Printer Friendly

Antitumor activity of terpenoids against classical and atypical multidrug resistant cancer cells.

ABSTRACT

Nineteen terpenoids, including macrocyclic diterpenes, diterpenic lactones and other polycyclic diterpenes, steroids and a triterpene isolated from the methanolic extracts of Euphorbia species, were evaluated for their potential antineoplastic activity in various human cancer cell lines that were derived from three tumor entities: gastric (EPG85-257), pancreatic (EPP85-181) and colon (HT-29) carcinomas. Furthermore, different multidrug-resistant variants of these cancer cell lines with over-expression of MDRl/P-gp or no MDRl/P-gp expression were also investigated. In parental drug-sensitive cell lines, the tested compounds showed a moderate/weak antiproliferative effect or were inactive. Most of them were found more effective in drug-resistant cells than in the parental, drug-sensitive ones, and some of them showed high antineoplastic efficacy in classical or atypical drug-resistant cells. The most active compounds were the lathyrane diterpenes latilagascenes C and D, and the diterpenic lactones 3[beta]-acetoxy-helioscopinolide B and helioscopinolide E which exhibited high antineoplastic activities against the drug-resistant subline EPG85-257RDB derived from gastric carcinoma. In addition, the macrocyclic lathyrane diterpene jolkinol B was found to be highly effective in the multidrug-resistant variant HT-29RNOV.

ARTICLE INFO

Keywords: Antiproliferative Multidrug resistance Lathyrane diterpenes Helioscopinolides Terpenoids

Introduction

Chemotherapy remains the treatment of choice in many malignant diseases. However, the emergence of resistance to anticancer drugs, in particular multidrug resistance (MDR), has made many of the available anticancer drugs ineffective (Borowski et al. 2005). MDR is a complex multifactorial phenomenon that can result from a number of biochemical mechanisms, including a decreased drug uptake or an increased drug efflux; the perturbed expression of target enzymes or altered target enzymes; the altered metabolism of drugs; the increased repair of drug-induced DNA damage; or a failure to undergo apoptosis (Teodori et al. 2006; Szakacs et al. 2006). The enhanced activity of various members of the family of adenosine triphosphate binding cassette (ABC)-transporters was associated with different types of MDR (Lage 2008). These membrane-embedded transport proteins act as energy-dependent drug extrusion pumps that decrease the intracellular concentration of multiple anticancer agents of different chemical structures and mode of action. The most significant mechanism of MDR, referred to as typical or classical MDR, is that resulting from the overexpression of ABC-transporter proteins. The most important and widely studied members of ABC transporters are MDRl/P-glycoprotein (MDRl/P-gp, ABCB1), multidrug resistance associated protein (MRP1/ABCC1) and breast cancer resistance protein (BCRP, ABCG2), (Teodori et al. 2006; Szakacs et al. 2006; Lage 2008). Since MDR is a major obstacle in clinical management of human cancers, it is important to design alternative therapy strategies that can be utilized for the treatment of drug-resistant cancer cells. One of such approaches is the development of alternative drugs without cross resistance in cancer cells exhibiting a drug-resistant phenotype. In previous work, we have isolated several macrocyclic diterpenes from Euphorbia species, which were shown to be very strong modulators of P-glycoprotein in resistant cancer cells (Duarte et al. 2006, 2007a, 2008; Ferreira et al. 2005). Continuing our efforts to discover new anticancer agents from Euphorbia species, traditionally used to treat cancer, herein we report the isolation and identification of five known steroids and one triterpene from the methanolic extract of Euphorbia lagascae. These compounds, together with other terpenoids previously isolated from the same species (Duarte et al. 2006, 2007a,b), and from Euphorbia tuckeyana (Duarte et al. 2008), were evaluated for their potential antineoplastic activity in human cancer cell lines established from three different tumor entities and derived sublines exhibiting different MDR phenotypes.

Materials and methods

Plant material

Euphorbia lagascae and Euphorbia tuckeyana (Euphorbiaceae) were collected in Cova da Beira (Coimbra, Portugal) and in the Garcia d' Orta Garden (Lisbon, Portugal), respectively. Both species were identified by Dr. Teresa Vasconcelos of the Instituto Superior de Agronomia (ISA), University of Lisbon. Voucher specimens have been deposited at the herbarium of ISA (E. lagascae no. 323; E. tuckeyana no. 139/2005).

Compounds tested

Nineteen compounds, whose structures are presented in Figs. 1 and 2, were tested: latilagascene B (1), latilagascene C (2), latilagascene D (3), jolkinol B (4), helioscopinolide A (5), helioscopinolide B (6), 3[beta]-acetoxy-helioscopinolide B (7), helioscopinolide D (8), helioscopinolide E (9), ent-16[alpha],17-dihydroxyatisan-3-one (10), 17-acetoxy-16[alpha]-hydroxyatisan-3-one (11), ent-16[alpha],17-dihydroxykauran-3-one (12), 17-acetoxy-16[alpha]-hydroxykauran-3-one (13), 3[beta]-hydroxy-20-taraxasten-30-al (14), stigmastane-3,6-dione (15), 7[alpha]-hydroxysitosterol (16), 6[beta]-hydroxysitostenone (17), 7-oxositosterol (18), ergosterol peroxide (19). All the compounds were dissolved in DMSO. The purity of the isolated compounds was more than 95% (HPLC). Compounds 1-4,10,12 and 18 were isolated from the methanol extract of Euphorbia lagascae aerial parts (Duarte et al. 2006, 2007a,b). Compounds 5, 6, 8 and 9 were isolated from the methanol extract of Euphorbia tuckeyana aerial parts (Duarte et al. 2008). Compound 7 was obtained by an acetylation reaction as previously described (Wesolowska et al. 2007). Compounds 11 and 13 were obtained by acetylation of compounds 10 and 12, respectively and compounds 14-18 were isolated from Euphorbia lagascae aerial parts as described below.

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

Isolation of compounds 14-18

Euphorbia lagascae aerial parts were extracted and fractionated as previously described (Duarte et al. 2006, 2007a), to obtain eight crude fractions (Fr A-H). The residue (3.5 g) of the crude fraction C (n-hexane/EtOAc, 3:1) was subjected to column chromatography ([SiO.sub.2], 180g) using n-hexane/EtOAc (1:0 to 0:1) to afford five fractions ([C.sub.A] to [C.sub.E]). The residue of the fraction [C.sub.B] was subjected to repeated column chromatography, over [SiO.sub.2], using as eluents mixtures of n-hexane/[CH.sub.2][Cl.sub.2] of increasing polarity, to yield, after recrystallization (n-hexane), 32 mg of compound 15 and a product that was further purified by HPLC (MeOH/[H.sub.2]O, 9:1; 220 nm, 4 mL/ min, [R.sub.t] 43min) yielding 10 mg of compound 14. The fraction [C.sub.E] (130 mg) was subjected to preparative TLC ([CHCl.sub.3]/MeOH, 19:1, 3 x ) to give 25 mg of a product that was further recrystallized (MeOH), yielding 8 mg of compound 16. The residue (10.4 g) of the crude fraction D (n-hexane/EtOAc, 7:3 to 2:3) was submitted to column chromatography ([SiO.sub.2], 320g) using n-hexane/EtOAc (1:0 to 0:1) to give five fractions ([D.sub.A] to [D.sub.E]). Fraction [D.sub.C] (4.5 g, n-hexane/EtOAc, 4:1 to 7:3) was subjected to repeated column chromatography to obtain 60 mg of compound 17. After repeated column chromatography of fraction [D.sub.D] (1.5 g, n-hexane/EtOAc, 13:7 to 3:2) and further purification by preparative TLC ([CHCl.sub.3]/ MeOH, 49:1, 3 x ) and HPLC (MeOH/[H.sub.2]0,9:1; 220 nm, 4 ml/min, [R.sub.t] 60 min), 15 mg of compound 18 were obtained.

Acetylation procedure. Compounds 10 and 12 (10 mg, each) were suspended in [Ac.sub.2]0 (0.5 ml) and pyridine (0.5 ml). After stirring at room temperature for 24 h, the excess of reagents was eliminated with [N.sub.2] and the products obtained were purified by preparative TLC to afford 8 and 7 mg of compounds 11 and 13.

Cell lines, cell culture and cell proliferation assay

Human cancer cell lines and drug-resistant sublines (Table 1) were grown in Leibovitz L-15 medium (Biowhittaker, Walkersville, MD) supplemented by 10% fetal calf serum (FCS) (GIBCO/BRL, Grand Island, NY), 1 mM L-glutamine, 6.25 mg/1 fetuin, 80 IE/1 insulin, 2.5 mg/ml transferrin, 0.5 g/1 glucose, 1.1 g/1 NaHCO3, 1% minimal essential vitamins and 20,000 kIE/1 trasylol in a humidified atmosphere of 5% [CO.sub.2] at 37 [degrees]C. Drug-resistant cell lines were established from parental cell lines by continuous exposure of the cells to stepwise increasing concentrations of antineoplastic agents as described previously (Nieth and Lage 2005). For maintenance of drug-resistant phenotypes, medium of drug-resistant sublines was supplemented with the selection agent. Resistance to etoposide and compounds was assessed using a proliferation assay based on sulforhodamine B (SRB) staining as described previously (Lage et al. 2006). Briefly, 800 cells per well were seeded in 96-well plates in triplicates. After 24 h attachment, the particular agent was added in dilution series for 5 days incubation. Cells were fixed by chilled 10% trichloroacetic acid for 1 h at 4 [degrees]C, washed five times with tap water before staining was performed with 0.4% SRB in 1% acetic acid for 10 min at room temperature. After washing with 1% acetic acid, drying and resolubilization in 20 mM Tris-HCl (pH 10), absorbance was measured at 562 nm against the reference wavelength of 690 nm. Mean [IC.sub.50]-values and standard deviations were calculated from four independent experiments in triplicate for each cell line by using the Prism software (GraphPad Software, Inc.; San Diego, CA, USA). Relative resistance (RR) values were also determined as:
Table 1
Cancer cell lines with drug-resistant sublines.

Cell line/origin   Selection     Proteins         References
                   agent         involved in the
                                 drug-resistant
                                 phenotype

Gastric carcinoma

EPG85-257P         -             -                Lage (2003)

EPG85-257RNOV      Mitoxantrone  BCRP, GPC3,      Lage (2003)
                                 Topo II (1),
                                 TAP (1)

EPG85-257RDB       Daunorubicin  MDR1/P-gp        Lage (2003)

Pancreatic
carcinoma

EPP85-181P         -             -                Lage and Dietel
                                                  (2002)

EPP85-181RNOV      Mitoxantrone  Topo II          Lage and Dietel
                                                  (2002)

EPP85-181RDB       Daunorubicin  MDR1/P-gp        Lage and Dietel
                                                  (2002)

Colon carcinoma

HT-29              -             -                Liu et al.(1983)

HT-29RNOV          Mitoxantrone  Topo II          Sinha et al. (1999)

HT-29RDB           Daunorubicin  -                Sinha et al. (1999)

(1) Minor contribution to the drug-resistant phenotype.


RR = [IC.sub.50] resistant cell line/[IC.sub.50] parental drug-sensitive cell line

RT-PCR

RT-PCR was applied for analysing the expression of different ABC-transporters. For this approach, total RNA was isolated using the RNeasy Mini Kit (Quiagen, Hilden, Germany). First-strand cDNA was synthesized using the Superscript Kit (Invitrogen GmbH, Carlsbad, USA). The PCR reaction mixture contained 1:10 diluted cDNA, 1.5 mM [MgCl.sub.2], 20 mM Tris-HCl, 20 mM KC1, 5 mM [([NH.sub.4]).sub.2] [SO.sub.4], 0.2 mM of each dNTP, 1 M Betain, 5% DMSO, 0.2 [micro]M of sense and antisense primer, and 1 unit TrueStart Taq (Fermentas, Canada). Primer sequences, annealing temperature and amplified fragment length are summarized in Table 2. As positive control for MRP2 (ABCC2) cDNA from HeLa cells was used, for MRP8 (ABCC11) and MRP9 (ABCC12) cDNA from SK-BR-3 cells. Cycling conditions for PCR were as follows: initial denaturation at 94 [degrees]C for 5 min followed by 36-49 cycles of amplification. The amplification started with 60s denaturation at 94 [degrees]C, annealing for 90 s and extension at 72 [degrees]C for 90 s. The last cycle contained a 5 min extension step at 72 [degrees]C.
Table 2
Primer sequences, annealing temperature ([T.sub.A]), cycles and
fragment length used for RT-PCR.

 Primer               Sequence            [T.sub.A]   Cycles
                                        ([degrees]C)

MRP1-fw       CTGACAAGCTAGACCATGAATGT        58         36
MRP1-rev      TCACACCAAGCCGGCGTCTTT

MRP-fw        GGAACAATTFTAGAGAAAGGATC        55         36
MRP2-rev      CACAAACGCAAGGATGATGAAGAA

MRP3-fw       GGACCCTGCGCATGAACCTG           60         36
MRP3-rev      AGGCAAGTCCAGCATCTCTGG

MRP4-fw       GGATCCAAGAACTGATGAGTTAAT       56         36
MRP4-rev      TCACAGTGCTGTCTCGAAAATAG

MRP5-fw       GCTGTTCAGTGGCACTGTCAG          60         36
MRP5-rev      TCAGCCCTTGACAGCGACCTT

MRP6-fw       CACTGCGCTCCAGGATCAGC           56         45
MRP6-rev      CAGACCAGGCCTGACTCCTG

MRP7-fw       AGGACAGGGCCTTGTGGCAG           60         49
MRP7-rev      TCAGGGACCTCCGAGTGAGG

MRP8-fw       GAAGTCCTCCTTGGGCATGGC          57         49
MRP8-rev      TTATCTCAGTGAAGAAGTGGCTGT

MRP9-fw       AGAGACACAATAATGAAACTCCCA       55         45
MRP9-rev      CTACAATCTGACTTCTGCTGCTA

MDR1-fw       CAGCTATTCGAAGAGTGGGC           58         39
MDR1-rev      CCTGACTCACCACACCAATG

BCRP-fw       CTTACAGTTCTCAGCAGCTCTTCG       55         36
BCRP-rev      CGAGGCTGATGAATGGAGAAG

Aldolase-fw   ATCCTGGCTGCAGATGAGTC           58         36
Aldolase-rev  GCCCTTGTCTACCTTTGATGC

  Primer      Fragment length (bp)        Reference

MRP1-fw                35           Konig et al. (2005)
MRP1-rev

MRP-fw                452           Materna et al. (2004)
MRP2-rev

MRP3-fw               450           Konig et al.(2005)
MRP3-rev

MRP4-fw               358           Konig et al. (2005)
MRP4-rev

MRP5-fw               481           Konig et al. (2005)
MRP5-rev

MRP6-fw               502           Konig et al. (2005)
MRP6-rev

MRP7-fw               437           Konig et al. (2005)
MRP7-rev

MRP8-fw               610           Konig et al. (2005)
MRP8-rev

MRP9-fw               375           Konig et al. (2005)
MRP9-rev

MDR1-fw               298           This paper
MDR1-rev

BCRP-fw               320           This paper
BCRP-rev

Aldolase-fw           258           This paper
Aldolase-rev


Results and discussion

Antiproliferative activity of compounds 1-19

Previously, we have reported the isolation and structure elucidation of the macrocyclic lathyrane-type diterpenes 1-4 from Euphorbia lagascae, which were found to be highly active as modulators of MDRl/P-gp as well as apoptosis inducers in human MDR1 gene-transfected mouse lymphoma cells (Duarte et al. 2006, 2007a). Furthermore, when tested in combination with doxorubicine, latilagascene B (1) showed a synergistic interaction, in the same resistant cell line (Duarte et al. 2006). In a preliminary work, the enr-abietane [alpha], [beta]-unsaturated [gamma]-lactones with an extended [gamma]-conjugation 5-9 have shown to be moderate inhibitors of the growth of gastric and pancreatic tumor cell lines (Duarte et al. 2008). Continuing our search for bioactive compounds from Euphorbia lagascae, in this study we have isolated and identified the pentacyclic triterpene 3[beta]-hydroxy-20-taraxasten-30-a! (14) and the steroids stigmastane-3,6-dione (15), 7[alpha]-hydroxysitosterol (16), 6[beta]-hydroxysitostenone (17) and 7-oxositosterol (18). Compounds 11 (17-acetoxy-16[alpha]-hydroxyati-san-3-one) and 13 (17-acetoxy-16[alpha]-hydroxykauran-3-one), were also obtained by acetylation reactions of compounds 10 and 12, respectively. Compounds were identified by comparison of their spectroscopic data with those reported in literature (Dai et al. 2001; Wei et al. 2004: Lim et al. 2005; Chaurasia and Wichtl 1987; Greca et al. 1990; Pettit et al. 2000). All compounds (1-19, Figs. 1 and 2) were evaluated for their antiproliferative activity in several human cancer cell lines that were derived from three different tumor entities: gastric (EPG85-257), pancreatic (EPP85-181), and colon cancer cells (HT-29). Furthermore, in each case different multidrug-resistant variants of these cancer cell lines with over-expression of MDRl/P-gp or no MDRl/P-gp expression were also investigated. For assessment of cytotoxicity of the nineteen tested compounds, the [IC.sub.50] values of each agent were determined by proliferation assays in each of the different cell variants. The etoposide-specific [IC.sub.50] values were measured as positive control for maintenance of the drug-resistant phenotype. Relative resistance (RR) values were also determined as the relation between the [IC.sub.50] of the resistant cell line and the [IC.sub.50] of the parental drug-sensitive cell line. When the sensitivity against a given compound was less than 10% of the corresponding parental cell line, the compound was assessed to be highly efficient in this drug-resistant cell line (Lage et al. 2006).

The [IC.sub.50] values and relative resistances of drug-resistant cell variants in comparison to the drug-sensitive parental cell lines are summarized in Table 3 for three EPG85-257 gastric carcinoma cell variants, in Table 4 for three EPP85-181 pancreatic carcinoma cells, in Table 5 for three HT-29 colon carcinoma cell lines. As can be observed, in parental drug-sensitive cell lines, all the tested compounds (1-19) showed a moderate/weak antiproliferative effect or were inactive. On the other hand, most of the drug-resistant cancer sublines showed increased sensitivities to the studied compounds when compared to the parental sublines.
Table 3
Cytotoxicity of compounds 1-19 in parental, drug-sensitive and in
different multidrug-resistant EPG85-257 gastric carcinoma cells.

Compound      EPG85-257P (1)              EPG85-257RDB (2)

               [IC.sub.50]           [IC.sub.50]    [RR.sup.4]
                ([micro]M)            ([micro]M)

1           17.5 [+ or -] 2.1     7.6 [+ or -] 1.4      0.43
2           16.5 [+ or -] 2.1     1.5 [+ or -] 0.3      0.09
3           85.5 [+ or -] 9.3     2.7 [+ or -] 0.6      0.03
4           64.9 [+ or -] 6.3    20.5 [+ or -] 1.8      0.31
5          > 100                 14.0 [+ or -] 0.9    < 0.14
6           38.0 [+ or -] 3.3     5.7 [+ or -] 0.8      0.15
7          > 100                  4.6 [+ or -] 3.8    < 0.05
9           45.0 [+ or -] 5.6     4.4 [+ or -] 0.6      0.09
10           110 [+ or -] 4.6    20.0 [+ or -] 3.2      0.18
11         > 100                 19.9 [+ or -] 2.3    < 0.20
12         115.0 [+ or -] 5.7    13.0 [+ or -] 2.6      0.11
13         > 100                 21.4 [+ or -] 2.6    < 0.21
14          92.6 [+ or -] 9.6    57.2 [+ or -] 4.9      0.62
15          65.5 [+ or -] 5.9    20.1 [+ or -] 1.8      0.31
17         > 100                 > 100                  n.c
18          67.8 [+ or -] 5.4    76.0 [+ or -] 6.2      1.12
19          20.6 [+ or -] 4.9     8.2 [+ or -] 1.8      0.40
Etoposide  0.105 [+ or -] 0.008   6.2 [+ or -] 0.3     59

Compound                 EPG85-257RNOV (3)

           [IC.sub.50] ([micro]M)  [RR.sup.4]

1            10.0 [+ or -] 1.6         0.57
2            12.0 [+ or -] 1.8         0.73
3            19.6 [+ or -] 13          0.23
4             4.8 [+ or -] 1.0         0.07
5            59.3 [+ or -] 5.6         n.c
6            22.0 [+ or -] 1.7         0.58
7            23.1 [+ or -] 2.6       < 0.23
9            27.0 [+ or -] 2.1         0.60
10           66.0 [+ or -] 4.3         0.60
11           98.0 [+ or -] 10.4      < 0.98
12           57.0 [+ or -] 6.1         0.50
13           > 100                     n.c
14           37.8 [+ or -] 2.8         0.41
15           64.9 [+ or -] 6.2         0.99
17           83.1 [+ or -] 11.2      < 0.83
18           46.9 [+ or -] 5.1         0.69
19           13.7 [+ or -] 4.6         0.66
Etoposide    1.55 [+ or -] 0.09       14.8

Compounds 8 and 16 were ineffective in the sensitive and resistant
variants of gastric carcinoma cells ([IC.sub.50] > 100[micro]M).

(1) EPG85-257P: parental, drug-sensitive gastric carcinoma cell line.

(2) EPG85-257RDB: gastric carcinoma cell line with classical MDR
pheno-type.

(3) EPG85-257RNOV: gastric carcinoma cell line with atypical MDR
pheno-type.

(4) RR, relative resistance in relation to the parental, drug-sensitive
cell line EPG85-257P.

Table 4
Cytotoxicity of compounds 1-19 in parental, drug-sensitive and in
different multidrug-resistant EPP85-181 pancreatic carcinoma cells.

Compound       EPP85-181P (1)                    EPP85-181RDB (2)

           [IC.sub.50] ([micro]M)  [IC.sub.50] ([micro]M)  [RR.sup.4]

1            26.0 [+ or -] 3.2       32.0 [+ or -] 3.5        1.23
2            34.0 [+ or -] 3.1       26.0 [+ or -] 2.6        0.76
4            63.8 [+ or -] 5.2       37.3 [+ or -] 4.4        0.58
5            66.3 [+ or -] 5.8       74.1 [+ or -] 7.2        1.11
6            78.0 [+ or -] 6.2       56.0 [+ or -] 3.7        0.72
7            33.3 [+ or -] 3.2       32.5 [+ or -] 3.4        1.00
9            77.0 [+ or -] 5.4       50.0 [+ or -] 4.3        0.65
12          135.0 [+ or -] 18.5      80.0 [+ or -] 10.3       0.59
14           87.4 [+ or -] 9.8       > 100                    n.c
15           95.8 [+ or -] 6.3       90.7 [+ or -] 7.9        0.95
18           84.9 [+ or -] 9.4       > 100                    n.c
19           21.1 [+ or -] 1.9       20.2 [+ or -] 2.1        0.96
Etoposide    0.58 [+ or -] 0.03      62.0 [+ or -] 4.2      106.9

Compound                EPP85-181RNOV (3)

           [IC.sub.50] ([micro]M)  [RR.sup.4]

1            19.0 [+ or -] 2.8        0.73
2            20.0 [+ or -] 2.3        0.59
4            44.9 [+ or -] 5.1        0.70
5            71.5 [+ or -] 7.2        1.08
6            58.0 [+ or -] 3.5        0.74
7            36.7 [+ or -] 3.2        1.09
9            63.0 [+ or -] 4.8        0.82
12          115.0 [+ or -] 13.6       0.85
14           96.3 [+ or -] 11.3       1.10
15           72.9 [+ or -] 6.5        0.76
18           80.8 [+ or -] 9.5        0.95
19           20.4 [+ or -] 2.2        0.97
Etoposide     4.5 [+ or -] 0.7        7.8

Compounds 3, 8, 10, 11, 13, 16, and 17 were ineffective in the
sensitive and resistant variants of pancreatic carcinoma cells
([IC.sub.50] >100[micro]M). n.c: not calculated.

(1) EPP85-181P: parental, drug-sensitive pancreatic carcinoma cell
line.

(2) EPP85-181RDB: pancreatic carcinoma cell line with classical MDR
pheno-type.

(3) EPP85-181RNOV: pancreatic carcinoma cell line with atypical MDR
pheno-type.

(4) RR, relative resistance in relation to the parental, drug-sensitive
cell line EPP85-181P.

Table 5
Cytotoxicity of compounds 1-19 in parental, drug-sensitive and in
different multidrug-resistant HT-29 colon carcinoma cells.

Compound           HT-29P (1)                       HT-29RDB (2)

           [IC.sub.50] ([micro]M)  [IC.sub.50] ([micro]M)  [RR.sup.4]

1            52.0 [+ or -] 3.7       28.0 [+ or -] 1.9        0.53
2            50.0 [+ or -] 4.1       51.0 [+ or -] 3.9        1.02
4            51.9 [+ or -] 5.4       64.3 [+ or -] 5.9        1.23
6           102.0 [+ or -] 8.8       56.0 [+ or -] 7.6        0.54
9           108.0 [+ or -] 11.3      60.0 [+ or -] 5.1        0.55
14           68.5 [+ or -] 7.3        9.3 [+ or -] 10.7       0.14
15          > 100                    60.5 [+ or -] 6.9      < 0.60
17          > 100                    85.7 [+ or -] 10.2       n.c
18          > 100                    77.8 [+ or -] 8.2        n.c
19           61.3 [+ or -] 9.4       63.0 [+ or -] 9.1        1.02
Etoposide     2.3 [+ or -] 0.3       26.0 [+ or -] 1.7       11.3

Compound                    HT-29RNOV (3)

           [IC.sub.50] ([micro]M)  [RR.sup.4]

1            19.5 [+ or -] 1.5         0.37
2            21.0 [+ or -] 2.2         0.42
4            39.6 [+ or -] 4.5         0.76
6            52.0 [+ or -] 6.3         0.51
9            53.0 [+ or -] 6.4         0.49
14           66.8 [+ or -] 7.2         0.98
15           67.3 [+ or -] 5.7       < 0.67
17           > 100                     n.c
18           > 100                     n.c
19           59.0 [+ or -] 8.9         0.96
Etoposide    35.0 [+ or -] 2.6        15.2

Compounds 3, 5, 7, 8, 10 -13 and 16 were ineffective in the sensitive
and resistant variants of colon carcinoma cells ([IC.sub.50]
>100[micro]M). n.c: not calculated.

(1) HT-29P: parental, drug-sensitive colon carcinoma cell line.

(2) HT-29RDB: colon carcinoma cell line with classical MDR phenotype.

(3) HT-29RNOV: colon carcinoma cell line with atypical MDR phenotype.

(4) RR, relative resistance in relation to the parental, drug-sensitive
cell line HT-29P.


When considering the results obtained for the set of diterpenes (1-13), it can be observed that in the drug-resistant subline EPG85-257RDB (associated with the overexpression of the ABC-transporter MDRl/Pgp) derived from gastric carcinoma, the macrocyclic diterpenes latilagascenes C (2) and D (3), and the diterpenic [alpha],[beta]-unsaturated lactones helioscopinolide B (6), its acetylated derivative (7), and helioscopinolide E (9) were found to be more effective than the positive control etoposide ([IC.sub.50] = 6.2 [micro]M) showing [IC.sub.50] values of 1.5, 2.7, 5.7, 4.6 and 4.4 [micro]M (Table 3) and relative resistance values of 0.09, 0.03, 0.15, 0.05 and 0.09, respectively. Therefore, these compounds can be considered highly effective against this cell line. Latilagascene B (1) also exhibited a significant [IC.sub.50] value (7.6 [micro]M), having, however, a higher RR value (0.43) against those gastric carcinoma cells.

The referred compounds showed a moderate activity in multidrug-resistant EPG85-257RNOV cells associated with altered topoisomerase II expression. However, a significant antineoplastic activity was found in the multidrug-resistant variant (EPG85-257RNOV) for the macrocyclic lathyrane diterpene jolkinol B (4, [IC.sub.50] = 4.8 [micro]M and RR = 0.07). On the other hand, this compound showed a moderate activity against EPG85-257RDB ([IC.sub.50] = 20.5 [micro]M). Therefore, these results suggest that the activity of the compounds is dependent from the individual drug-resistant phenotype. When tested against the three sublines of the pancreatic carcinoma cells (EPP85-181), none of the diterpenes (1-13) showed significant [IC.sub.50] values in all the three sublines (Table 4). The lowest [IC.sub.50] values were obtained for the macro-cyclic diterpenes 1 and 2 against the subline EPP85-181RNOV ([IC.sub.50] = 19.0 and 20.0 [micro]M respectively). Comparable results were obtained for the colon carcinoma cells (HT-29P) (Table 5), where latilagascenes B (1) and C (2) showed also a moderate activity, particularly against the cell subline HT-29RNOV ([IC.sub.50] = 19.5 and 21.0 [micro]M, RR = 0.37 and 0.42, respectively).

As can be observed, lathyrane derivatives 1-4, characterized by the rare 5,6-epoxy function, only differ in the substitution pattern of the pentacyclic ring (ring A). Latilagascene B (1) has two free hydroxyl groups at C-16 and C-3, being the hydroxyl at C-16 benzoylated in latilagascene D (3), and both hydroxyl groups acetylated in latilagascene C (2). On the other hand, jolkinol B (4) is not oxidized at C-16, and like compounds 1 and 3, has a free hydroxyl group at C-3. When comparing the results obtained in EPG85-257 cells for compounds 1-4, it can be suggested that the presence of acylating groups at C-3 and C-16 is important for the cytotoxic activity of lathyrane diterpenes in multidrug-resistant EPG85-257RDB cells, since the presence of free hydroxyl groups at these positions decreased the activity. This feature was demonstrated in the case of compounds 1 ([IC.sub.50] = 7.6 [micro]M) and 4 ([IC.sub.50] = 20.5 [micro]M) respectively. Additionally, oxidation at C-16 in compounds 1-3 seems to be also a relevant structural requirement for the activity, since jolkinol B (4), with a methyl group at C-16 was the less active lathyrane in multidrug-resistant EPG85-257RDB cells, being however the most active compound tested in multidrug-resistant EPG85-257RNOV cells. These results led to support the importance of the substitution pattern of ring A of lathyranes in their antiproliferative activity.

When comparing the results obtained for the diterpenic [alpha],[beta]-unsaturated [gamma]-lactones 5-9, in EPG85-257 gastric cancer cells, it can be observed that, except for compound 8, all the lactones showed significant activity ([IC.sub.50] = 14.0, 5.7, 4.6 and 4.4 [micro]M, respectively) against the subline overexpressing MDRl/P-gp (EPG85-257RDB), suggesting that the existence of an extra hydroxyl group at C-9 in compound 8 may be responsible for its lack of activity. Moreover, when compared to helioscopinolide B (6, [IC.sub.50] = 38 [micro]M), its acetoxy derivative (7) was ineffective against the sensitive-cell line EPG85-257P ([IC.sub.50] > 100 [micro]M). Nevertheless, compound 7 showed to be highly effective in the EPG85-257RDB drug-resistance subline ([IC.sub.50] = 4.6 [micro]M and RR > 0.08). The marked decrease of activity observed in parental cell for the derivative 7 ([IC.sub.50] > 100 [micro]M), obtained by acetylation of the hydroxyl group at C-3 of compound 6, highlight the importance of this part of the molecule for the activity. This structural feature is corroborated by the ineffectiveness of compound 5 in the same parental cells ([IC.sub.50] > 100 [micro]M), which is an epimer of compound 6, differing in the stereochemistry at C-3.

Among the set of the triterpene (14) and steroids (15-19), ergosterol peroxide (19), characterized by an unusual peroxide bridge between C-5/C-9, showed the most pronounced effect (RR = 0.40), with an [IC.sub.50] value of 8.2 [micro]M, similar to that of etoposide ([IC.sub.50] = 6.2 [micro]M, Table 3) in EPG85-257RDB cell variant of gastric carcinoma. In the same way, in pancreatic carcinoma EPP85-181 parental and multidrug resistant variants, the lowest [IC.sub.50] values were also obtained with ergosterol peroxide (19) which showed similar [IC.sub.50] values in sensitive and resistant cells ([IC.sub.50] = 21.1-20.2 [micro]M, Table 4). On the other hand, in colon carcinoma cells (HT-29, Table 5), the best result was obtained for the pentacyclic triterpene 3[beta]-hydroxy-20-taraxasten-30-al (14) against the HT-29RDB subline ([IC.sub.50] = 9.3 [micro]M; relative resistance value of 0.14).

Expression of ABC-transporters in multidrug-resistant cell variants

The cancer cell lines and their drug-resistant sublines were analysed concerning the expression of eleven different members of the family of ABC-transporters. Fig. 3 shows that MRP1 and MRP7 are constitutively expressed in all sensitive and drug-resistant cell variants at a similar level, whereas MRP9 is not expressed in any of these cells. MRP2, MRP4 and MRP5 are expressed in all cell variants, but the expression levels are differently distributed. Furthermore, high expression levels are not inevitably associated with drug-resistant cell variants. MRP3 is not expressed in any of the gastric carcinoma cell lines (EPG85-257P, EPG85-257RDB, EPG85-257RNOV). In parental EPP85-181P cells, a very low expression could be measured. In both drug-resistant derivatives (EPP85-181RDB, EPP85-181RNOV), elevated MRP3 levels are expressed. Likewise, MRP3 is found in all HT-29 colon cancer cells whereby one of the drug-resistant sublines, HT-29RNOV, shows an elevated expression level. Expression of MRP6 is absent in 6 of the 9 cell lines. MRP6 is expressed in parental, drug-sensitive EPP85-181P cells, but not in the derived drug-resistant variants. Likewise, it is expressed in parental HT-29 cells and to a higher extent in one of the drug-resistant sublines, HT-29RDB, but absent in the other one, HT-29RNOV. MRP8 could merely be detected in parental EPG85-257P cells at a very low level. MDRl/P-gp is expressed in two daunorubicin-selected MDR variants (EPG85-257RDB, EPP85-181RDB), but not in any of the other cells. BCRP is expressed at high levels in EPG85-257RNOV cells and at low levels in the corresponding parental cell line EPG85-257P and the drug-resistant variant EPG85-257RDB. Furthermore, very low levels could be detected in parental HT-29 cells and both drug-resistant derivatives.

[FIGURE 3 OMITTED]

In conclusion, the analysis of the ABC-transporter expression profiles in the panel of parental and drug-resistant tumor cells confirmed the over expression of MDRl/P-gp and BCRP in the MDR cell lines EPG85-257RDB, EPP85-181RDB and EPG85-257RNOV. Furthermore, the data indicated that MRP3 may contribute to the drug-resistant phenotype in EPP85-181RDB, EPP85-181RNOV and HT-29RNOV cells as well as that MRP6 may be involved in the MDR of the cell line HT-29RDB. Thus, the ABC-transporter expression patterns support the hypothesis that the different types of MDR are the result of a network of several independent factors contributing to a complex phenotype. Therefore, the biological effects of the investigated terpenoids should not be associated with a single factor, but should be assessed in the context of a multimodal-mediated biological mechanism.

Regarding the activity against the colon (HT-29) and pancreatic (EPP85-181) cancer cells, it should be noted that these cell lines appeared markedly more resistant than the gastrointestinal EPG85-257 cell line. In fact, just a moderate antiproliferative activity was found in these cell lines for some compounds, indicating a strong tissue-dependence.

Some of the tested compounds, particularly the macrocyclic lathyrane diterpenes latilagascenes C and D, and jolkinol B, which showed previously to be strong MDRl/P-gp modulators, and the diterpenic [gamma]-lactones 3[beta]-acetoxy-helioscopinolide B and helios-copinolide E, may be valuable as lead compounds for the development of anticancer agents for the treatment of multidrug-resistant cancer cells. It should be noted that the [alpha],[beta]-unsaturated lactone function is a common structural feature shared by many bioactive terpenoids and other natural product-derived compounds (Dewick 2002; Fatima et al. 2006; Buck et al. 2003). This activity is frequently manifested in vivo as cytotoxicity or skin allergies, fact that has impaired further clinical studies (Dewick 2002). It is widely accepted that [alpha],[beta]-unsaturated lactones act as a Michael acceptor in biological systems. Therefore, they preferably react with nucleophiles, especially thiol groups of proteins as well as the free intracellular glutathione, by a Michael-type addition (Zhang et al 2005). To the best of our knowledge, there is only one report regarding the in vivo activity of helioscopinolides, which were described as having effect on central nervous system (Speroni et al. 1991). In consequence, further studies are required namely in vivo experiments, to access the potential anti-tumor activity of these compounds.

Acknowledgements

This work was supported by The Science and Technology Foundation, Portugal (FCT), grant LA 1030/5-1 of the Deutsche Forschungsgemeinschaft (DFG) and COST B16 Action of the European Commission. The authors thank Dr. Teresa Vasconcelos (ISA, University of Lisbon, Portugal) for identification of the plants.

References

Borowski, E., BontempsGracz, M., Piwkowska, A., 2005. Strategies for overcoming ABC-transporters-mediated multidrug resistance (MDR) of tumor cells. Acta Biochim. Pol. 52, 609-627.

Buck, S.B., Hardouin, C., Ichikawa, S., Soenen, D.R., Gauss, C.M., Hwang, I., Swingle, M.R., Bonness, K.M., Honkanen, R.E., Boger, D.L., 2003. Fundamental role of the fostriecin unsaturated lactone and implications for selective protein phosphatase inhibition. J. Am. Chem. Soc. 125, 15694-15695.

Chaurasia, N., Wichtl, M., 1987. Sterols and steryl glycosides from Urtica dioica. J. Nat. Prod. 50, 881-885.

Dai, J., Zhao, C., Zhang, Q., Liu, Z., Yang, L., 2001. Taraxastane-type triterpenoids from Saussurea petrovii. Phytochemistry 60, 1107-1111.

Dewick, P.M. (Ed.), 2002. Medicinal Natural Products, a Biosynthetic Approach 2nd Ed Wiley, England, pp. 191-212.

Duarte, N., Ferreira, M.J., Martins, M., Viveiros, M., Amaral, L., 2007b. Antibacterial activity of ergosterol peroxide against Mycobacterium tuberculosis. Dependence upon system and medium employed. Phytother. Res. 21, 601-604.

Duarte, N., Gyemant, N., Abreu, P., Molnar, J., Ferreira, M.J., 2006. New macrocyclic lathyrane diterpenes, from Euphorbia lagascae, as inhibitors of multidrug resistance of tumor cells. Planta Med. 72, 162-168.

Duarte, N., Lage, H., Ferreira, M.J., 2008. Three new jatrophane diterpene polyesters and other constituents from Euphorbia tuckeyana. Planta Med. 74, 61-68.

Duarte, N., Varga, A., Radics, R., Molnar, J., Ferreira, M.J., 2007a. Apoptosis induction and modulation of P-glycoprotein mediated multidrug resistance by new macrocyclic lathyrane-type diterpenoids. Bioorg. Med. Chem. 15, 546-554.

Fatima, A., Modolo, L.V., Conegero, L.S., Pilli, R.A., Ferreira, C.V., Kohn, L.K., de Carvalho, J.E., 2006. Styryl lactones and their derivatives: biological activities, mechanisms of action and potential leads for drug design. Curr. Med. Chem. 13, 3371-3384.

Ferreira, M.J., Gyemant, N., Madureira, A.M., Tanaka, M., Koos, K., Didziapetris, R., Molnar, J., 2005. The effects of jatrophane derivatives on the reversion of MDR1 and MRP-mediated multidrug resistance in the MDA-MB-231 (HTB-26) cell line. Anticancer Res. 25, 4173-4178.

Greca, M., Monaco, P., Previtera, L., 1990. Stigmasterols from Typha latifolia. J. Nat. Prod. 53, 1430-1435.

Konig, J., Hartel, M., Nies, A., Martignoni, M., Guo, J., Buchler, M., et al., 2005. Expression and localization of human multidrug resistance protein (ABCC) family members in pancreatic carcinoma. Int. J. Cancer 115, 359-367.

Lage, H., Aki-Sener, E., Yalcin, I., 2006. High antineoplastic activity of new heterocyclic compounds in cancer cells with resistance against classical DNA topoisomerase II-targeting drugs. Int. J. Cancer 119, 213-220.

Lage, H., Dietel, M., 2002. Multiple mechanisms confer different drug-resistant phenotypes in pancreatic carcinoma cells. J. Cancer Res. Clin. Oncol. 128, 349-357.

Lage, H., 2008. An overview of cancer multidrug resistance: a still unsolved problem. Cell. Mol. Life Sci. 65, 3145-3167.

Lage, H., 2003. Molecular analysis of therapy resistance in gastric cancer. Dig. Dis. 21, 326-338.

Lim, J., Park, J., Budesinsky, M., Kasal, A., Han, Y., Koo, B., Lee, S., Lee, D., 2005. Antimutagenic constituents from the thorns of Gleditsia sinensis. Chem. Pharm. Bull. 53, 561-564.

Liu, L.F., Rowe, T.C., Yang, L., Tewey, K.M., Chen, G.L., 1983. Cleavage of DNA by mammalian DNA Topoisomerase II. J. Biol. Chem. 258, 15365-15370.

Materna, V., Pleger, J., Hoffmann, U., Lage, H., 2004. RNA expression of MDR1/P-glycoprotein, DNA-topoisomerase I, and MRP2 in ovarian carcinoma patients: correlation with chemotherapeutic response. Gynecol. Oncol. 94, 152-160.

Nieth, C., Lage, H., 2005. Induction of the ABC-transporters MDR1/P-gp (Abcbl), MRP1 (Abccl), and BCRP (Abcg2) during establishment of multidrug resistance following exposure to mitoxantrone. J. Chemother. 17, 215-223.

Pettit, G., Numata, A., Cragg, G., Herald, D., Takada, T., Iwamoto, C., et al., 2000. Isolation and structures of schleicherastatins 1-7 and schleicheols 1 and 2 from the teak forest medicinal tree Schleichera oleosa. J. Nat. Prod. 63, 72-78.

Sinha, P., Hutter, G., Kottgen, E., Dietel, M., Schadendorf, D., Lage, H., 1999. Search for novel proteins involved in the development of chemoresistance in colorectal cancer and fibrosarcoma cells in vitro using two-dimensional electrophoresis, mass spectrometry and microsequencing. Electrophoresis 20, 2961-2969.

Speroni, E., Coletti, B., Minghetti, A., Perellino, N., Guicciardi, A., Vincieri, F., 1991. Activity on the CNS of crude extracts and of some diterpenoids isolated from Euphorbia calyptrata suspended cultures. Planta Med. 57, 531-535.

Szakacs, G., Paterson, J., Ludwig, J., Genthe, C., Gottesman, M., 2006. Targeting multidrug resistance in cancer. Nat. Rev. Drug Discov. 5, 219-234.

Teodori, E., Dei, S., Martelli, C., Scapecchi, C., Gualtieri, F., 2006. The functions and structure of ABC transporters: implications for the design of new inhibitors of Pgp and MRP1 to control multidrug resistance (MDR). Curr. Drug Targets 7, 893-909.

Wei, K., Li, W., Koike, K., Pei, Y., Chen, Y., Nikaido, T., 2004. Complete [.sup.1]H and [.sup.13]C NMR assignments of two phytosterols from roots of Piper nigrum. Magn. Reson. Chem. 42, 355-359.

Wesolowska, O., Wisniewski, J., Duarte, N., Ferreira, M.J., Michalak, K., 2007. Inhibition of MRP1 transport activity by phenolic and terpenic compounds isolated from Euphorbia species. Anticancer Res. 27, 4127-4134.

Zhang, S., Won, Y.K., Ong, C.N., Shen, H.M., 2005. Anti-cancer potential of sesquiterpene lactones: bioactivity and molecular mechanisms. Curr. Med. Chem. Anticancer Agents. 5, 239-249.

* Corresponding author. Tel.: +351 21 7946475; fax: +35 121 7946470.

E-mail address: mjuferreira@ff.ul.pt (M.J.U. Ferreira).

0944-7113/$-see front matter [C] 2009 Elsevier GmbH. All rights reserved.

H. Lage (a), N. Duarte (b), C. Coburger (a), (c), A. Hilgeroth (c), M.J.U. Ferreira (b), *

(a) Charite Campus Mitte, Institute of Pathology, Berlin, Germany

(b) Institute for Medicines and Pharmaceutical Sciences, (iMed.UL) Faculty of Pharmacy, University of Lisbon, Av. das Forcas Armadas, 1600-083 Lisbon, Portugal

[c] Institute of Pharmacy, Martin-Luther-University Halle-Wittenberg, Germany

doi:10.1016/j.phymed.2009.07.009
COPYRIGHT 2010 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Lage, H.; Duarte, N.; Coburger, C.; Hilgeroth, A.; Ferreira, M.J.U.
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Date:May 1, 2010
Words:6210
Previous Article:The alkaloid berberine inhibits the growth of anoikis-resistant MCF-7 and MDA-MB-231 breast cancer cell lines by inducing cell cycle arrest.
Next Article:The administration of demethyl fruticulin a from Salvia corrugata to mammalian cells lines induces "anoikis", a special form of apoptosis.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters