Printer Friendly

Antiproliferative effect of hydroethanolic extracts of seeds of Cola verticillata and leaves of Solanum scabrum.

Introduction

Cancer led to the death of 7.6 million people in 2008 say 21 % of deaths caused by noncommunicable diseases (NCD) (WHO, 2011) and could be the first cost of mortality in the coming years (Seffrin, 2008). It is a malignant pathology that implicates three well distinct but connected steps: initiation (normal cell transforms into initiated cell), promotion (initiated cell transforms into pre-neoplastic cell), and progression (pre-neoplastic cell becomes neoplastic) (Thangapazham et al., 2006). It is characterized by the uncontrolled growth and proliferation of abnormal cells. Chemotherapy is a reference in the treatment of cancer but applied alone rarely provides healing (Lake and Robinson, 2005). Its association to other types of treatment like surgery and radiotherapy provide more efficient results (Oba, 2009). Apart from chemotherapy, radiotherapy, and surgery, phytotherapy is highly progressing.

Phytotherapy is well known and available in the whole world be it in developing or developed countries. Due to the high cost of other cancer treatments, in Sub-Saharan Africa, phytotherapy is applied through traditional medicine which implicates the use of medicinal plants in the management of this disease. Among these medicinal plants, some are consumed as food and mostly targeted for their healing potentials; it is the case with certain fruits and vegetables highly consumed in Cameroon. Cola verticillata whose seeds are consumed in the name of kola nut and Solanum scabrum whose leaves are consumed as vegetable locally called Njama-njama are two of such plants. C. verticillata belongs to the family of Sterculiaceae. Most members of this family have been found to have high antioxidant potential (Endrini et al., 2009; Momo et al., 2009) and also to be cytotoxic on some cancer cell lines (Endrini et al., 2009). S. scabrum is highly consumed in the north-western region of Cameroon as a vegetable. It is locally used as analgesic, febrifuge, narcotic, and purgative by local population. A closely related specie, Solatium nigrum has been proven to be hepato-protective (Sultana et al., 1995), neuropharmacological (Perez et al., 1998), and antiproliferative (Son et al., 2003). Because of the growing importance of phytotherapy in the treatment of cancer, phytotherapeutic projects have acquired an important part of the medical market and its progression is noticed in Europe and the United States (Saklani and Kutty, 2008). It is in this continuous search that we proposed to study the possible use of two Cameroonian functional foods in the management of cancer.

Materials and Methods

Preparation of hydroethanolic extracts

Fruits of C. verticillata were harvested in Bamena, in the western region of Cameroon in april 2010, while leaves of S. scabrum were harvested in Babangui, in the north-west region of Cameroon in march 2010. Both were identified at the National Herbarium in Yaounde, Cameroon. They were then sundried until constant weight was attained. After which they were grinned and the obtained powder was used to prepare hydroethanolic extracts. For this, 500 g of each material was marcerated for 48 h in 2000 ml of 50% ethanol. After maceration, the filtrates were recuperated and concentrated by air drying at 40[degrees]C to obtain crude hydroethanolic extracts of C. verticillata and S. scabrum.

Cell culture

The cell line used was the A2780 human ovarian carcinoma. The A2780 cells used for this study were obtained from the cell bank of the Laboratory of Functional Genomics and Experimental Pathology, The Oncology Institute, Prof. Dr. Ion Chiricuta, Cluj-Napoca, Romania. They were grown in RPMI 1640 supplemented with 10% fetal bovine serum (FBS), 2 mM L-Glutamine, and 100IU/ml penicillin + 100 mg/ml streptomycin in 5% C[O.sub.2] humidified environment at 37[degrees]C. All reagents were purchased from Sigma--Aldrich, Germany.

Cell treatment

Cells were treated for 24 and 48 h at varying concentrations of C. verticillata and S. scabrum extracts (0.25, 1, 2.5, 5, 10, 50, 100, 250, and 500 [micro]g/ml). Cell treatment was done on 96 well plates where 2 x [10.sup.4] cells were introduced into each well plate in a volume of 200 [micro]l. Each concentration was done in quadruplet and control wells were present in all plates. Cells were seeded into wells 24 h before treatment. The treatment was done by adding 20 [micro]l extract of well defined concentrations into corresponding wells and they were left for 24 and 48 h after which the MTT viability assay was carried.

Viability test

The viability test was done by the tetrazolium 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye reduction assay (Mosmann, 1983). After treating cells for 24 or 48 h, the culture medium in plates was discarded and wells washed with phosphate buffered saline (PBS). 50 [micro]l of hank's solution containing 1 mg/ml of MTT was pipetted into each well and the plates reincubated for 2 h. The wells were washed once more with PBS then 70 [micro]l of pure DMSO was added to solubilize the formazan crystals formed due to action with MTT. The plates were protected from light and agitated at 300 rpm for 5 min at room temperature after which they were read using a Tecan Sunrise microplate reader at 492 nm.

Cell treatment for RT-PCR

For this, six well plates were used and 4 x 105 cells were seeded into each well 24 h before treatment. Cells were treated for 24 h with concentrations of 10 and 50 [micro]g/ml for both hydroethanolic extracts of C. verticillata and S. scabrum (the concentrations were chosen based on the calculated Inhibitiory concentration 50 ([IC.sub.50]) after the viability test). Each concentration was done in triplicate for each extract and controls (untreated cells) were present.

Extraction and purification of RNA

Treating cells for 24 h led to RNA extraction using TRI-reagent (Sigma--Aldrich, Germany) by digestion. Seperation of cellular contents was done by adding chloroform to the mixture containing cell debris and TRI-reagent. After centrifugation the top phase containing RNA was pipetted into another tube. 70% ethanol was added to precipitate RNA. Purification was done by repeated washes using 75% ethanol. At the end of the purification process, RNA was solubilized in 30 [micro]l of RNase-free water. Quantity analyses using NanoDrop 1000[R] spectrometer and quality analyses using Lab-on-a-chip Agilent 2100 Bioanalyzer (Agilent technology) were done to determine if the purified RNA could be used for further analyses. All the RNAs presented a RNA intergrity number (RIN) between 9 and 10 permitting us to continue with our analyses.

cDNA synthesis

For cDNA synthesis in this experiment, the Random Hexamer Priming method was exploited as described by the manufacturer of the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnosis, Germany). Dilutions were done for each RNA purified sample so as to obtain a final concentration of 1000 ng/11 ul for each sample (starting concentration for cDNA synthesis was the same in each tube).

qRT-PCR (quantitative reverse transcriptase-polymerase chain reaction) assay

The LightCycler[R] Carousel-Based System (LightCycler[R] Software 4.0, Roche) in combination with the LightCycler TaqMan Master kit were used for qRT-PCR analyses according to the protocol provided by the manufacturer. Template cDNA was added to TaqMan Universal Master Mix with specific primers and probe for each gene: Beta-actin, left primer CCAACCGCGAAGATGA, right primer CCAGAGGCGTACAGGGATAG; PDGF, left primer TGATCTCCACGCCTGCT, right primer TGCATGTTCAGGTCCAACTCG; p53, left primer AGGCCTTGGAACTCAAGGAT, right primer CCCTTTTTGGACTTCAGGT G; ICAM-1, left primer CCTTCCTCACCGTGTACTGG, right primer AGCGTAGGGTAAGGTTCTTGC; VEGF, left primer CCACTTCGTGATGATTCGC, right primer TACCTCCACCATGCCAAGT; BCL-2, left primer CATGTGTGTGGAGAGCGTCAA, right primer GCCGGTTCAGGTACTCAGTCA; TNF[alpha], left primer CAGCCTCTTCTCCTTCCTGAT, right primer GCCAGAGGGCT GATTAAGAGA; ERCC1, left primer CGGACCTCCTGATGGAGA, right primer TTCACGGTGGTCAGACATTC. The PCR array data analysis software using the AACT method, which is based on fold-change calculations with normalization for all the genes was used.

[FIGURE 1 OMITTED]

Statistical analysis

Analysis were done using Graphpad Prism 5.04 and SPSS 16.0; results were analysed using analysis of variance (ANOVA) and they were expressed in mean [+ or -] standard deviation. Where necessary a least significant difference (LSD) test was used to compare means and results were considered statistically different when p < 0.05.

Results

Antiproliferative assay

Antiproliferative activity of hydroethanolic extracts of S. scabrum and C. verticillata was evaluated using MTT assay. Cells were treated with extracts for 24 and 48 h after which MTT was carried-out on them.

[FIGURE 2 OMITTED]

Concerning cells treated with S. scabrum, both 24 and 48 h treated gave curves which both followed the normal decay trend (Figure 1). The [IC.sub.50] of cells treated for 24 h (15.00 [micro]g/ml) was higher than for those treated for 48 h (11.30 [micro]g/ml) and these [IC.sub.50]s were found to be statically different (p [less than or equal to] 0.01).

The curve of percentage of control against log of concentration for cells treated with C. verticillata for 24 h gave a curve that followed the normal trend while those treated for 48 h did not follow the normal trend (Figure 2). From analysis the [IC.sub.50] for treating cells for 24 h was significantly different from that for 48 h treatment (p [greater than or equal to] 0.01); the [IC.sub.50] for 24 h treatment was 19.83 [micro]g/ml while that of cells treated for 48 h was 15.30 [micro]g/ml. Cells treated for a longer period (48 h) showed an [IC.sub.50] that was lower than for cells treated for a shorter period (24 h).

Gene modulation by extracts

For the evaluation of gene modulation by extracts two doses (10 and 50 [micro]g/ml) of each extract (hydroethanolic extracts of S. scabrum and C. verticillata) were used. The genes evaluated for both extracts included BCL-2, p53, PDGF, ICAM-1, ERCC1, TNF[alpha], and VEGF.

Figure 3 below is a graphic representation of gene modulation using C. verticillata extracts. Overall, the evaluated genes were downregulated by both doses of the extract except for TNF[alpha] gene which was upregulated after treatment with 10 [micro]g/ml of C. verticillata. BCL-2 was downregulated and the difference between the two was not significant. This results could imply that apoptosis through a pathway that involves BCL-2 is induced by C. verticillata. p53 was not significantly modulated by the lower dose while it was significant downregulated by the lower dose (p [less than or equal to] 0.05). This could imply that the two doses activated two different apoptotic pathways. The other apoptotic gene evaluated was TNF[alpha] which was found to be downregulated by the 50 [micro]g/ml dose while it was upregulated by the 10 [micro]g/ml dose (1.84 folds) and the difference between the two was significant. Still these two doses could exploit different pathways for the induction of apoptosis. Apart from these three apoptovtic genes, three angiogenic genes and one DNA repair gene were equally evaluated notably PDGF, ICAM-1, ERCC1, and VEGF, which were downregulated even if the folds were different for each gene and dose. The 0.32 and 0.53 fold for the downregulation of the higher and lower doses of PDGF were found to be significantly the same (p [greater than or equal to] 0.05). This was also the case with the regulation of ICAM-1. As concerns ERCC1 and VEGF, the two doses showed significantly different (p [less than or equal to] 0.05) fold differences with the 50 [micro]g/ml dose being more downregulated than the 10 [micro]g/ml dose. The downregulation of these four angiogenic genes could suppose that hydroethanolic extract of C. verticillata fruit is antiangiogenic.

[FIGURE 3 OMITTED]

Figure 4 is a representation of gene modulation using S. scabrum extracts. The two doses tested were 10 and 50 [micro]g/ml same as with C. verticillata. Of all evaluated genes, two of them were upregulated while the remaining five were downregulated. BCL-2 was upregulated by 24 h treatement with 50 (2.63 folds) and 10 [micro]g/ml (1.67 folds) and the increased expression was different for the two doses (p [less than or equal to] 0.05). The apoptotic mechanism involving BCL-2 is possibly not that exploited by the hydroethanolic extract of S. scabrum. As concerns p53, treatment with the 50 [micro]g/ml dose did not modulate this gene (1.00 folds), while treatment with the 10 [micro]g/ml dose significantly increased the expression of the p53 gene (1.28 folds). This result suggested that apoptosis induced by this extract was p53 dependent. The other apoptotic gene evaluated was TNF[alpha] and it was found to be underexpressed in cells after treatment with S. scabrum with no significant difference between the two doses (p [greater than or equal to] 0.05). This could imply that induction of apoptosis does not exploit the TNF[alpha] path. Like in treatment with C. verticillata, all angiogenic genes as well as the DNA repair gene were underexpressed in cells treated with this extract and this was independent of the dose. Contrarily to the other three genes which showed no significant difference between the 50 and 10 [micro]g/ml dose, VEGF showed a difference in the expression levels between the lower and the higher dose (p [less than or equal to] 0.05).

[FIGURE 4 OMITTED]

S. scabrum and C. verticillata affected the evaluated genes differently for some and same for others (Table 1). BCL-2 was downregulated by C. verticillata but upregulated by S. scabrum (p [less than or equal to] 0.01). p53 was downregulated by C. verticillata and for S. scabrum the higher dose did not alter regulation while the lower dose upregulated p53 and these two were significantly different (p [less than or equal to] 0.05) from the downregulation of the two doses of C. verticillata. Regulation of PDGF was significantly the same for both extracts independent of the doses (p [greater than or equal to] 0.05). For ICAM-1, there was a significant difference between the 50 [micro]g/ml dose of C. verticillata compared with both doses of S. scabrum (p [less than or equal to] 0.05). As concerns ERCC1, there was also a significant difference between the higher dose of C. verticillata and both doses of S. scabrum (p [less than or equal to] 0.05). TNF[alpha] showed significantly different results between the lower dose of C. verticillata and the higher dose of S. scabrum (p [less than or equal to] 0.05) but significantly the same with the lower dose of the same extract (p [greater than or equal to] 0.05). There was a significant difference in the modulation of VEGF between the treatment with the 10 [micro]g/ml dose of S. scabrum and both doses of C. verticillata (p [less than or equal to] 0.05) but no difference with the 50 [micro]g/ml dose of S. scabrum (p [greater than or equal to] 0.05). Table 2 shows the fold changes for each gene for every corresponding dose of each extract.

Discussion

Consumption of fruits and vegetables has been associated with reduced risk of chronic diseases such as cardiovascular diseases and cancer.

In this study, C. verticillata and S. scabrum which are two functional foods highly consumed in Cameroon were tested for anti-proliferative potential using the MTT assay. Their [IC.sub.50] s were determined and it was found that hydroethanolic extracts of both plants altered cell viability and this at concentrations that were within the micromolecular range; the best concentration obtained with S. scabrum (11 [micro]g/ml). The potential use of plant derived molecules as active substances in the management of bacterial infections, malaria, and cancer is well documented (Philippe and Angenot, 2005; Frederich et al., 2002). The National cancer institute estimates that a plants extract that has shown an antiproliferation inhibitory activity of [IC.sub.50] lower than 30 [micro]g/ml during the preliminary cytotoxic test could be considered a potential source of cytotoxic molecules (Jokhadze et al., 2007). C. verticillata and S. scabrum extracts that were tested gave [IC.sub.50] that were lower than 20 [micro]g/ml. Prior to these, hydroethanolic extracts of seeds of C. verticillata and leaves of S. scabrum could be considered to have a potential anticancerous activity and could be further studied in view of obtaining new bioactive molecules destined for the treatment of cancer.

In the last decade, basic cancer research has produced remarkable advances in our understanding of cancer biology and cancer genetics. Among these the realization that, apoptosis and the genes that control it have a profound effect on the malignant phenotype. For example, it is now clear that some oncogenic mutations disrupt apoptosis, leading to tumor initiation, progression or metastasis. Conversely, compelling evidence indicates that other oncogenic changes promote apoptosis, thereby producing selective pressure to supress apoptosis during multistage carcinogenesis. The life span of both normal and cancer cells within a living system is regarded to be substantially affected by rate of apoptosis.

p53 is a gene that codes for a protein p53 that regulates cell cycle and hence functions as a tumor suppressor gene. It is a key factor in the initiation of apoptosis as it holds an important role in cell cycle arrest at the G1 phase. Its positive or negative regulation is dependent on the expression of many proto-oncogenes (Favaudon, 2000). C. verticillata extract used in our study was found to downregulate p53. Downregulation of p53 here does not correspond to the antiproliferative property that this extract has. It can be proposed here that apoptosis induced by this extract was not p53 dependent. In p53 deficient cells, intrinsic apoptosis can be induced by the tumor protein p73. Apparently, p73 shares numerous regulatory principles and effector pathways with p53 (Bitomsky and Hofmann, 2009). p73 dependent apoptosis seems to be primarily regulated by its ability to transcriptionally activate pro-apoptotic p53 target genes (Pietsch et al., 2008). Also it has been proposed that apoptosis induced by DNA damage is not necessarily p53 dependent and that apoptosis due to DNA damage is p53 independent and is correlated to G2/M cell cycle arrest (Arita et al., 1997). Contrarily to C. verticillata extracts, A2780 ovarian cancer cells treated with S. scabrum, did not downregulated p53; the higher dose (50 [micro]g/ml) did not modify p53 expression while the lower dose (10 [micro]g/ml) upregulated its expression. As a matter of fact, the p53 gene is a well-known tumor suppressor gene with a significant role in the regulation of cell death and angiogenesis but its molecular mechanisms are far from completely understood. However, p53 can downregulate some pro-angiogenic proteins like VEGF or upregulate antiangiogenic proteins. The apoptotic process can be induced by two molecular pathways, an extrinsic pathway that operates via death receptors on the cell surface and an intrinsic pathway triggered via mitochondria stimuli (Burz et al., 2009). Nevertheless, both pathways are linked with other signaling proteins, such as p53, MDM2, and NK-[kappa]B and converge at the level of caspases (effector proteolytic enzymes). Resveratrol is an anticancer agent that induces apoptosis through the activation of p53 tumor suppression gene (Laux et al., 2004).

The common mechanism of apoptosis is negatively regulated by several sets of genes, of which the best characterized is the still growing BCL-2 family (Adams and Cory, 1998; Tsujimoto, 1998). The BCL-2 family of proteins that consists of antiapoptotic and pro-apoptotic members determine life-or-death of a cell by controlling the release of mitochondrial apoptogenic factors, cytochrome c, and apoptosis-inducing factor (AIF), that activate downstream executional phases, including the activation of death proteases called caspases (Tsujimoto and Shimzu, 2000). The BCL-2 proteins are a family of proteins involved in the response to apoptosis. Some of these proteins (such as BCL-2 and BCL-XL) are antiapoptotic, while others (such as Bad, Bax, Bak or Bid) are pro-apoptotic (Adams and Cory, 1998; Tsujimoto, 1998). The sensitivity of cells to apoptotic stimuli can depend on the balance of pro- and antiapoptotic BCL-2 proteins. BCL-2 family proteins influence the mitochondrial pathway of apoptosis (Athar et al., 2009). When there is an excess of pro-apoptotic proteins the cells are more sensitive to apoptosis, when there is an excess of antiapoptotic proteins the cells will tend to be more resistant. BCL-2 of the BCL-2 family prevents all mitochondrial changes including cytochrome c release (Jurgensmeier et al., 1998; Narita et al., 1998). It thus protects cells from undergoing apoptosis through the p53 pathway but it does not alter the trans-activation of Bax and p21 by p53. It is thought that BCL-2 has an additional ability to prevent caspase activation by sequestrating Apaf-1 (Hu et al., 1998; Pan et al., 1998). S. scabrum used in treating cells led to the upregulation of the BCL-2 gene. Knowing that antiproliferation was observed anyway in cells treated with S. scabrum, it could be supposed that cell death did not depend on a pathway that directly implicated BCL-2. Cytotoxicity due to S. scabrum could be linked to ATP depletion in treated cells. Reduction of ATP levels induces a disorganisation of the actine cytoskeleton in treated cancer cells. Quite a number of bioactive molecules have been determined to be cytotoxic by causing ATP depletion. It is the case with cardiotonic glycosides (Van Quaguebeke et al., 2005), pancratistatine (Kekre et al., 2005), and tetrandrine (Yan et al., 2006). Most often, ATP reduction is associated to increase in ROS (Yan et al., 2006) which is often thought to be a factor capable of activating apoptosis (Kekre et al., 2005). Cells treated with 50 and 10 [micro]g/ml of C. verticillata for 24 h had their BCL-2 downregulated. BCL-2 is an antiapoptotic protein that protects cells from programmed cell death by preventing the activation of pro-apoptotic caspase proteins like Bax, Bak, and Bok. Its underexpression would thus not block apoptosis but favor it.

Death receptors are cell surface receptors that transmit apoptotic signals initiated by specific ligands such as Fas, TNF[alpha], and TRAIL. TNF[alpha] is a ligand that binds to a death receptor on the surface of the cell even if its role in inflammation is far more important than its role in apoptosis. In our experiment, both doses of S. scabrum led to the downregulation of TNF gene. The 50 [micro]g/ml dose of C. verticillata equally led to downregulation of this gene. At this level it could be suggested that the extrinsic apoptotic pathway is not stimulated at least concerning the TNF-R1 recptor. Fas was not evaluated and so it cannot be assumed that this pathway is not activated by these extracts. This withstanding, the lower dose (10 [micro]g/ml) of C. verticillata led to the upregulation of TNF. It can be suggested that, upregulation of TNF is very sensitive to dose and so far as TNF is concerned, very low doses of hydroethanolic extracts of C. verticillata are necessary to lead to its over expression.

The formation of new blood vessels through a process called angiogensis is a necessary one in living organisms. It becomes a nuisance when it allows for tumors to grow by offering them opportunities to feed their cells. These new blood vessels most frequently have thin walls causing them to be permeable, these allowing tumors cells to leave their primary sites more readily. Thus, new vessels embedded in a tumor provide a channel for tumor cells to enter circulation and to metastasize to other sites. If contrarily tumors cannot form these vessels, they will not be able to grow in size and their ability to metastasize will be lower.

There has been evidence that VEGF plays a central role during angiogenesis. Higher levels of VEGF have been found in cancer cells when compared to normal cells (Loncaster et al., 2000). This higher level has been correlated with limited overall survival of cancer patients (Cheng et al., 2000). VEGF-A is a pluripotent vasoactive cytokine that stimulates endothelial cell proliferation and chemotaxis, and increases endothelial solute permeability (Kevil et al., 1998). In our study 24 h treatment of A2780 ovarian cancer cells with hydroethanolic extracts of C. verticillata and S. scabrum led to the downregulation of VEGF gene for both doses that were tested. It could be concluded that downregulation of VEGF leads to an inhibition of the production of VEGF.

An important family of growth factors implicated in cell proliferation and migration is the PDGF family. PDGF regulates a diverse array of cellular processes including cell proliferation, migration, transformation, and apoptosis. PDGF in its paracrine role is indirectly implicated in angiogenesis induced by stimulation of pericytes and mural cells whose secretion is stimulated by the pro-inflammatory agent VEGF (McCarty et al., 2007). Its autocrine role, is its activation of the PI3K/Akt and MAPK (Kitadai et al., 2006) pathway thus inducing the survival of tumor cells. In our study all tested extracts, this independent of the dose were found to downregulate the expression of PDGF gene. These results suggest that underexpression of PDGF together with underexpression of other pro-angiogenic genes in treated A2780 ovarian cancer cells could be responsible for the antiproliferation these cells.

ICAM-1 (Intercellular adhesion molecule 1) also known as CD54 is a protein that in humans is coded for by ICAM-1 gene and is a member of the immunoglobuline superfamily. Studies have proven that ICAM plays an important role in modulating angiogenic activity (Goebel et al., 2006). Little is known about the mechanism through which it influences the angiogenesis. It is at least known that stimulation of VEGF-A of endothelial cells increases ICAM-1 expression (Goebel et al., 2006). ICAM-1 thus facilitates VEGF-A mediated angiogenesis. A novel mechanism whereby ICAM-1 expression regulates VEGF-A mediated eNOS activity and angiogenesis through regulation of endothelial glutathione levels has been proposed (Langston et al., 2007). In our study both hydroethanolic extracts of C. verticillata and S. scabrum downregulated ICAM-1 for both the 10 and 50 pg/ml doses. Reduction of the expression of ICAM-1 by extracts is important as this is associated with increase in GSH levels which upregulates phosphatase and tensin homolog (PTEN). PTEN is a well known tumor suppressor gene (Cantley and Neel, 1999) whose modulation could be exploited in the quest for antitumoral cancer agents.

Excision repair cross complementing gene 1 (ERCC1) is a highly conserved enzyme which is specific to the nucleotide excision repair (NER) 1 pathway and its absence is incompatible with life. It is involved in the repair of damaged DNA (McHugh et al., 2001). In normal tissue, a disorder leading to the suppression of ERCC1 is associated with DNA repair deficiency and this can be highly deleterious to the organism as may lead to irreparable genetic disorders and even carcinogenesis. In cancer cells, ERCC1 levels are high but this is not an asset; high levels of ERCC1 have led to resistance to certain cancer drugs (Lord et al., 2002). In our study, both tested extracts were found to reduce the expression of ERCC1 protein as ERCC1 gene was found to be downregulated by these two extracts. In a study carried out by Tsai and collaborators, administration of curcumin significantly increased the cytotoxicity due to cisplatine in cells that had been proven to be resistant to cisplatine treatment (Tsai et al., 2011). These two extracts could thus act as curcumin by reducing ERCC1 levels leading to increased sensitivity to cancer treatments.

Practical Applications

Leaves of S. scabrum and seeds of C. verticillata are highly consumed in Cameroonian diets especially in the grassfield region. Like most fruits and vegetables they have been proven to possess high antioxidant potentials. Consumption of such foods has been associated with decrease risk of degenerative diseases like cancer.

In our study we found that hydroethanolic extracts S. scabrum and C. verticillata possessed antiproliferative capacity and modulated the expression of certain gene that have been proven to be affected in cancer patients. From the obtained results, these two plants were found to possess anticancer properties.

The results of this pilot study indicate that these two foods could be highly considered for anticancer studies. Knowing that the prevalence of cancer is fastly increasing in developing countries like Cameroon, the consumption of these foods could be advised to Cameroonians. This study would thus have served for the valorization of these foods.

Conflict of Interests

None declared.

Authors' Contributions

All authors contributed equally to this study.

References

Adams JM, Cory S, 1998. The BCL-2 protein family: arbiters of cell survival. Science (New York, N.Y.) 281(5381): 1322-1326.

Arita D, Kambe M, Ishioka C, Kanamaru R, 1997. Induction of p53-independent apoptosis associated with G2M arrest following DNA damage in human colon cancer cell lines. Japanese Journal of Cancer Research, 88(1): 39-43.

Athar M, Back JH, Kopelovich L, Bickers DR, Kim AL, 2009. Multiple molecular targets of resveratrol: anticarcinogenic mechanisms. Archives of Biochemistry and Biophysics, 486(2): 95-102.

Bitomsky N, Hofmann TG, 2009. Apoptosis and autophagy: regulation of apoptosis by DNA damage signaling--roles of p53, p73, and HIPK2. The FEBS Journal, 276(21): 6074-6083.

Burz C, Berindan-Neagoe I, Balacescu O, Irimie A, 2009. Apoptosis in cancer: key molecular signaling pathways and therapy targets. Acta Oncologica, 48(6): 811-821.

Cantley LC, Neel BG, 1999. New insights into tumor suppression: PTEN suppresses tumor formation by restraining the phosphoinositide 3-kinase/AKT pathway. Proceedings of the National Academy of Sciences of USA, 96(8): 4240-4245.

Cheng WF, Chen CA, Lee CN, Wei LH, Hsieh FJ, Hsieh CY, 2000. Vascular endothelial growth factor and prognosis of cervical carcinoma. Obstetrics and Gynecology, 96: 721-726.

Endrini S, Marsiati H, Suherman P, Fauziah O, Asmah R, 2009. Antioxidant activities and cytotoxic effect of cola nut extract (Cola nitida) on human liver carcinoma cell lines (HepG-2). Jurnal Kedokteran YARSI, 17(1): 40-44.

Favaudon V, 2000. Regulation of cell cycle and radiation-induced cell death. Cancer Radiotherapie, 4(5): 355-368.

Frederich M, Jacquier MJ, Thepenier P, De Mol P, Tits M, Philippe G, et al., 2002. Antiplasmodial activity of alkaloids from various strychnos species. Journal of Natural Products, 65(10): 1381-1386.

Goebel S, Huang M, Davis WC, Jennings M, Siahaan TJ, Alexander JS, et al., 2006. VEGF-A stimulation of leukocyte adhesion to colonic microvascular endothelium: implications for inflammatory bowel disease. American Journal of Physiology, Gastrointestinal and Liver Physiology, 290(4): 648-654.

Hu Y, Ding L, Spencer DM, Nunez G, 1998. WD-40 repeat region regulates Apaf-1 self-association and procaspase-9 activation. The Journal of Biological Chemistry, 273(50): 33489-33494.

Jokhadze M, Eristavi L, Kutchukhidze J, Chariot A, Angenot L, Tits M, et a/., 2007. In vitro cytotoxicity of some medicinal plants from Georgian Amaryllidaceae. Phytotherapy Research, 21(7): 622-624.

Jurgensmeier JM, Xie Z, Deveraux Q, Ellerby L, Bredesen D, Reed JC, 1998. Bax directly induces release of cytochrome c from isolated mitochondria. Proceedings of the National Academy of Sciences of USA, 95(9): 4997-5002.

Kekre N, Griffin C, McNulty J, Pandey S, 2005. Pancratistatin causes early activation of caspase-3 and the flipping of phosphatidyl serine followed by rapid apoptosis specifically in human lymphoma cells. Cancer Chemotherapy and Pharmacology, 56(1): 29-38.

Kevil CG, Payne DK, Mire E, Alexander JS, 1998. Vascular permeability factor/vascular endothelial cell growth factor-mediated permeability occurs through disorganization of endothelial junctional proteins. The Journal of Biological Chemistry, 273(24): 15099-15103.

Kitadai Y, Sasaki T, Kuwai T, Nakamura T, Bucana CD, Fidler IJ, 2006. Targeting the expression of platelet-derived growth factor receptor by reactive stroma inhibits growth and metastasis of human colon carcinoma. The American Journal of Pathology, 169(6): 2054-2065.

Lake RA, Robinson BW, 2005 Immunotherapy and chemotherapy-a practical partnership. Nature Reviews Cancer, 5(5): 397-405.

Langston W, Childlow JH Jr., Booth BA, Barlow SC, Lefer DJ, Patel RP, et al., 2007. Regulation of endothelial glutathione by ICAM-1 governs VEGF-A-mediated eNOS activity and angiogenesis. Free Radical Biology and Medicine, 42(5): 720-729.

Laux MT, Aregullin M, Berry JP, Flanders JA, Rodriguez E, 2004. Identification of a p53-dependent pathway in the induction of apoptosis of human breast cancer cells by the natural product, resveratrol. Journal of Alternative and Complementary Medicine, 10(2): 235-239.

Loncaster JA, Cooper RA, Logue JP, Davidson SE, Hunter RD, West CM, 2000. Vascular endothelial growth factor (VEGF) expression is a prognostic factor for radiotherapy outcome in advanced carcinoma of the cervix. British Journal of Cancer, 83(5): 620-625.

Lord RV, Brabender J, Gandara D, Alberola V, Camps C, Domine M, et al., 2002. Low ERCC1 expression correlates with prolonged survival after cisplatin plus gemcitabine chemotherapy in non-small cell lung cancer. Clinical Cancer Research, 8(7): 2286-2291.

McCarty MF, Somcio RJ, Stoeltzing O, Wey J, Fan F, Liu W, et al., 2007. Overexpression of PDGF-BB decreases colorectal and pancreatic cancer growth by increasing tumor pericyte content. The Journal of Clinical Investigation, 117(8): 2114-2122.

McHugh PJ, Spanswick VJ, Hartley JA, 2001. Repair of DNA interstrand crosslinks: molecular mechanisms and clinical relevance. The Lancet Oncology, 2(8): 483-490.

Momo CEN, Ngwa AF, Dongmo GIF, Oben JE, 2009. Antioxidant properties and a-amylase inhibition of Terminalia superb, Albizia sp., Cola nitida, Cola odorata, and Harugana madagascarensis, used in the management of diabetes in Cameroon. Journal of Health Science, 55(5): 732-738.

Mosmann T, 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. Journal of Immunological Methods, 65(1-2): 55-63.

Narita M, Shimizu S, Ito T, Chittenden T, Lutz RJ, Matsuda H, et al., 1998. Bax interacts with the permeability transition pore to induce permeability transition and cytochrome c release in isolated mitochondria. Proceedings of the National Academy of Sciences of the USA, 95(25): 14681-14686.

Oba K, 2009. Efficacy of adjuvant chemotherapy using tegafur-based regimen for curatively resected gastric cancer: update of a meta-analysis. International Journal of Clinical Oncology, 14(2): 85-89.

Pan G, O'Rourke K, Dixit VM, 1998. Caspase-9, BCL-XL, and Apaf-1 form a ternary complex. The Journal of Biological Chemistry, 273(10): 5841-5845.

Perez RM, Perez JA, Garcia LM, Sossa HM, 1998. Neuropharmacological activity of S. nigrum fruit. Journal of Ethnopharmacology, 62(1): 43-48.

Philippe G, Angenot L, 2005. Recent developments in the field of arrow and dart poisons. Journal of Ethnopharmacology, 100(1-2): 85-91.

Pietsch EC, Sykes SM, McMahon SB, Murphy ME, 2008. The p53 family and programmed cell death. Oncogene, 27(50): 6507-6521.

Radisavljevic Z, Avraham H, Avraham S, 2000. Vascular endothelial growth factor upregulates ICAM-1 expression via the phosphatidylinositol 3 OH-kinase/AKT/Nitric oxide pathway and modulates migration of brain microvascular endothelial cells. The Journal of Biological Chemistry, 275(27): 20770-20774.

Saklani A, Kutty SK, 2008. Plant-derived compounds in clinical trials. Drug Discovery Today, 13(3-4): 161-171.

Seffrin JR, 2008. Cancer control as a human right. The Lancet Oncology, 9(5): 409-411.

Son YO, Kim J, Lim JC, Chung Y, Chung GH, Lee JC, 2003. Ripe fruits of S. nigrum L. inhibits cell growth and induces apoptosis in MCF-7 cells. Food and Chemical Toxicology, 41(10): 1421-1428.

Sultana S, Perwaiz S, Igbal M, Athar M, 1995. Crude extracts of hepatoprotective plants, S. nigrum and Cichorium intybus inhibit free radical-mediated DNA damage. Journal of Ethnopharmacology, 45(3): 189-192.

Thangapazham RL, Sharma A, Maheshwari RK, 2006. Multiple molecular targets in cancer chemoprevention by curcumin. The AAPS Journal, 8(3): 443-449.

Tsai MS, Weng SH, Kuo YH, Chiu YF, Lin YW, 2011. Synergistic effect of curcumin and cisplatin via downregulation of thymidine phosphorylase and excision repair cross-complementary 1 (ERCC1). Molecular Pharmacology, 80(1): 136-146.

Tsujimoto Y, 1998. Role of BCL-2 family proteins in apoptosis: apoptosomes or mitochondria? Genes to Cells, 3(11): 697-707.

Tsujimoto Y, Shimizu S, 2000. BCL-2 family: life-or-death switch. FEBS Letters, 466(1): 6-10.

Van Quaguebeke E, Simon G, Andre A, Dewelle J, EI Yazidi M, Bruyneel F, et al., 2005. Identification of a novel cardenolide (2"-oxovoruscharin) from Calotropis procera and the hemisynthesis of novel derivatives displaying potent in vitro antitumor activities and high in vivo tolerance: structure-activity relationship analyses. Journal of Medicinal Chemistry, 48(3): 849-856.

WHO, 2011. Global status report on noncommunicable diseases 2010.

Yan C, Xin-Ming Q, Li-Kun G, Lin-Lin L, Fang-Ping C, Ying X, et al., 2006. Tetrandrine-induced apoptosis in rat primary hepatocytes is initiated from mitochondria: caspases and endonuclease G (Endo G) pathway. Toxicology, 218(1): 1-12.

Zeng H, Dvorak HF, Mukhopadhyay D, 2001. Vascular permeability factor (VPF)/vascular endothelial growth factor (VEGF) peceptor-1 downmodulates VPF/VEGF receptor-2-mediated endothelial cell proliferation, but not migration, through phosphatidylinositol 3-kinase-dependent pathways. The Journal of Biological Chemistry, 276(29): 26969-26979.

Mary-Ann A Mbong (1,2), Gabin KB Azantsa (5), Cornelia Braicu (2), Neagoe Ioana (3), Irimie Alexandru (4), Laure J Ngondi (1) *, Julius E Oben (1)

(1) Department of Biochemistry, Faculty of Science, University of Yaounde, Cameroon.

(2) Department of Functional Genomics and Experimental Pathology, The Oncology Institute, Prof. Dr. Ion Chiricuta , Cluj-Napoca, Romania.

(3) Department of Immunology, Iuliu Hatieganu University of Medicine and Pharmacy, Cluj-Napoca, Romania.

(4) Department of Surgery, Ion Chiricuta Cancer Institute, Cluj-Napoca, Romania.

(5) Department of Biochemistry and Molecular Biology, Faculty of Science, University of Buea, Cameroon.

* Correspondence: ngondijudithl@hotmail.com

Accepted: 1st Apr 2013, Published: 15th Apr 2013
Table 1: [IC.sub.50] after treating cells with C.
verticillata and S. scabrum. [IC.sub.50] of hydroethanolic
extracts of C. verticillata and S. scabrum after 24 and
48 h treatment of A2780 ovarian cancer cells. The lowest
[IC.sub.50] was obtained with cells treated for 48 h with
S. scabrum extracts (11.30 [micro]g/ml) followed by 24 h
treatment with the same extract (15.00 [micro]g/ml) then
48 h treatment with C. verticillata (15.30 [micro]g/ml)
and then 24 h treatment of C. verticillata  (19.83 [micro]g/ml).
S. scabrum was found to inhibit the proliferation of
A2780 cells more than C. verticillata.

Hydroethanolic        [IC.sub.50] ([micro]g/ml)
extract
                   24 h treatment   48 h treatment

C. verticillata        19.83            15.30
S. scabrum             15.00            11.30

Table 2: Gene modulation after treatment with different doses
of C. verticillata and S. scabrum. Cells were treated for 24 h
with hydroethanolic extracts of C. verticillata and S. scabrum
using two doses (10-50 [micro]g/ml) for each extract. The extract
of C. verticillata led to the downregulation of all genes (BCL-2,
p53, PDGF, ICAM-1, ERCC1, TNF[alpha], and VEGF) for both doses
except for 10 [micro]g/ml dose that led to the upregulation of
TNF[alpha]. S. scabrum led to the upregulation of BCL-2 and p53
genes for both doses while the other genes (PDGF, ICAM-1, ERCC1,
TNF[alpha], VEGF) were downregulated.

Genes                   Hydroethanolic extract
                         of C. verticillata

                50 [micro]g/ml        10 [micro]g/ml

BCL-2         0.83 [+ or -] 0.385   0.75 [+ or -] 0.43
p53           0.53 [+ or -] 0.195   0.95 [+ or -] 0.84
PDGF          0.32 [+ or -] 0.247   0.53 [+ or -] 0.37
ICAM-1        0.34 [+ or -] 0.193   0.62 [+ or -] 0.44
ERCC1         0.20 [+ or -] 0.09    0.77 [+ or -] 0.82
TNF[alpha]    0.26 [+ or -] 0.117   1.84 [+ or -] 0.59
VEGF          0.17 [+ or -] 0.122   0.33 [+ or -] 0.26

Genes                   Hydroethanolic extract
                            of S. scabrum

                50 [micro]g/ml        10 [micro]g/ml

BCL-2         2.63 [+ or -] 0.17    1.67 [+ or -] 0.35
p53           1.01 [+ or -] 0.33    1.28 [+ or -] 0.34
PDGF          0.28 [+ or -] 0.11    0.25 [+ or -] 0.07
ICAM-1        0.69 [+ or -] 1.21    0.73 [+ or -] 0.60
ERCC1         0.61 [+ or -] 0.32    0.70 [+ or -] 0.19
TNF[alpha]    0.60 [+ or -] 0.84    0.51 [+ or -] 0.37
VEGF          0.34 [+ or -] 0.32    0.54 [+ or -] 0.36
COPYRIGHT 2013 HATASO Enterprises, LLC
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Mbong, Mary-Ann A.; Azantsa, Gabin K.B.; Braicu, Cornelia; Ioana, Neagoe; Alexandru, Irimie; Ngondi,
Publication:Biology and Medicine
Article Type:Report
Geographic Code:6CAME
Date:Jan 1, 2013
Words:6557
Previous Article:The effect of ethanolic extract of Moringa oleifera on alcohol-induced testicular histopathologies in pre-pubertal albino Wistar rats.
Next Article:Reproductive impact of aqueous leaf extract of Mangifera indica (Mango) on some reproductive functions in female Sprague-Dawley rats.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters