Printer Friendly

Antipyretic effect of Mao-to, a Japanese herbal medicine, for treatment of type a influenza infection in children.

Abstract

Mao-to is a Japanese traditional herbal medicine which has been used since ancient times for the treatment of influenza-like illness. This study was conducted to evaluate the effect of oral Mao-to administration in children with type A influenza, in comparison to Oseltamivir. We performed a controlled trial of 60 children, from 5 months through 13 years of age, with fever and influenza-like symptom of up to 48 h duration. Diagnosis of influenza type A was performed by virus isolation or detection of a viral gene by RT-PCR. Patients assigned into the following 3 groups: oral Mao-to powder (TJ-27) 0.06 g/kg body wt./dose three times daily (n = 17), Oseltamivir 2mg/kg body wt./dose twice daily (n = 18) or both oral Mao-to plus Oseltamivir (n = 14). The median duration of fever after treatment was significantly shorter in the Mao-to and Mao-to plus Oseltamivir groups, compared with the Oseltamivir only group (15h [95%CI 13.2-22.1] p<0.01; 18h[15.2-27.7] p<0.05; 24h[23.5-43.0], respectively). Oral Mao-to administration was effective in the control of fever due to type A influenza infection in children.

[c] 2006 Elsevier GmbH. All rights reserved.

Keywords: Influenza; Mao-to; Japanese herbal medicine; Oseltamivir; Pediatrics

Introduction

The neuraminidase inhibitor Oseltamivir (-Ethyl[3R, 4R, 5S]-4-acetamido-5-amino-3-[1-ethylpropoxy]cyclohex-1-ene-l-carboxylate monophosphate) (Fig. 1), a specific antiviral against type A and B influenza viruses, is effective in the treatment of influenza and is now used worldwide (Cooper et al., 2003). The drug is not, however, administered to infants under 1 year of age, because its safety for that population has not yet been established (Wooltorton, 2004). Furthermore, a recent report concerning the emergence of viruses resistant to this new drug (Gubareva, 2004; Kiso et al., 2004). It would therefore be advantageous to identify alternative strategies for treatment of influenza that do not rely on this drug.

Mao-to is a traditional herbal medicine that has been used in Japan for the treatment of influenza-like illness (high fever, headache, pain and cough) since ancient times and Ephedrae herba, one of component herbs of Mao-to has been reported to show an in vitro anti-influenza viral effect (Mantani et al., 1999). This study was conducted to investigate the efficacy of oral Mao-to administration, in order to evaluate this traditional medicine in comparison with modern treatment with the antiviral drug Oseltamivir in children with type A influenza, diagnosed based on virus isolation or detection of viral genes.

Methods

Patients

The children enrolled in this study were between the ages of 5 months and 13 years who visited the outpatient clinic of the Department of Pediatrics, Self Defense Force Sendai Hospital from January to March 2004, suffering from influenza-like illness with fever [[greater than or equal to] 38 [degrees]C], at least two constitutional symptoms (headache, chill, or fatigue) and one respiratory symptom (cough or coryza) within 48 h duration of illness.

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

Study design

We did not exclude patients who had received vaccination for influenza that season. After physical examination and before treatment, nasal swabs or aspirates were collected from each patient for definitive diagnosis of type A influenza by isolation/detection of the virus. Patients were assigned to treatment groups based on their age and the results of a rapid influenza diagnosis kit test (Capilia FLU A, B; Nippon Becton Dickinson, Tokyo, Japan) (Fig. 2). Patients positive for the kit test and under the age of 1, or negative for the kit test, were assigned to the group which was administered only oral Mao-to powder (TJ-27. Tsumura & Co., Tokyo, Japan) at a dose of 0.06g/kg body wt./dose three times daily (standard regimen for children), because they did not meet the criteria for Oseltamivir treatment in Japan. Those positive for the kit test and over the age of 1 year were randomized by two groups which received either oral Oseltamivir powder 2 mg/kg body wt./dose twice daily or both Mao-to 0.06 g/kg body wt./dose three times and Oseltamivir 2 mg/kg body wt./dose twice daily. TJ-27 contains extract from Ephedrae herba, Cinnamomi cortex, Armenicae cortex and Glycyrrhizae radix (Table 1). The three-dimensional HPLC profile of TJ-27 is shown in Fig. 3. Caregivers of the patients were asked not to use antipyretic such as acetaminophen and to record their compliance with the daily regimen of study medication, to measure body temperature by axially thermometer at least four times daily, every 6 hours after the beginning of treatment, and to note the patients' constitutional symptoms. All caregivers were provided with informed consent for enrolling the children in this study.

[FIGURE 3 OMITTED]

Assessment

The final diagnosis of influenza was determined from the results of viral culture or detection of a viral gene by RT-PCR. For viral culture, nasal specimens were transported to a laboratory in transport medium and inoculated onto MDCK cells. Influenza typing was performed using neutralization tests with authentic anti-sera provided by the National Institute of Infectious Diseases, Japan. RT-PCR was performed for specimens negative for virus isolation, using primers designed to amplify the NS gene of the type A(H3) influenza virus: AH3G 5'd (AAGCAGGGGATAATTCTATT) and AH3I 5'd (TAGAAAATGGTTGGGAGGGA) (Ellis et al., 1995).

Data analysis

Finally, patients who were confirmed to be infected with influenza virus were included in the analysis. The primary endpoint for evaluation of the therapies was time to becoming afebrile (<37.2 [degrees]C) and not to fever up again after commencement of the medication. The duration of fever after treatment in the Mao-to-treated group and the group treated with both Mao-to and Oseltamivir was compared with that of the Oseltamivir only treatment group, using the extended Wilcoxon's rank sum test. All analyses were performed with Stat View, Version 5.0 (SAS institute Inc., Cary, NC).

Results

Sixty patients were enrolled into this study; three took no study medication and were excluded. Overall, a total of 49 patients were finally enrolled in this study after excluding patients without type A influenza virus isolation or detection by RT-PCR. The subtype of influenza virus from all patients in this study was H3. Approximately 75% of the influenza virus-infected populations across the three groups were viral-culture positive, and the rest were virus-positive only by RT-PCR. There was no difference in the rating of viral-culture positive among the three groups. Seventeen of the 49 patients received only Mao-to (7 were under 1 year old), 18 only Oseltamivir, and 14 Mao-to plus Oseltamivir. The demographic and clinical characteristics of the patients were statistically similar across all groups (Table 2). Although there was no significant difference in other respiratory symptoms or in the frequency of symptomatic relief medication use among the three groups, the median duration of fever after start of medication was significantly shorter with the Mao-to group and the Mao-to plus Oseltamivir group, as compared to the Oseltamivir-only group (15 h [95%CI 13.2-22.1] p<0.01; 18 h [15.2-27.7] p<0.05; 24 h [23.5-43.0], respectively) (Fig. 4) and after fever was subsided the daily activity became "pre-illness" normal in all groups. Mao-to showed no adverse events. No patient required hospitalization during this study.

Discussion

Our study suggests that Mao-to might have a better effect on reducing the duration of fever in children with type A influenza. Although we included patients who had received current influenza vaccination in this study, it did not seem to affect the results because the number in each group was negligible and the antigenecity of the epidemic strain (A/Fujian/411/2002-like virus) of influenza A virus circulating in our community was significantly different from that of the vaccine strain (A/Panama/2007/97) for this season (data not shown). During preparation of this manuscript, publications appeared in the Japanese journals on the efficacy of Mao-to for influenza-infected patients (Kuroki and Kimoto, 2004), but the results reported were restricted because the diagnosis of influenza infection was made using only the rapid diagnosis test kit. This leaves open the possibility of including some false positive case, and the Kuroki group's trials were designed to compare the efficacy of combined therapy of Mao-to and Oseltamivir with Oseltamivir solo therapy. Our results on the Mao-to solo group reveal clearly the antipyretic effect of Mao-to.

[FIGURE 4 OMITTED]

It has been reported that Mao-to relieved influenza-like symptoms, a side effect accompanying IFN-[beta] injection, in patients with chronic hepatitis (Kainuma et al., 2004). It has been proposed that ephedrine, one of the bio-active components of Mao-to, augments the incremental production of IL-6 and IL-1 receptor antagonist (Tilg et al., 1994) and might therefore reduce such symptoms. Kakkon-to, which is also a Japanese traditional herbal medicine used for treatment of the common cold, was suggested to exhibit a different mode of antipyretic action from that of aspirin in influenza virus-infected mice, by suppressing IL-1[alpha] production via organic solvent-extractable fractions of Cinnamomum cassia contained in this medicine (Kurokawa et al., 1998). It was also reported to be effective in reducing the severity of pneumonia, and prolonged survival times by enhancing IL-12 production in the respiratory tract in influenza virus-infected mice by using Kakkon-to (Kurokawa et al., 2002). Sho-seiryu-to is another Japanese herbal medicine that has been used for the treatment of the common cold in Japan, and its effect was explained by restriction of influenza virus replication through enhancement of anti-influenza A virus IgA production, augmented by administration of this medicine in a mouse model system(Nagai and Yamada, 1994). Ephedrae herba, Cinnamomi cortex and Glycyrrhizae radix are common ingredients among these three traditional herbal medicines, and some or all of extracts of Mao-to might act in our influenza patients.

The mechanism(s) of Mao-to against influenza might be synergistic actions of direct antiviral effect and enhancement of the immune response, implying that Mao-to might be effective for the treatment of influenza caused by viruses resistant to antiviral drugs, or by antigenic variants which are not covered by current influenza vaccines. The price of Mao-to is far cheaper than that of neuraminidase inhibitors, and is usually one-tenth to twentieth the cost of Oseltamivir, so a broad range of people could afford to benefit from it.

In conclusion, Mao-to might have potential as an alternative medicine for the treatment of influenza, having different mechanism(s) of action from currently approved antiviral drugs. It might also be a potent weapon in situations such as an influenza pandemic, when a shortage of antivirals and vaccines is to be expected. Further large-scale studies to investigate the potential of Mao-to and studies of its mechanism(s) of that are required.

Acknowledgments

We would like to thank Dr. Iwao Sakakibara, Pharmacognosy & Medicinal Resources Laboratories, for three-dimensional HPLC analyses of Mao-to and Mao-to alkaloid.

References

Cooper, N.J., Sutton, A.J., Abrams, K.R., Wailoo, A., Turner, D.A., Nicholson, K.G., 2003. Effectiveness of neuraminidase inhibitors in treatment and prevention of influenza A and B: systematic review and meta-analyses of randomised controlled trials. Br. Med. J. 326, 1235-1241.

Ellis, J.S., Chakraverty, P., Clewley, J.P., 1995. Genetic and antigenic variation in the haemagglutinin of recently circulating human influenza A (H3N2) viruses in the United Kingdom. Arch. Virol. 140, 1889-1904.

Gubareva, L.V., 2004. Molecular mechanisms of influenza virus resistance to neuraminidase inhibitors. Virus Res. 103, 199-203.

Kainuma, M., Sakai, S., Sekiya, N., Mantani, N., Ogata, N., Shimada, Y., Terasawa, K., 2004. The effects of a herbal medicine (Mao-to) in patients with chronic hepatitis C after injection of IFN-[beta]. Phytomedicine 11, 5-10.

Kiso, M., Mitamura, K., Sakai-Tagawa, Y., Shiraishi, K., Kawakami, C., Kimura, K., Hayden, F.G., Sugaya, N., Kawaoka, Y., 2004. Resistant influenza A viruses in children treated with oseltamivir: descriptive study. Lancet 364, 759-765.

Kurokawa, M., Kumada, C.A., Yamamura, J., Kamiyama, T., Shiraki, K., 1998. Antipyretic activity of cinnamyl derivatives and related compounds in influenza virus-infected mice. Eur. J. Pharmacol. 348, 45-51.

Kurokawa, M., Tsurita, M., Brown, J., Fukuda, Y., Shiraki, K., 2002. Effect of interleukin-12 level augmented by Kakkon-to, a herbal medicine, on the early stage of influenza infection in mice. Antivir. Res. 56, 183-188.

Kuroki, H., Kimoto, H., 2004. Experience of combined western and oriental medicine for the treatment of influenza and measles in children. Jpn. Pediatr. Soc. Orient. Med. 20, 28-30 (in Japanese).

Mantani, N., Andoh, T., Kawamata, H., Terasawa, K., Ochiai, H., 1999. Inhibitory effect of Ephedrae herba, an oriental traditional medicine, on the growth of influenza A/PR/8 virus in MDCK cells. Antivir. Res. 44, 193-200.

Nagai, T., Yamada, H., 1994. In vivo anti-influenza virus activity of Kampo (Japanese herbal) medicine "Sho-seiryu-to" and its mode of action. Int. J. Immunopharmacol. 16, 605-613.

Tilg, H., Trehu, E., Atkins, M.B., Dinarello, C.A., Mier, J.W., 1994. Interleukin-6 (IL-6) as an anti-inflammatory cytokine: induction of circulating IL-1recepter antagonist and soluble tumor necrosis factor receptor. Blood 83, 113-118.

Wooltorton, E., 2004. Oseltamivir (Tamiflu) unsafe in infants under 1 year old. Can. Med. Assoc. J. 170, 336.

Tomohiro Kubo (a,*), Hidekazu Nishimura (b)

(a) Department of Pediatrics, Self Defense Force Sendai Hospital, Minaminometate 1-1, Miyaginoku, Sendai, Miyagi, Japan

(b) Virus Research Center, Clinical Research Division, Sendai Medical Center, National Hospital Organization, Miyagi, Japan

*Corresponding author. Tel.: +81 22 231 1111(5245); fax: +81 22 235 6642.

E-mail address: bokukubo17@hotmail.com (T. Kubo).
Table 1. The component drugs of Mao-to (TJ-27)

Ephedrae herba 5.0 g
Armenicae cortex 5.0 g
Cinnamomi cortex 4.0 g
Glycyrrhizae radix 1.5 g

1.75 g of spray-dried powdered extract from these herbs is included in
7.5 g of Mao-to (TJ-27).

Table 2. Demographic and clinical characteristics of influenza patients

 Mao-to and
 Oseltamivir Oseltamivir
 (n = 18) (n = 14) Mao-to (n = 17)

Mean (SD) age (years) 5.39 (1.98) 5.26 (1.97) 4.56 (4.82)
Male/female 56%/44% 43%/57% 47%/53%
Mean (SD) duration of 10.6 (9.1) 11.2 (10.2) 11.4 (12.6)
 fever before
 medication (h)
Mean (SD) baseline 38.4 (0.7) 38.7 (0.5) 38.7 (0.6)
 temperature
 ([degrees]C)
No. of patients 2 2 0
 immunized with
 current influenza
 vaccine
COPYRIGHT 2007 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2007 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Kubo, Tomohiro; Nishimura, Hidekazu
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Geographic Code:9JAPA
Date:Feb 1, 2007
Words:2359
Previous Article:Steroid-sparing effect of wormwood (Artemisia absinthium) in Crohn's disease: a double-blind placebo-controlled study.
Next Article:Influence of excipients and technological process on anti-inflammatory activity of quercetin and Achyrocline satureioides (Lam.) D.C. extracts by...
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters