Printer Friendly

Aptameric molecular switch for cascade signal amplification.

High sensitivity of analysis is constantly in demand for clinical diagnosis. Thus, the development of assay signal amplification paths has become important, and several amplification techniques have been developed, including catalytic nanoparticles (1, 2), PCR (3, 4), rolling-circle amplification (5, 6), enzyme-triggered strand displacement amplification (7-10), entropy-driven signal amplification (11, 12), and cascade signal amplification (13, 14). The PCR is currently the most widely used thermal-cycling technique for DNA amplification. However, thermal-cycling techniques require the use of special instruments, and the conventional PCR product typically requires characterization at the end of the reaction (13). These disadvantages limit this technique. Isothermal amplification of DNA has emerged as an alternative amplification technique (6, 8, 15). The reaction is performed at a constant temperature, so the time required for DNA amplification is less than that of thermal-cycling techniques. In addition, isothermal amplification can be performed without specialized instrumentation and has the potential for use in point-of-care testing. The basis of this technique is continuous strand displacement, in which polymerase extension uses 1 strand of the DNA chain as a template (16). He et al. (8) described an analytically sensitive method for cocaine detection based on isothermal strand displacement. Shlyahovsky et al. (7) provided an automated technique based on aptamers that was activated by polymerase, nicking enzyme, and a molecular beacon for amplifying the detection of cocaine. The advantage of these fluorescent biosensors was an enhanced limit of detection of the assay, whereas the linear signal amplification procedure seemed to be disadvantageous.

Aptamers have been integrated as recognition elements in optical or electrochemical sensors (17, 18). Aptamers are nucleic acids selected from a rich nucleic acid library by means of the SELEX (systematic evolution of ligands by exponential enrichment) procedure. Aptamers possess specific recognition properties toward low molecular weight substrates or macromolecules such as proteins (19). As novel elements for molecular recognition, aptamers offer many advantages over protein antibodies, such as high affinity and specificity for target proteins, good stability, and ease of synthesis and modification (20). Aptamer-based analytical methods have been developed for protein-detection methods that use electrochemistry (21,22), fluorescence (23,24), and binding-induced label-free detection (25).

Thrombin is a serine protease that plays an important role in the coagulation cascade, thrombosis, and hemostasis. The 15mer single-strand DNA of the thrombin aptamer can bind with thrombin strongly and selectively and is the first aptamer selected in vitro (26). The goal of our study was to develop a highly selective and sensitive aptamer-based sensor to detect thrombin in human serum. We have introduced the paradigm of a signal amplification platform that isothermally and nonlinearly amplifies the recognition event between the aptamer and its substrate. The readout of the analysis triggered by binding of the aptamer and substrate was have accomplished by a fluorescence signal. We have developed a cascade signal amplification strategy that is isothermal and homogeneous.

Materials and Methods

All oligonucleotides used in this work were designed by using the mFold server (http://mfold.rna.albany. edu) and synthesized by Takara Biotechnology, as shown in Table 1.

Klenow fragment polymerase ([exo.sup.-]), Nt.BbvCI enzyme, and a mixture of deoxynucleoside triphosphates (dNTPs) [2] were purchased from New England Biolabs. Human thrombin (10 U/mg) was purchased from DingGuo. BSA was obtained from Westang. Trypsin and bovine thrombin were purchased from Sigma-Aldrich. Human serum was provided by Qingdao Municipal Hospital in China. All chemicals were of analytical grade and were used without further purification. All solutions were prepared with doubly distilled water.

Fig. 1 outlines the principles of signal cascade amplification based on aptamer recognition of thrombin as an example. Nucleic acid 1 consists of 4 regions (Fig. 1A). Region I is the sequence of thrombin aptamer. The 7 bases at the 5'terminus excluded from the stem of nucleic acid 1 are for a better switching of the DNA structure. Region II consists of a sequence that is the same as a molecular beacon. Thus, the complementary strand of region II can act as the "product" and hybridize with the molecular beacon when it is replicated and displaced, which leads to the signal transduction of the thrombin-binding event. Region III includes a nicking site for Nt.BbvCI when the duplex of this region is formed. Region IV is located in the 3'terminus of nucleic acid 1, which can hybridize with region I for 10 bases or for 7 bases with itself. Therefore, nucleic acid 1 has 2 kinds of configurations in solution. Owing to the hybridization of 10 bases by nucleic acid 1 with higher affinity than the hybridization of 7 bases, most of nucleic acid 1 exists in the state of region I hybridizing with region IV in the absence of thrombin. This prevents uncontrolled folding of nucleic acid 1 from triggering the polymerase reaction. In addition, region IV has 2-base extensions at the 3' terminus to avoid undesired replication reactions under experimental conditions.

In the presence of thrombin, nucleic acid 1 acts as a molecular switch, folding the aptamer into its stable aptamer-thrombin complex (Fig. 1B) and forming a 7-base duplex structure with itself that can initiate replication. The 15mer thrombin aptamer appears to have a dissociation constant ([K.sub.d]) from 25 to 200 nmol/L for thrombin (26), whereas the Klenow fragment polymerase has a [K.sub.d] of 7.9 nmol/L for DNA (27). The thrombin aptamer has a greater [K.sub.d] for thrombin than the polymerase for DNA, so the polymerase is able to displace thrombin from the furled-up pocket on the 5' terminus. The polymerase replication is activated with the Klenow fragment ([exo.sup.-]) and dNTPs and can displace thrombin to another nucleic acid 1. Simultaneously, the replication of a single strand yields the duplex that includes the nicking site for Nt.BbvCI. Scission of the replicated strand results in a new replication site for polymerase and the concomitant displacement of the nicked strand. Thus, there are double circular amplifications to produce cascade signal amplification by thrombin displacement and the nicking method. The circle with a slashed line through it (Fig. 1B) means no presence of thrombin, so no cascade signal amplification is generated.

[FIGURE 1 OMITTED]

The system also includes nucleic acid 3 as a reporter unit that is a single-strand DNA molecular beacon (DNAMB). It recognizes and hybridizes with nucleic acid 2.

A fluorophore, FAM (6-carboxyfluorescein), and a quencher, DABCYL [4-(dimethylaminoazo)benzene-4-carboxylic acid], are covalently conjugated at each terminus of the DNA-MB strand, respectively. DNA-MB acts as a fluorescence resonance energy transfer-based switch that is normally in the closed or "fluorescence-off" state but switches to the open or "fluorescence-on" state in the presence of nucleic acid 2. In other words, the fluorescence of FAM (excitation wavelength: 480 nm) has only a residually minute emission in the absence of nucleic acid 2. In contrast, the fluorescence of FAM shows a large increase in the presence of nucleic acid 2.

TIME-DEPENDENT SENSING PROCEDURE

For real-time monitoring of the reaction process, the reaction was performed by using an ABI StepOne real-time PCR instrument (Applied Biosystems). Nucleic acid 1 was denatured at 95 [degrees]C for 10 min and cooled to room temperature in 1X NEB buffer 4 (New England Biolabs) [20 mmol/LTris-acetate (pH 7.9), 50 mmol/L potassium acetate, 10 mmol/L magnesium acetate, and 1 mmol/L dithiothreitol]. Each reaction mixture contained the following reagents in a final volume of 25 [micro]L: 1.25 U polymerase, 2.5 U Nt.BbvCI, 0.2 mmol/L dNTPs, 0.4 [micro]mol/L nucleic acid 1, and 0.5 /[micro]mol/L molecular beacon. Reaction buffer was 1 X NEB buffer 4. A 5-[micro]L specific concentration of thrombin was added to trigger the polymerase reaction. The reactions were incubated at 37 [degrees]C for 60 min to detect fluorescence intensities. Fluorescence curves were recorded at 30-s intervals. All the reactions were run in triplicate, and the same reaction mixtures without thrombin were used as negative controls.

APPLICATION OF THE APTAMER-BASED SYSTEM IN HUMAN SERUM

Thrombin was further tested in human serum without any pretreatment to illustrate the feasibility of the approach. Serum, diluted 2 times, was tested alone or spiked with serially diluted thrombin at concentrations ranging from 0.3 to 300 nmol/L. Furthermore, the final concentrations of 3.0 X [10.sup.-6] mol/L BSA, [10.sup.-7] mol/L trypsin, and [10.sup.-7] mol/L bovine thrombin were tested in the selectivity experiments. The assay procedures for BSA, trypsin, and bovine thrombin were the same as those for human thrombin in buffer, except for the use of BSA, trypsin, and bovine thrombin instead of human thrombin, respectively.

Results and Discussion

A time course of signal cascade amplification reactions initiated with different amounts of thrombin is shown in Fig. 2A. The progress of the reaction was visualized by using denaturing PAGE (20% separation gel, 5% spacer gel). The results of the electrophoresis confirmed the expected amplification reaction and the presence of nucleic acid 2 (Fig. 2A, inset). Consistent with electrophoresis results, the fluorescence response increased with the increases in reaction time and in thrombin concentrations ranging from 0.3 nmol/L to 300 nmol/L (Fig. 2A). The change in fluorescence signal ([DELTA]F) was calculated as F - [F.sub.0], where F and [F.sub.0] correspond to the fluorescence emission intensity observed in the presence and absence of a given thrombin concentration, respectively. The [DELTA]F continued to increase with the increase in thrombin concentration (0.3 to 300 nmol/L) until a plateau was reached (Fig. 2B). A linear relationship between the [DELTA]F and the logarithm of thrombin concentration from 0.3 to 10 nmol/L for thrombin quantification was found (Fig. 2B, inset), with a correlation coefficient of0.9964. The regression equation was: [DELTA]F = 12 710 X logC + 590 (C is the concentration of thrombin, [10.sup.-10] mol/L). The detection limit for thrombin was determined to be 1.7 X [10.sup.-10] mol/L with the use of the 3 a value of the background signal (n = 7). This low detection limit for thrombin was attributable to the large signal amplification upon target-induced polymerization. This detection limit was comparable to or better than that of other reported aptamer-based fluorescence analytical methods for thrombin detection listed in Supplemental Table 1 (see the Data Supplement that accompanies the online version of this article at http://www. clinchem.org/content/vol58/issue2). Considering the low specific activity of thrombin (10 U/mg) used in this experiment and the high specific activity of thrombin (1000-3600 U/mg) in most of the reported methods, this method should have a lower detection limit. Control experiments revealed that the approach generated a small background fluorescence of FAM in the absence of thrombin. This background fluorescence was attributed to minute quantities of nucleic acid 1 folding into a 7-base duplex to activate replication even in the absence of thrombin.

Recently, Connolly et al. (13) developed a cascade signal amplification strategy for rapid quantification of DNA. The fluorescence signal quickly increased with the increase of target DNA. This is an intelligent method and can be used to detect trace amounts of DNA. However, the disadvantage of this method is the ability to detect and amplify only a specific DNA sequence. In comparison with this method (13), our approach can detect and quantify various non-DNA-biomarkers on the basis of the recognition abilities of aptamers for different target molecules, such as proteins and small molecules.

We tested the specificity of the assay with BSA, trypsin, and bovine thrombin. Because of the inherent specificity of the aptamer toward its target, the sensing system was highly specific (Fig. 3). Only thrombin caused remarkable signal amplification, and the signal was about 7 times higher than that of BSA, trypsin, and bovine thrombin (BSA, trypsin, and bovine thrombin caused negligible [DELTA]F). The experimental results indicated that the developed assay could exhibit a high degree of selectivity for thrombin detection and was suitable for the detection of thrombin in a real sample.

[FIGURE 2 OMITTED]

[FIGURE 3 OMITTED]

To test the practical application of this approach, we analyzed thrombin diluted 1:1 in human serum. The fluorescence changes shown in online Supplemental Fig. 1A appeared to be very regular. As shown in online Supplemental Fig. 1B, the fluorescence response appeared to be linear, as was observed in buffer, in the tested concentration range of 0.3 to 10 nmol/L. The regression equation is: [DELTA]F = 33.7 X logC " 12.2 (C is the concentration of thrombin, [10.sup.-10] mol/L; r = 0.9987). This result showed that our approach could be used in a complex buffer or real specimens, such as human serum. Thus, this approach appears to be a potentially useful tool to detect the target in complex matrices, and could have broad applications in the fields of basic and clinic research and diagnostics.

In this study, we developed a new aptameric sensor with nonlinear signal amplification, the application of which was demonstrated by the homogeneous detection of thrombin. The new protocol design exhibits the following advantages. First, it mimics the cascade signal amplification strategy used in a biological circuit and can quickly amplify signals under double circular amplifications by thrombin displacement and the nicking method. In our study, this strategy permitted detection at a concentration as low as 0.17 nmol/L thrombin within 60 min. In comparison with the established aptamer-based thrombin system, the amplification of fluorescence signal induced by double circular amplifications improves the detection limit of the assay. Second, the sensor enables simple, isothermal, real-time, and homogeneous detection of targets in human serum (see online Supplemental Fig. 1). On the basis of the recognition abilities of aptamers for different molecules, coupled with the high sensitivity, inherent simplicity, and low cost derived from this design strategy, this approach appears promising for detecting and screening trace concentrations of biomarkers in complex matrices in clinical applications.

Author Contributions: All authors confirmed they have contributed to the intellectual content of this paper and have met the following 3 requirements: (a) significant contributions to the conception and design, acquisition of data, or analysis and interpretation of data; (b) drafting or revising the article for intellectual content; and (c) final approval of the published article.

Authors' Disclosures or Potential Conflicts of Interest: Upon manuscript submission, all authors completed the Disclosures of Potential Conflict of Interest form. Potential conflicts of interest:

Employment or Leadership: None declared.

Consultant or Advisory Role: None declared.

Stock Ownership: None declared.

Honoraria: None declared.

Research Funding: National Natural Science Foundation of China (no. 31170758), Science and Technology Development Project of Shandong Province (2011GGB01038), and the Research Initial Funding Project for Doctors in Qingdao University of Science and Technology (no. 0022335).

Expert Testimony: None declared.

Role of Sponsor: The funding organizations played no role in the design of study, choice of enrolled patients, review and interpretation of data, and preparation or approval of manuscript.

References

(1.) Zhang S, Zhong H, Ding C. Ultrasensitive flow injection chemiluminescence detection of DNA hybridization using signal DNA probe modified with Au and CuS nanoparticles. Anal Chem 2008; 80:7206-12.

(2.) Zhang S, Xia J, Li X. Electrochemical biosensor for detection of adenosine based on structure-switching aptamer and amplification with reporter probe DNA modified Au nanoparticles. Anal Chem 2008;80:8382-8.

(3.) Mullis K, Faloona F, Scharf S, Saiki R, Horn G, Erlich H. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant Biol 1986;51(Pt 1):263-73.

(4.) Li X, Huang Y, Guan Y, Zhao M, Li Y. Universal molecular beacon-based tracer system for real time polymerase chain reaction. Anal Chem 2006; 78:7886-90.

(5.) Li N, Jablonowski C, Jin H, Zhong W. Stand-alone rolling circle amplification combined with capillary electrophoresis for specific detection of small RNA. Anal Chem 2009;81:4906-13.

(6.) Jarvius J, Melin J, Goransson J, Stenberg J, Fredriksson S, Gonzalez-Rey C, et al. Digital quantification using amplified single-molecule detection. Nat Methods 2006;3:725-7.

(7.) Shlyahovsky B, Li D, Weizmann Y, Nowarski R, Kotler M, Willner I. Spotlighting of cocaine by an autonomous aptamer-based machine. J Am Chem Soc 2007;129:3814-5.

(8.) He JL, Wu ZS, Zhou H, Wang HQ, Jiang JH, Shen GL, Yu RQ. Fluorescence aptameric sensor for strand displacement amplification detection of cocaine. Anal Chem 2010;82:1358-64.

(9.) Bi S, Zhang J, Zhang S. Ultrasensitive and selective DNA detection based on nicking endonuclease assisted signal amplification and its application in cancer cell detection. Chem Commun 2010;46:5509-11.

(10.) Ding C, Li X, Ge Y, Zhang S. Fluorescence detection of telomerase activity in cancer cells based on isothermal circular strand-displacement polymerization reaction. Anal Chem 2010;82: 2850-5.

(11.) Zhang DY, Turberfield AJ, Yurke B, Winfree E. Engineering entropy-driven reactions and networks catalyzed by DNA. Science 2007;318: 1121-5.

(12.) Niu S, Jiang Y, Zhang S. Fluorescence detection for DNA using hybridization chain reaction with enzyme-amplification. Chem Commun 2010;46: 3089-91.

(13.) Connolly AR, Trau M. Isothermal detection of DNA by beacon-assisted detection amplification. Angew Chem Int Ed 2010;49:2720-3.

(14.) Cheng W, Yan F, Ding L, Ju H, Yin Y. Cascade signal amplification strategy for subattomolar protein detection by rolling circle amplification and quantum dots tagging. Anal Chem 2010;82: 3337-42.

(15.) Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 2000;28:63e.

(16.) Guo Q, Yang X, Wang K, Tan W, Li W, Tang H, Li H. Sensitive fluorescence detection of nucleic acids based on isothermal circular strand displacement polymerization reaction. Nucleic Acids Res 2009;37:20-5.

(17.) Hermann T, Patel DJ. Adaptive recognition by nucleic acid aptamers. Science 2000;287:820-5.

(18.) Xiang Y, Zhang Y, Qian X, Chai Y, Wang J, Yuan R. Ultrasensitive aptamer-based protein detection via a dual amplified biocatalytic strategy. Biosens Bioelectron 2010;25:2539-42.

(19.) Stoltenburg R, Reinemann C, Strehlitz B. SELEX: a (r)evolutionary method to generate high-affinity nucleic acid ligands. Biomol Eng 2007;24:381-403.

(20.) Jayasena SD. Aptamers: an emerging class of molecules that rival antibodies in diagnostics. Clin Chem 1999;45:1628-50.

(21.) Zhao Q, Li XF, Le XC. Aptamer-modified mono lithic capillary chromatography for protein separation and detection. Anal Chem 2008;80:3915-20.

(22.) Lu Y, Li X, Zhang L, Yu P, Su L, Mao L. Aptamer based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe. Anal Chem 2008;80:1883-90.

(23.) Yang H, Liu H, Kang H, Tan W. Engineering target-responsive hydrogels based on aptamer-target interactions. J Am Chem Soc 2008;130: 6320-1.

(24.) Dittmer WU, Reuter A, Simmel FC. A DNA-based machine that can cyclically bind and release thrombin. Angew Chem Int Ed 2004;43:3550-3.

(25.) Du Y, Li B, Wei H, Wang Y, Wang E. Multifunctional label-free electrochemical biosensor based on an integrated aptamer. Anal Chem 2008;80: 5110-7.

(26.) Bock LC, Griffin LC, Latham JA, Vermaas EH, Toole JJ. Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature 1992;355:564-6.

(27.) Guest CR, Hochstrasser RA, Dupuy CG, Allen DJ, Benkovic SJ, Millar DP. Interaction of DNA with the Klenow fragment of DNA polymerase I studied by time-resolved fluorescence spectroscopy. Biochemistry 1991;30:8759-70.

Cuiping Ma, [1] Chunhui Zhao, [1] Yujie Ge, [1] and Chao Shi [1] *

[1] State Key Laboratory Base of Eco-Chemical Engineering, College of Chemistry and Molecular Engineering, Qingdao University of Science and Technology, Qingdao, P. R. China.

* Address correspondence to this author at: College of Chemistry and Molecular Engineering, Qingdao University of Science and Technology, Zhengzhou Rd. 53, Qingdao, China 266042. Fax +86-532-84023927; e-mail sc169@163.com.

Received July 26, 2011; accepted November 1, 2011.

Previously published online at DOI: 10.1373/clinchem.2011.173195

[2] Nonstandard abbreviations: dNTPs, deoxynucleoside triphosphates; [K.sub.d], dissociation constant; DNA-MB, DNA molecular beacon; FAM, 6-carboxyfluorescein; DABCYL, 4-(dimethylaminoazo)benzene-4-carboxylic acid; [DELTA]F, change in fluorescence signal.
Table 1. Sequences of molecular switch and molecular beacon. (a)

 Sequence (5' to 3')

Nucleic acid 1 GGTTGGTGTGGTTGG[begin strikethrough]GTTATTTATATTT[end
 strikethrough]GCTGAGGGAGTGGTATTACCCAACCACTC
Nucleic acid 2 TCAGCAAATATAAATAACCCAACCACACCAACC
Nucleic acid 3 FAM-CATCTGTTATTTATATTTGCTCAGATG-DABCYL

(a) The shaded characters in nucleic acid 1 (region I) indicate the
thrombin aptamer sequence. The strikethrough portion is region II. The
italic portion (region III) in nucleic acid 1 as the template to form
the duplex is the nicking site of the nicking enzyme Nt.BbvCI. The
portions underlined and the regions boldfaced in nucleic acid 1
indicate complementary sequences, respectively. The boldfaced
characters of nucleic acids 2 and 3 indicate complementary
nucleotides. The stem of nucleic acid 3 is underlined.
COPYRIGHT 2012 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Automation and Analytical Techniques
Author:Ma, Cuiping; Zhao, Chunhui; Ge, Yujie; Shi, Chao
Publication:Clinical Chemistry
Date:Feb 1, 2012
Words:3442
Previous Article:Quantification of methylated markers with a multiplex methylation-specific technology.
Next Article:Specificity characteristics of 7 commercial creatinine measurement procedures by enzymatic and Jaffe method principles.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters