Printer Friendly

Antibiotic resistance of Escherichia Coli isolates from environmental and waste water samples in Mauritius.

Introduction

Antimicrobial agents are important in the treatment of bacterial infections. The global increase in antibiotic-resistant bacteria is of major concern and thus, antibiotic use for medical and agricultural applications is a major risk factor for the increased occurence of resistant organsisms. [1,12,25]. Besides medical use in humans, there is the troubling issue of their use in agriculture, specifically in livestock production where antibiotics have long been regularly used not only for the treatment of infections, but also as a means of getting animals to market faster through growth promotion by adding feed-based antibiotics constantly.

Antibiotic resistance in pathogenic bacteria has been an increasing medical problem for decades [9,10]. Microbes may develop resistance to antibiotics under selective pressure, or they may acquire antibiotic resistance determinants without direct exposure to an antibiotic. Furthermore, acquired resistance determinants are spread among different species and even genera which include potential and obligate pathogens. [7,9,20]. This is especially favoured in settings that allow the close association of densely packed microorganisms such as the intestine of humans and animals [9,16]. Consequently, antimicrobial-resistant bacteria are selected for; thereby posing a serious public health threat in that antimicrobial treatment effectiveness may be reduced. [17].

Resistant bacteria are also shed in faeces, where they can share extrachromosomal antibiotic resistance plasmids (R-plasmids) with native bacteria and may also be disseminated to other animals. Antibiotics accumulate in the tissues of animals and hence, can be ingested by consumers whose own resident microflora may become resistant [11,19,22]. Hence, this is an important means of dissemination of resistance in humans through the food chain [1,3,25].

Beta-lactamases target the peptidases of bacterial cell-wall biosynthetic process. Extended-spectrum beta-lactamases (ESBLs) have evolved through a series of substitutions of amino acids and provide resistance to third generation cephalosporins. ESBLs are produced by Gram-negative bacteria and have been reported from many species.

Escherichia coli (E. coli) is a Gram-negative bacterium and the main aerobic commensal bacterial species. [1,24]. The native habitat of E. coli is the enteric tract of humans and other warm-blooded animals. Therefore, E. coli is widely disseminated in the environment through the faeces of humans and other animals and its presence in water is generally considered to indicate faecal contamination and the possible presence of enteric pathogens. Unlike other microorganism, E. coli is able to acquire resistance easily, consequently being a good bioindicator model for surveillance studies of antimicrobial resistance [1,24]. Pathogenic strains of these bacteria are also an important cause of bacterial infections.

The main objective of the present study was to isolate E. coli from effluent water of different sources, from litter, faeces of different animals and infections in animals and to test their ability to grow in the presence of several antibiotics. The antimicrobial drugs resistance was investigated using different antibiotics namely amoxicillin/clavulanic acid, erythromycin, enrofloxacin Baytril, fosfomycin, neomycin, Penicillin G, streptomycin, sulphamethoxazole/ trimethoprim, and tetracycline. Extended-spectrumbeta-lactamase mediated resistance was assessed by disc diffusion method of four antibiotics ceftazidime, cefpirome, cefpodoxime and cefotaxime and corresponding disc containing ceftazidime/clavulanic acid, cefpirome/clavulanic acid, cefpodoxime/clavulanic acid and cefotaxime/clavulanic acid. This relies on the fact that clavulanic acid inhibits beta-lactamases. Polymerase chain reaction assay was also used to amplify the genes coding for the beta-lactamases. On the whole, this study sheds light on the current resistance situation of E. coli in Mauritius.

Materials and methods

Sources and Reference of Bacterial Isolates:

Isolation of E. coli:

Fresh samples were collected. The samples were processed within 24 hours and were kept at 4[degrees]C until processed.

From Effluent Samples:

A bacteriological loop was dipped in vial containing the mother sample and a loop full was streaked on MacConkey agar (Oxoid) and is incubated at 37[degrees]C for 18-24 hours.

Fecal or Solid Samples:

The sample was diluted with peptone water which was enrichment medium. It was kept at 37[degrees]C for 18 hours. Then, using a bacteriological loop, a drop of the diluted sample was streaked on MacConkey agar and was incubated at 37[degrees]C for 18-24 hours.

Suspected Escherichia coli infection:

Direct streaking was done, that is, when post mortem was carried out, a bacteriological loop was passed on the heart of the birds and was streaked onto the MacConkey agar which was incubated at 37[degrees]C for 18-24 hours.

After 18-24 hours any bacterial growth was observed.

Primary tests were carried out on the isolated colonies of Escherichia coli, that is, morphology of Escherichia coli on MacConkey agar and Gram staining.

Identification of E. coli from various sources:

After confirmation of the presence of a Gramnegative Enterobacteriaceae, the colony was subcultured on Eosin Methylene Blue agar (EMB) which is a differential and selective medium to differentiate between different Enterobacteriaceae in terms of the morphological characteristics and colour on the agar.

According to the colour of E. coli on EMB, a colony was streaked on EMB to obtain pure cultures of E. coli colonies. From the pure culture, a distinct E. coli colony was touched with a bacteriological loop and was transferred in a vial containing sterile distilled water. It was thoroughly mixed.

Analytical Profile Index (API) was then carried out (with the mixture of E. coli and sterile distilled water) for the identification and differentiation of members of the family Enterobacteriaceae and confirmation of whether the isolated colony was E. coli.

Antibiotic Susceptibility by Disc Diffusion Technique:

The disc diffusion method was used to determine the antimicrobial agent sensitivity profiles of the E. coli isolates for 13 antibiotic discs, amoxicillin/clavulanic acid (AMC) 30 ng, erythromycin (E) 5 ng, enrofloxacin Baytril (ENR) 5 ng, fosfomycin (FOS) 50 [micro]g, neomycin (N) 10 Hg, penicillin G (P) 10units, streptomycin (S) 10 ng, sulphamethoxazole/ trimethoprim (SXT) 25 [micro]g, tetracycline (T)10 [micro]g, cefpodoxime (CPD) 10[micro]g, ceftazidime (Ca) 30mcg, cefotaxime (CXT), and cefpirome (Cfp) 30mcg. Two drops of each diluted colony were taken, and was put on different MacConkey Agar plate. The solution was spread onto the entire plate. These discs were chosen based on the importance of the antibiotic in treating mainly animal and human infections. The discs were placed individually with a sterile forcep and then it was gently pressed down onto the agar. Not more than 4 discs were placed on a 100 mm plate (each disc was 5 mm in diameter). This prevents overlapping of the zones of inhibition and possible error in measurement. Diffusion of the drugs in the disc begins immediately; therefore, once a disc contacts the agar surface, the disc should not be moved.

The plate was then inverted and incubated at 37[degrees]C for 16 to 18 hours. The diameter of the zones of complete inhibition of microbial growth was measured (including the diameter of the disc) and it was recorded in millimeters. Slight growth within the inhibition zone, of 80% inhibition, was ignored and the zone diameter was measured to margin of heavy growth.

Extended-spectrum beta-lactamases (ESBLs):

The test was performed using disc diffusion discs that contain ceftazidime, cefpodoxime, cefotaxime and cefpirome and corresponding discs containing ceftazidime/clavulanic acid, cefpodoxime/clavulanic acid, cefotaxime/clavulanic acid and cefpirome/clavulanic acid.

A difference of [greater than or equal to] 5 mm between the zone diameters of either of the cephalosporin discs and their respective cephalosporin/clavulanate disc was taken to be the phenotypic confirmation of ESBL production.

Data Analysis:

To analyse the data, it was reported in the form of diameter of inhibition zone during susceptibility testing of all bacterial isolates by disc diffusion test against the different antibiotics used and their percentage resistance was carried out.

The percentages of each antibiotic in terms of resistance, intermediate resistance and susceptibility of all isolates together were calculated.

The sensitivity of ceftazidime, cefpodoxime, cefotaxime and cefpirome was determined using phenotypic test.

Extraction of bacterial DNA:

[E.sub.W2] [F.sub.GF1], [H.sub.WO], [I.sub.C] and [F.sub.C] isolates were grown overnight in Luria Bertani (LB) in a large conical flask for ample aeration with shaking at 37[degrees]C. DNA was then extracted from the five isolates by the phenol/chloroform extraction.

Polymerase Chain Reaction (PCR):

A reaction mix was prepared which contain 3x [micro]l PCR buffer, 2.4[chi] [micro]l dNTPs, 1[chi] [micro]l Mg[Cl.sub.2], 18.3[chi] [micro]l [H.sub.2]O, 0.3[micro]l Taq. DNA polymerase, 2[chi] [micro]l Primer 1 and 2[chi] Lil Primer 2. The final volume was 30 [micro]l. [chi square]: number of reaction tubes (including the negative control)

Primers Used for PCR:

The cycling parameter for amplification were predenaturation at 94[degrees]C for 5 minutes, followed by 30 three-step cycles, including denaturation at 94[degrees]C for 1 minute; annealing at 45[degrees]C for 1.5 minutes, extension at 72[degrees]C for 1 minute and with a final elongation at 72[degrees]C for 5 minutes. The PCR products were then verified on agarose gel electrophoresis. 15[micro]l of PCR products were mixed with 2[micro]l of dye and before loading on a 1.5% agarose gel. A ladder was also loaded as a DNA size marker and was electrophoresed in TBE buffer with a voltage of 90V. Ethidium bromide (EtBr) staining following gel electrophoresis, specific band should be visible using Ultra Violet illumination.

Results and discussion

19 E coli isolates were obtained:

Antibiogramm (The disc diffusion method):

The arrows on each figure 1 show how the zone of inhibition of the bacteria was measured. Different diameters were measured with a ruler and were recorded on a data sheet as shown in Table 3. The clear zones around the antibiotic disc show the susceptibility of the bacteria against the antimicrobial. There were also isolates that were resistant to many antibiotics and no clear zone was observed. The resistance of the different antibiotics varies as the diameters of the zone of inhibition differ.

Table 3 gives the resistance and susceptibility of the isolated E. coli to different antibiotics as represented by the diameter in mm. The highlight indicates cases considered to be resistant to the respective antibiotics. All the isolated E. coli showed resistance to one or more antibiotics.

Out of the 19 isolates, 21% were resistant to amoxicillin/clavulanic acid, 11% were intermediates, that is, is developing resistance and 68% were susceptible to this particular antibiotic. Only 5% of the isolates were resistant to fosfomycin, with a percentage susceptibility of 95%.

Erythromycin, penicillin and neomycin showed a resistance of 100% from all the isolates. 31% of the isolates were resistant to streptomycin, 11% were intermediates and 58% were susceptible. The percentage of resistance to sulphamethoxazole/ trimethoprim is 42%, with an intermediate resistance of 5% and 53% were susceptible to the antibiotics.

Enrofloxacin Baytril had a percentage susceptibility of 90%, with a percentage resistance and intermediate resistance of 5%. 32% of the isolates were resistant to tetracycline, with an intermediate resistance of 21% and 47% were susceptible.

All isolates were susceptible to cefpirome. 89% of the isolates were susceptible to ceftazidime and cefpodoxime, with a resistance of 11% and 5% were resistant to cefotaxime, with a percentage susceptibility of 95%.

Phenotypic Confirmatory Tests for B-lactamases Production:

Escherichia coli was considered as producer of extended-spectrum beta-lactamases if there was a difference of [greater than or equal to] 5 mm between the zone diameter of either cephalosporins and their respective cephalosporins/clavulanate disc. Clavulanic acid is a beta-lactamase inhibitor.

Using cefpodoxime and ceftazidime, the isolates did not show any extended-spectrum beta-lactamase production as the difference in the zone diameter between these antibiotics with their respective cefpodoxime/clavulanic acid and ceftazidime/clavulanic acid was less than 5 mm.

10.5% of the isolates had a difference in the zone diameter which was more than 5mm for with cefotaxime/clavulanic acid and that of cefotaxime disc alone. Nevertheless, 73.7% of the isolates showed a zone diameter difference of greater than 5mm for cefpirome/clavulanic acid and cefpirome alone.

PCR amplification of beta-lactamase genes:

Each primer used gave a different profile (Figure 3-5) under the same reaction conditions.

TEM:

EW2 FGF1, HWO, IC and FC gave rise to a single band (Figure 3). No amplification was observed in the negative control. The fragments were either 1000 or 400 bp. The expected size fragment was ~1000bp.

SHV:

[E.sub.W2], [I.sub.C], [F.sub.C], and [H.sub.WO] gave rise to a single band of 500 bp while a 600 bp band was seen with FGF1. Three bands (2000bp, 700bp and 500bp) were visible with sample [F.sub.C] (Figure 4). The expected size fragment for this particular primer set is ~800bp.

Detection of CTX-M:

[E.sub.W2] and [I.sub.C] gave rise to 1 band, 300bp and 400bp respectively. No band was observed in FGF1, 6 bands in [F.sub.C], bands were between 400-2000bp and 3 bands in HWO (400-700bp). No amplification was observed in the negative control. The expected size fragment was ~500bp.

Discussion:

In this study, the antimicrobial resistance of Escherichia coli from different sources was evaluated. The samples were effluent waste water from the environment, hospitals, from different farms (processing unit, chicks basket from hatchery and hatchery of ducklings), overshoes which contain litter and faeces, faeces of different animals, guinea fowl, duck, cow and goat and suspected E. coli infections from chick's and duck's heart and intestinal content of ducklings and guinea fowl.

Escherichia coli were confirmed by the analytical profile index which indicated that the isolated black colonies with the metallic sheen were in fact E. coli. Seven digit codes were obtained, which corresponded to E. coli

Antibiotic susceptibility was carried out using the disc diffusion technique and the results varied for the different anti-microbials. There were a larger number of isolates that were resistant to neomycin, penicillin and erythromycin than to sulphamethoxazole/ trimethoprim and tetracycline. This pattern of resistance to the antibiotics may be due to widespread and lengthy use of tetracycline, neomycin, penicillin and erythromycin. However, resistance frequencies were also noted for the cephalosporins which are the third generation antibiotics.

Of all the E. coli isolates characterised in this study, all displayed resistance to one or more antibiotics, including penicillins, macrolides (erythromycin), tetracycline, sulphonamides (trimethoprim-sulfamethoxazole) and aminoglycocides (neomycin, Streptomycin). Some were still susceptible to the third class generations, that is, cephalosporins (cefotaxime, cefpirome, ceftazidime and cefpodoxime).

Tetracycline is a naturally derived compound. Hence, bacteria can be exposed to these agents in nature and outside any human use for disease treatment, for prophylaxis, or for growth promotion of livestock [23]. Accordingly, resistance to tetracycline may be conserved in bacterial populations, regardless of selection pressure, which might result in an overall increase in resistance over time [1]. Resistance to tetracycline is plasmid mediated, with a wide variety of genetic determinants [14,23] as well as chromosomally mediated.

Possible explanations for the persistence of sulphonamide resistance include the properties of the mobile elements on which the determinants are carried, and the possible selection pressures other than human medical use. Sulphonamide target the folic acid pathway used by bacteria to produce precursors important for DNA synthesis. The antibiotics bind to one of the enzymes and disrupt the folic acid pathway [4]. The use of this antimicrobial agent was restricted for food animals in the 1980s after a potential human health menace from residues in foods of animal origin. These drugs are broad spectrum antimicrobial agents, that is, they are widely used, with a history of more than 50 years of veterinary use [1].

Penicillin was once used to treat many different bacterial infections, but because of resistance, as the gene was around for a long time, penicillin is no longer as effective. Such resistant bacteria are also resistant to erythromycin as they have altered 50S ribosomal subunits with reduced affinity for erythromycin. Thus, the growing peptide chain is disrupted and mutation may also be involved which affect the proteins [8].

Resistance to aminoglycoside is due to the inactivation of the aminoglycoside by a large number of enzymes, generally coded by R-factors. Enzymatic inactivation of streptomycin is the most frequently encountered mechanism of resistance. In E. coli a single amino acid replacement in either one of the two specific positions results in 30S ribosomes resistant to streptomycin [4].

[FIGURE 1 OMITTED]

The proliferation of resistant E. coli contributes to the dissemination of the genetic components that confer the resistance phenotype; there might be transfer of resistance genes to other susceptible E. coli or to different bacterial species. Furthermore, the antibiotic resistance for one or more antibiotics could have been the outcome of independent, simultaneous development of resistance to different agents or could have been the consequences of co-selection of resistance determinants [1].

Nevertheless, evidence suggests that human and agricultural activity have a significant impact on the level of resistance in all environments. Antibiotic resistant E. coli from the human, as well as unabsorbed antibiotics can enter the environment via sewage (faecal contamination). Therefore, the bacteria may be disseminated thus expanding its resistance ubiquitously. Resistant organisms are also found in places where human impacts are negligible. This should not be surprising since antibiotics are natural microbial products. The use of antibiotics has lead to increased antibiotic resistance in humans, animals and the environment [1].

[FIGURE 2 OMITTED]

[FIGURE 3 OMITTED]

[FIGURE 4 OMITTED]

[FIGURE 5 OMITTED]

The production of extended-spectrum betalactamases was also evaluated by the phenotypic confirmatory tests by the disc diffusion method. Cefpodoxime, ceftazidime, cefotaxime and cefpirome and their corresponding clavulanic acid disc were used to screen for ESBL production by noting a specific difference in the zone diameters ([greater than or equal to] 5cm) which indicated a likely presence of ESBL. From the results it can be seen that the ESBL producers were those isolates that gave >5 mm difference in the case of cefpirome 14 isolates produced ESBL and for cefotaxime, 2 isolates produced ESBL.

DNA was extracted from a few isolates and tested in PCR for the presence of beta-lactamase genes. PCR amplification results showed the presence of different bands with the three sets of primers. The expected size fragments for TEM is 1000bp. Three of the five isolates ([E.sub.W2], [F.sub.BD], and [H.sub.WO]) gave bands of 1000bp which is that of the TEM beta-lactamase. The expected size fragment for SHV is 800bp. The 800bp band was absent from all the isolates, but other fragments of other sizes were obtained. In case of CTX-M, The expected size fragment for CTX-M was 500bp. and three isolates produced bands that were close to 500 bp.

This study has pointed to the wide occurrence of antibiotic resistance genes among E. coli isolates in wastes. The dissemination of those resistant bacteria in the environment may be due to faecal contamination by human and animals as well as the extensive use of antibiotics in livestock and medical treatment. Most isolates were resistant to at least three antibiotics while some were resistant to up to eight antibiotics. Most were still susceptible to third generation cephalosporins which indicate the level of evolution or nucleotide substitutions that the genes have undergone so far. This is similar to worldwide trends. The phenotypic analysis with the disc combination with clavulanic acid indicated the presence of extended-spectrum beta lactamases.

Acknowledgements

We wish to acknowledge the University of Mauritius and Miss Deepa Sonatun from the Food and Allied Industries Ltd (FAIL).

References

[1.] Alhaj, N., N.S. Mariana, A.R. Raha and Z. Ishak, 2007. Prevalence of Antibiotic Resistance among Escherichia coli from Different Sources in Malaysia. Int J Poultry Sc., 6(4): 293-297.

[2.] Babini, G. and D. Livermore, 2000. Are SHV beta-lactamases universal in klebsiella pneumonia? Antimicrob Agents Chemother., 44(8): 2230.

[3.] Barton, M.D., 1998. Does the use of antibiotics in animals affect human health? Aust Vet J., 76: 177-180.

[4.] Betty, A., Forbes, F. Daniel, Sahm, S. Alice Weissfeld, 2007. Bailey & Scott's Diagnostic Microbiology, 12th edition.

[5.] Brenwald, N.P., G. Jevons, J.M. Andrews, J.H. Xiong, P.M. Hawkey, and R. Wise, 2003. An outbreak of a CTX-M-type beta-lactamase-producing Klebsiella pneumoniae: the importance of using cefpodoxime to detect extended-spectrum beta-lactamases. J Antimicrob Chemother, 51: 195-196.

[6.] Falagas, M., S. Gorbach, 1995. Practice guidelines: urinary tract infections. Infect Dis Clin Pract., 4: 241-257.

[7.] Gevers, D., G. Huys and J. Swings, 2003. In vitro conjugal transfer of tetracycline resistance from Lactobacillus isolated to other grampositive bacteria, FEMS. Microbiol Lett., 225: 125-130.

[8.] Hugo, W.B., A.D. Rusell., 1991. Pharmaceutical Microbiology, 4th Edition, Blackwell Scientific Publications.

[9.] Kastner Sabine, Vincent Perreten, Helen Bleuler, Gabriel Hugenschmidt, Christophe Lacroix, and Leo Meile., 2005. Antibiotic susceptibility patterns and resistance genes of starter cultures and probiotic bacteria used in food. Sys. App Microbiol., 29: 145-155.

[10.] Mazel, D., J. Davies, 1999. Antibiotic resistance in microbes, Cell Mol Life Sci., 56: 742-754.

[11.] Novick, R.P., 1981. The development and spread of antibiotic resistant bacteria as a consequence of feeding antibiotics to livestock. Ann, NY Acad, Sci., 368: 23-59.

[12.] Neu, H.C., 1992. The crisis in antibiotic resistance. Sci., 257: 1064-1070.

[13.] Paterson, D.L. and R.A. Bonomo, 2005. Extended-spectrum beta-lactamases: a clinical update. Clin Microbiol Rev., 18: 657-686.

[14.] Prescott, J.F., J.D. Baggot, R.D. Walker, 2000. Antimicrobial therapy in veterinary medicine. 3rd edition. Ames: Iowa State Press.

[15.] Ryoo, N.H., E.C. Kim, S.G. Hong, 2005. Dissemination of SHV-12 and CXT-M-type extended spectrum beta-lactamases among clinical isolates of E. coli and Klebsiella pneumonia and emergence of GES-3 in Korea. J Antimicrob Chemother, 56: 698-702.

[16.] Salyers, A.A., A. Gupta and Y. Wang, 2004. Human intestinal bacteria as reservoirs for antibiotic resistance genes, Trends Microbiol, 12: 412-416.

[17.] Schroeder, C.M. et al. 2002. Antimicrobial resistance of Escherichia coli O157 isolated from humans, cattle, swine, and food. App Environ Microbiol, 68: 576-581.

[18.] Schroeder, M. Carl, Jianghong Meng, Shaohua Zhao, Chitrita DebRoy, Jocelyn Torcolini, Cuiwei Zhao, Patrick F. McDermott, David D. Wagner, Robert D. Walker. and David G, White, 2002. Antimicrobial Resistance of Escherichia coli O26, O103, O111, O128, and O145 from Animals and Humans. Emerg Infec Dis., 8: 1409-1414.

[19.] Siegel, D., W. Huber and F. Enloe, 1974. Continuous non- therapeutic use of antibacterial drugs in feed and drug resistance of the gram-negative enteric florae of food producing animals, Antimicrob Agents Chemother, 6: 697-701.

[20.] Teuber, M., 1999. Spread of antibiotic resistance with food-borne pathogens, Cell. Mol. Life Sci., 56: 755-763.

[21.] Thielman, N.M., R.L. Guerrant, 1999. Escherichia coli. In: Yu VL, Merigan Jr TC, Barriere SL, editors. Baltimore: The Williams & Wilkins Company., 188-200.

[22.] Timothy, R., O.C. Keller, W.C. Pancorbo, Merka and H.M. Barnhart, 1997. Antibiotic resistance of Bacterial Litter Isolates. Poultry Sci., 77: 243-247.

[23.] Tricia, D. Miles, Wayne McLaughlin, Paul D. Brown., 2006. Antimicrobial resistance of Escherichia coli isolates broiler chickens and humans. BMC Vet Res., 6: 2-7.

[24.] Von Baum, H. and R. Marre, 2005. Antimicrobial resistance of Escherichia coli and therapeutic implications. Int. J. Med. Microbiol., 295: 503-511.

[25.] Witte, W., 1998. Medical consequences of antibiotic use in agriculture, Science, 279: 996-997.

Ittoo Danishta, (1) Mamode Ismet, (1) Deepa Sonatun and Yasmina Jaufeerally-Fakim

University of Mauritius Food and Allied Industries Limited, Mauritius

Corresponding Author:

Yasmina Jaufeerally-Fakim, University of Mauritius Food and Allied Industries

Limited, Mauritius

Phone number: +230 719 7352

E-mail: yasmina@uom.ac.mu
Table 1: Sources and reference of bacterial isolates

Isolate       Sources
reference

[E.sub.P]     Effluent water poultry processing unit
[I.sub.C]     Suspected E. coli infection from chick's heart
[E.sub.HC]    Effluent water chicks basket from hatchery
[O.sub.1]     Overshoes contains poultry litter and faeces
[O.sub.2]     Overshoes contains poultry litter and faeces
[O.sub.3]     Overshoes contains poultry litter and faeces
[I.sub.DL]    Suspected presence on E. coli from intestine of ducklings
[F.sub.BD]    Faeces of breeder duck
[F.sub.GFI]   Feaces of breeder Guinea fowl Rf 55
[I.sub.D]     Suspected E. coli infection from duck's heart
[E.sub.HD]    Effluent water hatchery of ducklings
[F.sub.GF2]   Feaces of breeder Guinea fowl Rf 54
[IC.sub.GF]   Intestinal content of Breeder Guinea Fowl
[F.sub.C]     Faeces of cow
[F.sub.G]     Faeces of goat
[H.sub.WI]    Hospital wastes (Inlet)
[H.sub.WO]    Hospital wastes (Outlet)
[E.sub.W1]    Environmental wastes 1
[E.sub.W2]    Environmental wastes 2

Table 2: Primers used and their Sequences

PRIMER            SEQUENCE (5'-3')       Reference

SHV B1            ATGCGTTATATTCGCCTGTG      (2)
SHV B2            GTTAGCGTTGCCAGTGCTCG
Bla TEM A2        TTACCAATGCTTAATCA
Bla TEM A1        TAAAATTCTTGAAGACG
CXT-M (forward)   ACCGCGATATCGTTGGT        (15)
CXT-M (reverse)   CGCTTTGCGATGTGCAG

Table 3: Antibiotic sensitivity testing.
The clear zone diameter (mm) was measured.

                      Antibiotic Sensitivity Tests (mm)

Description    AMC    FOS    E      S      SXT    P      N     ENR

[E.sub.P]      25     22     7      14     22     7      11     24
[E.sub.HC]     23     38     7      15     18     7      11     33
[I.sub.C]      28     42     7      8      9      9      12     21
[O.sub.1]      25     36     8      15     15     6      10     30
[O.sub.2]      22     39     8      15     7      7      9      23
[O.sub.3]      27     39     8      8      7      14     11     7
[I.sub.DL]     17     34     9      15     10     8      11     30
[F.sub.BD]     14     37     7      9      30     8      11     32
[F.sub.GF1]    16     33     7      8      7      7      10     28
[I.sub.D]      25     37     12     16     9      7      11     35
[E.sub.HD]     27     38     7      15     25     9      17     37
[F.sub.GF2]    25     40     10     15     34     7      9      35
[IC.sub.GF]    28     38     8      16     34     8      12     25
[E.sub.W1]     25     37     9      15     30     7      10     27
[E.sub.W2]     24     39     6      8      7      7      10     25
[H.sub.WI]     18     35     7      7      7      7      10     30
[H.sub.WO]     25     32     8      14     24     14     11     32
[F.sub.C]      26     36     10     15     34     9      11     31
[F.sub.G]      25     41     9      16     33     7      11     34

              Antibiotic Sensitivity Tests (mm)

Description    T      CFP    Ca     CPD    CXT

[E.sub.P]      19     28     30     24     31
[E.sub.HC]     16     31     29     28     33
[I.sub.C]      14     32     30     30     33
[O.sub.1]      14     28     29     27     35
[O.sub.2]      9      30     31     34     31
[O.sub.3]      19     28     26     24     34
[I.sub.DL]     15     29     30     30     33
[F.sub.BD]     25     31     33     26     33
[F.sub.GF1]    15     31     29     30     32
[I.sub.D]      14     31     34     31     35
[E.sub.HD]     15     29     36     30     30
[F.sub.GF2]    11     32     33     31     37
[IC.sub.GF]    21     31     34     31     35
[E.sub.W1]     28     28     29     27     31
[E.sub.W2]     14     29     26     26     30
[H.sub.WI]     20     29     33     31     34
[H.sub.WO]     27     30     31     29     29
[F.sub.C]      31     31     32     29     36
[F.sub.G]      33     35     36     30     39

AMC, amoxicillin/clavulanic acid; FOS, fosfomycin; E, erythromycin;
S, streptomycin; SXT, sulphamethoxazole/ trimethoprim; P,
Penicillin G; N, neomycin; ENR, enrofloxacin Baytril; T,
tetracycline; Cfp, cefpirome; Ca, ceftazidime; CPD, cefpodoxime;
CXT, cefotaxime.
COPYRIGHT 2010 American-Eurasian Network for Scientific Information
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original Article
Author:Danishta, Ittoo; Ismet, Mamode; Sonatun, Deepa; Jaufeerally-Fakim, Yasmina
Publication:Advances in Environmental Biology
Article Type:Report
Geographic Code:6MAUI
Date:Jan 1, 2010
Words:4530
Previous Article:Low cost fish fed for aquarium fish: a test case using earthworms.
Next Article:Effect of water stress on some seed characteristics of Isabgol (Plantago ovata Forsk) in Zanjan (IRAN).
Topics:

Terms of use | Copyright © 2017 Farlex, Inc. | Feedback | For webmasters