA. COMPARACION ENTRE
DIABETICOS Y CONTROLES CON SM (SIN DIABETES).

                           N= Controles                Valor de p con
GENOTIPO/ALELO    N=DM 2      con SM      Valor Chi2     dos colas

Alelo A            177         224          9,737         0,001806
Alelo G            119          88

Modelo dominante

Genotipo AA         33          68          15,52        0,00008163
Genotipo AG+GG     115          88

Modelo paradominante

Genotipo AG        111          88          11,61        0,0006566
Genotipo no AG      37          68

Modelo Sobredominante

Genotipo AA+GG      34          68          13,61        0,0002252
Genotipo AG        111          88
Modelo Recesivo
Genotipo AA+AG     144         156          0,9386         0,3326
Genotipo GG         4           0

Modelo-Codominante

Genotipo AA         33          68            1
Genotipo AG        111          88          14,33        0,0001534
Genotipo GG         0           4          0,01038         0,9189

(B). ASOCIACION E IMPACTO DEL SNP RS1345365 DE ELMO1
EN FUNCION DEL MODELO DE HERENCIA. COMPARACION ENTRE
DIABETICOS Y PERSONAS SANAS.

Alelo A            177         361          21,33       0,000003867
Alelo G            119         177

Modelo dominante

Genotipo AA         33          92          17,97        0,00002248
Genotipo AG+GG     115         177

Modelo paradominante

Genotipo AG        111         177          3,783         0,05178
Genotipo no AG      37          92

Modelo Sobredominante

Genotipo AA+GG      34          92          5,145         0,02332
Genotipo AG        111         177
Modelo Recesivo
Genotipo AA+AG     144         269          4.771         0,02894
Genotipo GG         4           0

Modelo-Codominante

Genotipo AA         33          92
Genotipo AG        111         177           16,6        0,00004615
Genotipo GG         4           0           6,981         0,008236

(C). ASOCIACION E IMPACTO DEL SNP RS1345365 DE ELMO1 EN
FUNCION DEL MODELO DE HERENCIA. COMPARACION PERSONAS
SANAS YPERSONAS CON SM.

Alelo A            224         361          2,028          0,1545
Alelo G             88         177

Modelo dominante

Genotipo AA         68          92          3,708         0,05416
Genotipo AG+GG      88         177

Modelo paradominante

Genotipo AG         88         177          3,708         0,05416
Genotipo no AG      68          92

Modelo Sobredominante

Genotipo AA+GG      68          92          3,708         0,05416
Genotipo AG         88         177
Modelo Recesivo
Genotipo AA+AG     156         269          1,717          0,1903
Genotipo GG         0           0

Modelo-Codominante

Genotipo AA         68          92
Genotipo AG         88         177          3,708         0,05416
Genotipo GG         4           0           5,239          0,0225

(A). ASOCIACION E IMPACTO DEL SNP RS 1345365 DE ELMO1
EN FUNCION DEL MODELO DE HERENCIA. COMPARACION ENTRE
DIABETICOS Y CONTROLES CON SM (SIN DIABETES).

                  Riesgo en    Riesgo en     Riesgo
GENOTIPO/ALELO    expuestos   no expuestos   total     ORs

Alelo A            44,14%        57,49%      48,68%   0,7678
Alelo G

Modelo dominante

Genotipo AA        32,67%        56,65%      48,68%   0,5768
Genotipo AG+GG

Modelo paradominante

Genotipo AG        55,78%        35,24%      48,68%    1,5
Genotipo no AG

Modelo Sobredominante

Genotipo AA+GG     33,33%        55,70%      48,10%   0,5976
Genotipo AG
Modelo Recesivo
Genotipo AA+AG       48%          80%        48,52%    0,6
Genotipo GG

Modelo-Codominante

Genotipo AA
Genotipo AG          33%          56%        48,00%   0,5858
Genotipo GG        32,67%         20%        32,08%   1,6634

(B). ASOCIACION E IMPACTO DEL SNP RS1345365 DE ELMO1
EN FUNCION DEL MODELO DE HERENCIA. COMPARACION ENTRE
DIABETICOS Y PERSONAS SANAS.

Alelo A            32,90%        50,42%      38,24%   0,6525
Alelo G

Modelo dominante

Genotipo AA        26,40%        49,57%      41,46%   0,5326
Genotipo AG+GG

Modelo paradominante

Genotipo AG        38,54%        28,68%      35,49%   1,344
Genotipo no AG

Modelo Sobredominante

Genotipo AA+GG     26,98%        38,54%      35,02%   0,7001
Genotipo AG
Modelo Recesivo
Genotipo AA+AG       35%          100%       35,49%   0,3487
Genotipo GG

Modelo-Codominante

Genotipo AA
Genotipo AG          26%          49%        40,79%   0,5423
Genotipo GG        26,40%         100%       28,68%   0,264

(C). ASOCIACION E IMPACTO DEL SNP RS1345365 DE ELMO1 EN
FUNCION DEL MODELO DE HERENCIA. COMPARACION PERSONAS
SANAS YPERSONAS CON SM.

Alelo A            38,29%        33,21%      36,71%   1,153
Alelo G

Modelo dominante

Genotipo AA        42,50%        33,21%      36,71%    1,28
Genotipo AG+GG

Modelo paradominante

Genotipo AG        33,21%        42,50%      36,71%   0,7814
Genotipo no AG

Modelo Sobredominante

Genotipo AA+GG     42,50%        33,21%      36,71%    1,28
Genotipo AG
Modelo Recesivo
Genotipo AA+AG       37%          100%       36,85%   0,3671
Genotipo GG

Modelo-Codominante

Genotipo AA
Genotipo AG        42,50%        33,21%      36,71%    1,28
Genotipo GG        42,50%         100%       43,90%   0,425

(A). ASOCIACION E IMPACTO DEL SNP RS 1345365 DE ELMO1
EN FUNCION DEL MODELO DE HERENCIA. COMPARACION ENTRE
DIABETICOS Y CONTROLES CON SM (SIN DIABETES).

                    Intervalo de
GENOTIPO/ALELO    confianza del 95%    FPP      FPE

Alelo A            0,6538-0,97017     15,31%   23,22%
Alelo G

Modelo dominante

Genotipo AA         0,4253-0,7822     14,06%   42,32%
Genotipo AG+GG

Modelo paradominante

Genotipo AG          1,188-2,11       27,62%   36,83%
Genotipo no AG

Modelo Sobredominante

Genotipo AA+GG      0,4423-0,8075     13,64%   40,24%
Genotipo AG
Modelo Recesivo
Genotipo AA+AG        0,38-1,0         34%      40%
Genotipo GG

Modelo-Codominante

Genotipo AA
Genotipo AG         0,4313-0,7955     13,95%   42,42%
Genotipo GG         0,2768-9,641      37,65%    20%

(B). ASOCIACION E IMPACTO DEL SNP RS1345365 DE ELMO1
EN FUNCION DEL MODELO DE HERENCIA. COMPARACION ENTRE
DIABETICOS Y PERSONAS SANAS.

Alelo A             0,5478-0,7771     24,16%   34,75%
Alelo G

Modelo dominante

Genotipo AA         0,3867-0,7336     16,37%   46,74%
Genotipo AG+GG

Modelo paradominante

Genotipo AG          0,9868-1,83      19,19%   25,58%
Genotipo no AG

Modelo Sobredominante

Genotipo AA+GG      0,5073-0,9662     9,13%    29,99%
Genotipo AG
Modelo Recesivo
Genotipo AA+AG      0,3056-0,3978      65%      65%
Genotipo GG

Modelo-Codominante

Genotipo AA
Genotipo AG         0,3931-0,748      16,21%   45,77%
Genotipo GG         0,197-0,3538      71,32%    74%

(C). ASOCIACION E IMPACTO DEL SNP RS1345365 DE ELMO1 EN
FUNCION DEL MODELO DE HERENCIA. COMPARACION PERSONAS
SANAS YPERSONAS CON SM.

Alelo A              0,944-1,407      9,53%    13,27%
Alelo G

Modelo dominante

Genotipo AA          0,9985-1,64      9,53%    21,86%
Genotipo AG+GG

Modelo paradominante

Genotipo AG         0,6096-1,002      13,63%   21,86%
Genotipo no AG

Modelo Sobredominante

Genotipo AA+GG      0,9985- 1,64      9,53%    21,86%
Genotipo AG
Modelo Recesivo
Genotipo AA+AG      0,324-0,4159       63%      63%
Genotipo GG

Modelo-Codominante

Genotipo AA
Genotipo AG          0,9985-1,64      9,53%    21,86%
Genotipo GG         0,3549-0,5089     56,10%    58%

TABLA II
GENOTIPOS Y ALELOS DEL SNP RS1345365 EN OTRAS POBLACIONES.

                                                          GENOTIPOS
                                     Numero de
Poblacion                            cromosomas    AA      AG      GG

Grupos etnicos en Estados Unidos
de Norte America

Indios Gujarati en Houston, Texas       176       0,477   0,375   0,148
Residentes del sureste de Estados        98       0,082   0,49    0,429
  Unidos de Norte America con
  ancestria africana
Residentes de Utah con ancestria        226       0,451   0,487   0,062
  del norte y occidente de Europa

Poblaciones Europeas

Toscana italiana                        176        0,5    0,464   0,091
Muestras de pacientes Europeos del       48        0,5    0,375   0,125
  Instituto de Celulas
  Respiratorias Coriell

Poblaciones o grupos etnicos africanos

Muestras de pacientes con                46       0,174   0,522   0,304
  ancestria africana del Instituto
  de Celulas Respiratorias Coriell
Luhya, Kenia Africa                     178       0,079   0,371   0,551
Masais,Kinyawa Kenia                    286       0,084   0,538   0,378
Yoruba in Ibadan, Nigeria,              224       0,062   0,348   0,589
  Sub-Sahara Africa

Poblaciones o grupos etnicos Asiaticos

Asiaticos de la tribu Han de             84       0,548   0,333   0,119
  Beijin China, no relacionados
  geneticamente.
Asiaticos de la tribu Han de             92       0,537   0,415   0,049
  Beijin, China
Asiaticos de Tokio Japon                172       0,581   0,36    0,058
Chinos en Metropolitan Denver,          170       0,506   0,435   0,059
  Colorado
Muestras de descendientes Chinos         48       0,458    0,5    0,042
  del Instituto de Celulas
  Respiratorias Coriell

Poblaciones o grupos etnicos con ancestria mexicana

Residentes de los Angeles con           100       0,54    0,36     0,1
  ancestria Mexicana
Estudio en poblacion Mestiza            644       0,36    0,64      0
  Mexicana
Mestizos del noroccidente de            538       0,34    0,66      0
  Mexico
Mestizos con ancestria Zapoteca         106       0,453   0,547     0
  y Yoruba
Este estudio en personas con SM         312       0,44    0,56      0
  sin DM2
Este estudio pacientes con DM2          296       0,23    0,75    0,02

                                        ALELOS

Poblacion                              A        G

Grupos etnicos en Estados Unidos
de Norte America

Indios Gujarati en Houston, Texas    0,665    0,335
Residentes del sureste de Estados    0,237    0,763
  Unidos de Norte America con
  ancestria africana
Residentes de Utah con ancestria     0,695    0,305
  del norte y occidente de Europa

Poblaciones Europeas

Toscana italiana                     0,705    0,295
Muestras de pacientes Europeos del   0,688    0,312
  Instituto de Celulas
  Respiratorias Coriell

Poblaciones o grupos etnicos africanos

Muestras de pacientes con            0,435    0,565
  ancestria africana del Instituto
  de Celulas Respiratorias Coriell
Luhya, Kenia Africa                  0,264    0,736
Masais,Kinyawa Kenia                 0,353    0,647
Yoruba in Ibadan, Nigeria,           0,237    0,763
  Sub-Sahara Africa

Poblaciones o grupos etnicos Asiaticos

Asiaticos de la tribu Han de         0,714    0,286
  Beijin China, no relacionados
  geneticamente.
Asiaticos de la tribu Han de         0,744    0,256
  Beijin, China
Asiaticos de Tokio Japon             0,762    0,238
Chinos en Metropolitan Denver,       0,724    0,276
  Colorado
Muestras de descendientes Chinos     0,708    0,292
  del Instituto de Celulas
  Respiratorias Coriell

Poblaciones o grupos etnicos con ancestria mexicana

Residentes de los Angeles con         0,72    0,28
  ancestria Mexicana
Estudio en poblacion Mestiza          0,32    0,678
  Mexicana
Mestizos del noroccidente de          0,33    0,67
  Mexico
Mestizos con ancestria Zapoteca       0,27    0,73
  y Yoruba
Este estudio en personas con SM       0,72    0,28
  sin DM2
Este estudio pacientes con DM2        0,66     0,4

Nota. Datos tomados del SNPdatabase.
COPYRIGHT 2015 Universidad del Zulia
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Ramirez-Garcia, Sergio Alberto; Charles-Nino, Claudia; Mazariegos-Rubi, Manuel; Rosalba Topete-Gonza
Publication:Investigacion Clinica
Date:Dec 1, 2015
Words:7897
Previous Article:Los Editores Biomedicos venezolanos en crisis.
Next Article:Efecto biologico de la recuperacion nutricional en las concentraciones sericas de citocinas inflamatorias en el nino desnutrido grave.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters