Printer Friendly

Antibiotic resistance patterns and frequency of metallo-beta-lactamases in Klebsiella pneumoniae in Hamadan, Iran.

Introduction

Klebsiella pneumoniae is a Gram-negative bacterium, which is known as normal constituent of the human gastrointestinal tract. K. pneumoniae is currently emerging as a significant nosocomial pathogen. (1) Carbapenem drugs such as meropenem, imipenem and ertapenem are used for treatment of infections due to drug-resistant K. pneumoniae. (2)

Resistance to carbapenem is predominantly associated with the production of carbapenemase enzymes. Based on the antibiotic hydrolytic mechanism at the active site, carbapenemase enzymes were divided into class A and class B. (3) The class A enzymes contain a serine in the active site and their functions are inhibited by beta-lactamase inhibitors, such as clavulanic acid, tazobactam, and sulbactam. The class B metallo-beta-lactamases (MBL), such as [bla.sub.IMP] and blaVIM are another class of carbapenemases. (4) These are zinc-dependent beta-lactam-hydrolyzing enzymes with board spectrum activity, which hydrolyze carbapenems and other beta-lactam antibiotics, except for aztreonam. (5) The MBLs are not inhibited by beta-lactamase inhibitors but their functions are blocked by zinc chelating agents (EDTA). In most cases, the coding genes for MBLs are located in integrons and placed on chromosomes and/or plasmids. (5) In the first reports, [bla.sub.IMP] and [bla.sub.VIM] were detected in Japan and Italy, respectively. (6) Predominantly, MBLs have been described in non-fermenting Gram-negative bacteria. But now the MBLs have been reported from several Gram-negative bacteria including K. pneumoniae. Specifically, carbapenem-resistant K. pneumoniae is currently known as a major concern in recent years. (7)

In this report, we describe the antibiotic resistance profiles and prevalence of MBL genes including [bla.sub.VIM-1], [bla.sub.VIM-2], and blaIMP-1 in K. pneumoniae isolates recovered from inpatients from Hamadan province, west of Iran.

Methods

Collection of specimens

From November 2015 to February 2016, one hundred K. pneumoniae isolates were collected from different infection specimens of inpatients and outpatients, which were referred to three teaching and treatment university hospitals in Hamadan, Iran. Only one isolate per patient was included in the sample. Isolated strains were identified by routine conventional tests including indole, methyl red, Voges-Proskauer, lactose fermentation, etc. (8) and confirmed by API 20E strips (bioMerieux, Marcy l'etoile, France). Also, isolated strains were confirmed as K. pneumoniae by PCR. For this purpose, PCR primers (ureD) were used for specific identification of K. pneumoniae (Table 1).

Antimicrobial susceptibility testing

Antibiotic susceptibilities for clinical isolates were defined by both disk diffusion and E-test methods. The antibiotic susceptibility profiles of K. pneumoniae according to CLSI were assessed for gentamicin (10 [micro]g), aztreonam (30 [micro]g), cefepime (30 [micro]g), cefotaxime (30 [micro]g), cefixime (10 [micro]g), ceftazidime (30 [micro]g), ceftizoxime (30 [micro]g), ciprofloxacin (5 [micro]g), ceftriaxone (30 [micro]g), imipenem (10 [micro]g), and meropenem (30 [micro]g) (Mast, London, UK), determined by the disk diffusion method. (13) MDR isolates were described as resistant to 3 or more antibiotics.

Also, the minimum inhibitory concentration (MIC) value of imipenem for clinical isolates of K. pneumoniae was evaluated by using the Etest method. According to CLSI, 0.5 McFarland of bacterial inoculum was prepared and cultured on Mueller-Hinton agar (Himedia, Delhi, India) plates, and then disks or strips were placed on the medium. Subsequently, the plates were incubated for 16-18 h at 35[degrees]C. (13)

Detection of MBL production

Phenotypic MBL production was assessed by both double disk synergy (DDS) test and E-test (AB Biodisk, Solna, Sweden). (14) For this purpose in the DDS test, the inhibition zone of imipenem and imipenem-EDTA containing disks was measured. According to the manufacturer's protocol, the inhibition zone diameter for imipenem and imipenem combined with EDTA was 13 mm and 14.5 mm, respectively. After overnight incubation, the presence of an enlarged inhibition zone was interpreted as being DDS test positive and any synergistic inhibition zone was interpreted to be positive by the MBL screening test. (14)

MBL E-test strips (AB Biodisk) using imipenem and imipenem-EDTA were used according to the manufacturer's instructions. The E-test MBL strips consisted of a wide range of imipenem MICs (4-128 [micro]g/mL) overlaid with a constant concentration of EDTA.

Detection of [bla.sub.VIM-1], [bla.sub.VIM-2], [bla.sub.IMP-1]

The [bla.sub.VIM-1], [bla.sub.VIM-2], and [bla.sub.IMP-1] genes detection was carried out by PCR with specific primers (Yekta Tajhiz Azma, Iran) for all 100 isolates. DNA was extracted using the boiling method. Briefly, a cell pellet was homogenized in 500 [micro]L of TE (10 mM Tris, 1 mM EDTA, pH 8.0) and the mixture was boiled for 10 min. Finally, the mixture was centrifuged at 13000 rpm for 2 min (Vision, Daejeon, South-Korea). The supernatant was used as DNA template for PCR amplification.

The primers used in this study are listed in Table 1. The PCR was performed according to a previous study. (15) The PCR products were observed on 2% agarose gel under constant voltage at 85V. In PCR amplification, Pseudomonas aeruginosa ATCC 27853 was used as negative control.

Statistical analysis

Data were entered into a database using SPSS 23 (IBM Corp., Armonk, NY, USA). Differences between proportions were analyzed using the Chi-square test; p<0.05 was considered significant.

Results

Bacterial collection

During the study period, one hundred K. pneumoniae strains were isolated. Bacterial strains were isolated from different clinical specimens including blood culture (32), urine (18), stool (13), sputum (13), wound swabs (12), diabetic foot pus (5), skin and soft tissue abscesses (4), and tracheal aspirate (3) (Table 2).

Sex, age and ward distribution

Of 100 patients infected by K. pneumoniae, 64 patients were women and 36 were men. The mean age of patients was 44.24 years (SD=18 years; range: 1 to 78 years). In this study, K. pneumoniae strains were recovered from the following wards: intensive care unit (ICU, 19), outpatient care (OPD, 4), coronary care unit (CCU, 10), pediatric (7), internal medicine (10), urology (4), cardiology unit (5), dialysis (17), burn unit (6), and infectious diseases (18) (Table 3).

Antibiotic susceptibility testing

The antimicrobial resistance of K. pneumoniae isolates was determined in all 100 isolates and the results of susceptibility testing by disk diffusion method are presented in Table 2. Of 100 isolates, 95 and 88 isolates were susceptible to meropenem and imipenem, respectively. The highest resistance rate was found to cefixime (48%), followed by ceftriaxone (47%). Also, in this study 43 K. pneumoniae isolates were MDR. A higher frequency of MDR isolates was observed in strains recovered from the ICU (89.5%) and followed by burn (66.7%) and infectious diseases (55.6%) wards. Antimicrobial resistance patterns of the all K. pneumoniae strains are shown in Tables 2 and 3.

The MICs of all isolates were investigated for imipenem by using E-test and its results were interpreted according to CLSI breakpoints. (13) The MIC interpretive criteria for both imipenem and meropenem were <4 [micro]g/mL. In accordance to disk diffusion, MIC results showed that twelve isolates were resistant to imipenem (4-128 [micro]g/mL). Also, antimicrobial susceptibility testing demonstrated that five isolates were resistant to meropenem (4-64 [micro]g/mL).

In the current study, MBL-producing strains were detected using the double-disk synergy (DDS) test. (15) The DDS test showed that of twelve K. pneumoniae isolates resistant to imipenem, five (41.7%) strains were MBLs positive. The MBL-positive strains were isolated from blood (ICU, n=3), tracheal (ICU, n=1) and wound infections (infectious diseases ward, n=1).

Detection of [bla.sub.VIM-1], [bla.sub.VIM-2], [bla.sub.IMP-1]

PCR was performed for all 100 K. pneumoniae isolates to detect the [bla.sub.VIM-1], [bla.sub.VIM-2] and [bla.sub.IPM-1] genes. The [bla.sub.VIM-1] gene was detected in 5 isolates, but the genes [bla.sub.VIM-2] and blaIPM-1 were not found in K. pneumoniae isolates recovered in this study.

Discussion

K. pneumoniae is an opportunistic pathogen, which causes different infections such as bacteremia, gastrointestinal and urinary tract infections. Rapid spread of K. pneumoniae in the hospital described this bacterium as the main cause of nosocomial infection. (10,16) Primarily, K. pneumoniae was susceptible to most [beta]-lactams except for penicillin agents, but now resistance to the [beta]-lactam category, especially carbapenems, has developed. The most important resistance mechanism to the carbapenem category is MBL enzymes production (Ambler class B enzymes). The MBL enzymes are able to destroy [beta]-lactams and are associated with emerging resistance to all [beta]-lactams including penicillins, carbapenems, extended-spectrum cephalosporins, but not aztreonam. (6) Also, VIM and IPM are the most important MBL variants.

In our study, in accordance to other studies performed in Iran, the highest resistance in K. pneumoniae was observed towards third generation cephalosporins including cefixime, ceftriaxone, cefotaxime, and ceftazidime. (17-19) The main reasons for the high resistance of K. pneumoniae to this category are associated with overuse and empiric therapy in our hospitals. (18) In a previous study, Cornaglia et al. showed that administration of [beta]-lactams is a main risk factor for the emergence of MBL isolates in their community. (20) On the other hand, K. pneumoniae has the ability of rapid distribution of resistance genes among species. (17)

In older studies, the inhibitory activity of aztreonam in combination with other drugs (meropenem and colistin) against K. pneumoniae was observed. (21) In current study, in concordance to another study reported from Iran, resistance rate to aztreonam was observed in approximately half of the isolates (45% vs 59%). (22) In contrast, in previous studies, an aztreonam resistance rate in K. pneumoniae was 71% and 95%. (17,19) Resistance rates of K. pneumoniae to ciprofloxacin in various studies were different and ranged from 2 to 68%. (1,22) These various resistance rates among studies are related to several risk factors. For example, the previous study demonstrated that rates of extended spectrum beta-lactamase (ESBL) isolates are higher in patients with lower ages. (22)

The earlier studies illustrated that carbapenems including imipenem and meropenem have the highest activity against K. pneumoniae and susceptibility rates were 100%. (23,24) But in further studies, in accordance with our results, resistance to imipenem and meropenem was observed. (19,22,25) Our result showed that resistance to imipenem was 12%, which is in accordance with the previous studies that demonstrated resistance rates that ranged from 2 to 24%. (19,22,25) Also, resistance to meropenem was to 28% in Iran. (19)

Numerous reasons are associated with carbapenem resistance. One of the most important mechanisms is MBL production. Using the DDS test, 5 of 12 imipenem-resistant isolates were MBL positive. Probably, the resistance in imipenem-resistant strains which are MBL negative is associated with other mechanisms such as activation of efflux pumps, decreasing outer membrane permeability (porin) and high-level AmpC cephalosporinase production. (22) In a previous study performed in Iran, Hashemi et al. demonstrated that 3.5% of isolates were MBL positive. (22) In some studies, the isolation rates of VIM-1-producing K. pneumoniae higher than in the current study. For example, in a study performed by Daikos et al., 26.7% of K. pneumoniae isolates from blood were VIM-1 positive. (26) The diversity of carbapenem resistance rate and prevalence of beta-lactamase genes in different studies may be related to geographical areas and predominant endemic bacteria, which exist in the region. (19) Direct and indirect contact was defined as a main way of transmission of MBL-producing K. pneumoniae from patients to healthy persons, (27) thus contact precautions are useful to reduce the risk of transfer.

Conclusion

In summary, our result showed that the most effective antibiotic agents for the treatment of infection caused by K. pneumoniae in this region are meropenem and imipenem. The carbapenem category is the most important choice in emergency conditions. Thus, suitable prescription by doctors and lack of arbitrary and excessive use of these antibiotics by the community are critical factors to control and prevent the emergence of carbapenem resistance.

Authors' contributions statement: MYA and RYM designed the experiments as primary investigators; KA, MAN and PG performed the clinical experiments and analyzed the data. All authors read and approved the final version of the manuscript.

Conflicts of interest: All authors--none to declare.

Funding: none to declare.

Acknowledgement: The authors gratefully acknowledge staff of the Department of Bacteriology and Virology, Hamadan University of Medical Sciences, Hamadan, Iran.

References

(1.) Ghotaslou R, Ghorashi Z, Nahaei MR. Klebsiella pneumoniae in neonatal sepsis: a 3-year-study in the pediatric hospital of Tabriz, Iran. Jpn J Infect Dis 2007;60:126-8.

(2.) Kim SY, Hong SG, Moland ES, Thomson KS. Convenient test using a combination of chelating agents for detection of metallo-[beta]-lactamases in the clinical laboratory. J Clin Microbiol 2007;45:2798-801. [Crossref]

(3.) Maltezou HC, Giakkoupi P, Maragos A, et al. Outbreak of infections due to KPC-2-producing Klebsiella pneumoniae in a hospital in Crete (Greece). J Infect 2009;58:213-9. [Crossref]

(4.) Cagnacci S, Gualco L, Roveta S, et al. Bloodstream infections caused by multidrug-resistant Klebsiella pneumoniae producing the carbapenem-hydrolysing VIM-1 metallo-[beta]-lactamase: first Italian outbreak. J Antimicrob Chemother 2008;61:296-300. [Crossref]

(5.) Cendejas E, Gomez-Gil R, Gomez-Sanchez P, Mingorance J. Detection and characterization of Enterobacteriaceae producing metallo-[beta]-lactamases in a tertiary-care hospital in Spain. Clin Microbiol Infect 2010;16:181-3. [Crossref]

(6.) Queenan AM, Bush K. Carbapenemases: the versatile [beta]-lactamases. Clin Microbiol Rev 2007;20:440-58. [Crossref]

(7.) Nordmann P, Naas T, Poirel L. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis 2011;17:1791-8. [Crossref]

(8.) Hansen DS, Aucken HM, Abiola T, Podschun R. Recommended test panel for differentiation of Klebsiella species on the basis of a trilateral interlaboratory evaluation of 18 biochemical tests. J Clin Microbiol 2004;42:3665-9. [Crossref]

(9.) Arakawa Y, Shibata N, Shibayama K, et al. Convenient test for screening metallo-[beta]-lactamase-producing gram-negative bacteria by using thiol compounds. J Clin Microbiol 2000;38:40-3.

(10.) Giakkoupi P, Xanthaki A, Kanelopoulou M, et al. VIM-1 metallo-[beta]-lactamase-producing Klebsiella pneumoniae strains in Greek hospitals. J Clin Microbiol 2003;41:3893-6. [Crossref]

(11.) Yakupogullari Y, Poirel L, Bernabeu S, Kizirgil A, Nordmann P. Multidrug-resistant Pseudomonas aeruginosa isolate co-expressing extended-spectrum [beta]-lactamase PER-1 and metallo-[beta]-lactamase VIM-2 from Turkey. J Antimicrob Chemother 2008;61:221-2. [Crossref]

(12.) Zamani A, Mashouf RY, Namvar AME, Alikhani MY. Detection of magA gene in Klebsiella spp. isolated from clinical samples. Iran J Basic Med Sci. 2013;16:173-6.

(13.) Hsueh PR, Ko WC, Wu JJ, et al. Consensus statement on the adherence to Clinical and Laboratory Standards Institute (CLSI) Antimicrobial Susceptibility Testing Guidelines (CLSI-2010 and CLSI-2010-update) for Enterobacteriaceae in clinical microbiology laboratories in Taiwan. J Microbiol Immunol Infect. 2010;43:452-5. [Crossref]

(14.) Franco MR, Caiaffa-Filho HH, Burattini MN, Rossi F. Metallo-beta-lactamases among imipenem-resistant Pseudomonas aeruginosa in a Brazilian university hospital. Clinics (Sao Paulo) 2010;65:825-9. [Crossref]

(15.) Luzzaro F, Endimiani A, Docquier JD, et al. Prevalence and characterization of metallo-beta-lactamases in clinical isolates of Pseudomonas aeruginosa. Diagn Microbiol Infect Dis 2004;48:131-5. [Crossref]

(16.) Fukigai S, Alba J, Kimura S, et al. Nosocomial outbreak of genetically related IMP-1 [beta]-lactamase-producing Klebsiella pneumoniae in a general hospital in Japan. Int J Antimicrob Agents 2007;29:306-10. [Crossref]

(17.) Feizabadi MM, Delfani S, Raji N, et al. Distribution of blaTEM, blaSHV, blaCTX-M genes among clinical isolates of Klebsiella pneumoniae at Labbafinejad Hospital, Tehran, Iran. Microb Drug Resist 2010;16:49-53. [Crossref]

(18.) Mehrgan H, Rahbar M, Arab-Halvaii Z. High prevalence of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae in a tertiary care hospital in Tehran, Iran. J Infect Dev Ctries 2010;4:132-8. [Crossref]

(19.) Shahcheraghi F, Nobari S, Rahmati Ghezelgeh F, et al. First report of New Delhi metallo-beta-lactamase-1-producing Klebsiella pneumoniae in Iran. Microb Drug Resist 2013;19:30-6. [Crossref]

(20.) Cornaglia G, Giamarellou H, Rossolini GM. Metallo-[beta]-lactamases: a last frontier for [beta]-lactams? Lancet Infect Dis 2011;11:381-93. [Crossref]

(21.) Tangden T, Hickman RA, Forsberg P, Lagerback P, Giske CG, Cars O. Evaluation of double and triple antibiotic combinations for VIM-and NDM-producing Klebsiella pneumoniae by in vitro time-kill experiments. Antimicrob Agents Chemother 2014;58:1757-62. [Crossref]

(22.) Hashemi A, Fallah F, Erfanimanesh S, Hamedani P, Alimehr S, Goudarzi H. Detection of [beta]-lactamases and outer membrane porins among Klebsiella pneumoniae strains isolated in Iran. Scientifica (Cairo) 2014;2014:726179. [Crossref]

(23.) Feizabadi MM, Etemadi G, Yadegarinia D, Rahmati M, Shabanpoor S, Bokaei S. Antibiotic-resistance patterns and frequency of extended-spectrum beta-lactamaseproducing isolates of Klebsiella pneumoniae in Tehran. Med Sci Monit 2006;12:BR362-5.

(24.) Bazzaz BS, Naderinasab M, Mohamadpoor AH, Farshadzadeh Z, Ahmadi S, Yousefi F. The prevalence of extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae among clinical isolates from a general hospital in Iran. Acta Microbiol Immunol Hung 2009;56:89-99. [Crossref]

(25.) Yong D, Choi YS, Roh KH, et al. Increasing prevalence and diversity of metallo-[beta]-lactamases in Pseudomonas spp., Acinetobacter spp., and Enterobacteriaceae from Korea. Antimicrob Agents Chemother 2006;50:1884-6. [Crossref]

(26.) Daikos GL, Karabinis A, Paramythiotou E, et al. VIM-1-producing Klebsiella pneumoniae bloodstream infections: analysis of 28 cases. Int J Antimicrob Agents 2007;29:471-3. [Crossref]

(27.) Akhi MT, Bialvaei A, Ghotaslou R, et al. Faecal carriage of ESBL and plasmid-mediated AmpC [beta]-lactamase genes in Klebsiella spp. and Shigella spp. isolated from inpatient and outpatient carriers in Tabriz, Iran. J Fundam Appl Sci 2016;8:16-29. [Crossref]

Khalil Azizian (1), Mohammad Yousef Alikhani (2), Rasoul Yousefi Mashouf (3), Pourya Gholizadeh (4), Mohammad Ali Noshak (4,*)

Received: 14 November 2018; revised: 28 January 2019; accepted: 02 February 2019

(1) PhD Medical Microbiology, Liver and Gastrointestinal Diseases Research Center, Tabriz University of Medical Science, Tabriz, 51666-14766, Iran; (2) PhD Medical Microbiology, Department of Microbiology, Faculty of Medicine, Hamadan University of Medical Sciences, Hamadan, 65178, Iran; (3) PhD Medical Microbiology, Department of Microbiology, Faculty of Medicine, Hamadan University of Medical Sciences, Hamadan, 65178, Iran; (4) PhD candidate Medical Microbiology, Department of Microbiology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, 51666-14766, Iran.

(*) Corresponding author: Mohammad Ali Noshak, noshak_ma@yahoo.com
Table 1. The primers used in this study

Primers  Target gene      Sequences                 Annealing
                                                    temperature

IMP-1    [bla.sub.IMP-1]  F: ACCGCAGCAGAGTCTTTGCC   59 [degrees]C
                          R: ACAACCAGTTTTGCCTTACC
VIM-1    [bla.sub.VIM-1]  F: AGTGGTGAGTATCCGACAG    55.1 [degrees]C
                          R: ATGAAAGTGCGTGGAGAC
VIM-2    [bla.sub.VIM-2]  F: ATGTTCAAACTTTTGAGTAAG  55 [degrees]C
                          R: CTACTCAACGACTGAGCG
URE-D    ureD             F: CCCGTTTTACCCGGAAGAAG   60 [degrees]C
                          R: GGAAAGAAGATGGCATCCTGC

Primers  Amplified  Ref.
         size (bp)

IMP-1    587         9
VIM-1    261        10
VIM-2    780        11
URE-D    243        12

Table 2. Antibiotic resistance rate (%) of K. pneumoniae isolates from
different specimens

Antibiotics  Blood   Urine   Sputum  Trachea  Diabetic  Stool   Abscess
             (n=32)  (n=18)  (n=13)  (n=3)    foot pus  (n=13)  (n=4)
                                              (n=5)

CFM          75      27.7    38.4    66.6      40       23      25
CRO          62.5    38.8    46.2    33.3      60       30.7    25
AZT          53.1    38.9    46.2    66.6       0       46.2    25
CTX          50      50      38.5     0       100       30.2     0
CAZ          31.2    61.1    46.2    33.3      40       61.5     0
CZX          43.7    44.4    31.5     0        60       23.1     0
GEN          28.1    38.9    46.2     0        20       23.1     0
FEP          28.1    55.6    38.5    33.3      20       23.1     0
CIP          15.6    27.8    61.5    33.3      20        7.7     0
IMP          15.6    16.7    15.4     0         0        7.7    25
MER           3.1     5.6     0       0        20        0      25

Antibiotics  Wound   Total non-susceptible  P          df
             swab    (n=100)                value
             (n=12)

CFM          50      48                     0.023 (*)  8
CRO          41.7    47                     0.563      8
AZT          50      45                     0.547      8
CTX          58.3    46                     0.072      8
CAZ          58.3    45                     0.256      8
CZX          41.7    41                     0.280      8
GEN          16.7    28                     0.538      8
FEP          50      35                     0.366      8
CIP          33.3    25                     0.062      8
IMP           0      12                     0.170      8
MER           8.3     5                     0.298      8

CFM--cefixime; CRO--ceftriaxone; AZT--aztreonam; CTX--cefotaxime;
CAZ--ceftazidime; CZX--ceftizoxime; GEN--gentamicin; FEP--cefepime;
CIP--ciprofloxacin; IMP--imipenem; MER--meropenem.

Table 3. Antibiotic resistance rate (%) of K. pneumoniae isolates in
different wards

Antibiotics  ICU     OPD    CCU     Pediatric  Internal  Urology
             (n=19)  (n=4)  (n=10)  (n=7)      (n=10)    (n=4)

CFM          73.6    25     70      42.8       30        75
CRO          68.4    50     60      42.8       20        75
AZT          78.9    50     20      57.1       30        75
CTX          68.4     0     40      28.5        0        75
CAZ          89.4     0     20      14.2       30        25
CZX          68.4    25     50       0          0        75
GEN          63.1     0     20      28.5       10        25
FEP          68.4     0     40      28         10        25
CIP          31.5     0     30       0         10         0
IMP          21       0      0       0         10        25
MER           5.3     0      0       0         10         0

Antibiotics  Cardiology  Dialysis  Burn   Infectious  P value     df
             (n=5)       (n=17)    (n=6)  diseases
                                          (n=18)

CFM          80          29.4       50    27.8         0.054      10
CRO          60          23.5       50    44.4         0.228      10
AZT          40          41.2       50    22.2         0.047 (*)  10
CTX           0          29.4       83.3  77.7        <0.001 (*)  10
CAZ          40          64.7        0    44.4        <0.001 (*)  10
CZX           0           5.9      100    66.6        <0.001 (*)  10
GEN          20           5.9        0    44.4         0.006 (*)  10
FEP          20          17.6       66.7  33.3         0.026 (*)  10
CIP          20          11.8       50    50           0.088      10
IMP          20           0         33.3  16.7         0.328      10
MER           0           0         16.7  11.1         0.804      10

CFM--cefixime; CRO--ceftriaxone; AZT--aztreonam; CTX--cefotaxime;
CAZ--ceftazidime; CZX--ceftizoxime; GEN--gentamicin; FEP--cefepime;
CIP--ciprofloxacin; IMP--imipenem; MER--meropenem; ICU--intensive care
unit; OPD--outpatient department; CCU--coronary care unit.
COPYRIGHT 2019 Asociatia pentru Cresterea Vizibilitatii Cercetarii Stiintifice (ACVCS)
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2019 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original article
Author:Azizian, Khalil; Alikhani, Mohammad Yousef; Mashouf, Rasoul Yousefi; Gholizadeh, Pourya; Noshak, Moh
Publication:Journal of Contemporary Clinical Practice
Geographic Code:7IRAN
Date:May 1, 2019
Words:3584
Previous Article:A project to implement active learning in medical schools: time for result analysis.
Next Article:The importance of relationship marketing in healthcare: differences and similarities in the physician-patient relationship in the Romanian private...
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |