Printer Friendly

Anti-cancer effect of (-)-epigallocatechin-3-gallate (EGCG) in head and neck cancer through repression of transactivation and enhanced degradation of [beta]-catenin.

ABSTRACT

Background and Purpose: Aberrant expression of [beta]-catenin is highly associated with progression of various cancers including head and neck cancer (HNC). Green tea is most commonly used beverage in the world and one of the more bioactive compounds is the antioxidant epigallocatechin gallate (EGCG). This study was performed to investigate the mechanism by which EGCG inhibits the growth of HNC, focusing on the modulation of the expression and activity of [beta]-catenin.

Methods: In vitro effects of EGCG on the transcription, translation, or degradation of [beta]-catenin were investigated. Antitumor effects of EGCG in vivo were evaluated in a syngeneic mouse model and [beta]-catenin expression was checked in HNC patients' samples.

Results: [beta]-catenin expression was elevated in tumor samples of HNC patients. EGCG induced apoptosis in KB and FaDu cells through the suppression of [beta]-catenin signaling. Knockdown of [beta]-catenin using siRNA enhanced the proapoptotic activities of EGCG. EGCG decreased mRNA and transcriptional activity of [beta]-catenin in p53 wild-type KB cells. EGCG also enhanced the ubiquitination and proteasomal degradation of [beta]-catenin. The suppression of [beta]-catenin and consequent apoptosis were observed in response to EGCG treatment in a syngeneic mouse model. In conclusion, we report that EGCG inhibits [beta]-catenin expression through multiple mechanisms including decreased transcription and increased ubiquitin-mediated 26S proteasomal degradation.

Conclusion: This study proposes a novel molecular rationale for antitumor activities of green tea in HNCs.

Keywords:

[beta]-catenin

(-)-epigallocatechin-3 gallate

Head and cancer

Transactivation

Ubiquitination

P53

Introduction

Less than 50% of patients with advanced head and neck cancer (HNC) are cured without locoregional or distant failure despite intense interventions, including destructive surgery, radiotherapy or chemotherapy (Jung et al., 2014; Takes et al., 2012). Moreover, the survival rates of HNC patients have not improved significantly over several decades (Siegel et al., 2014). Therefore, alternative treatment options are currently being investigated by many physicians and researchers. Herbal ingredients are appealing as a treatment option because of their easy accessibility and reduced incidence of side-effects. (-)-Epigallocatechin-3 gallate (EGCG), which is the major polyphenol in green tea, has therapeutic potential against various cancers (Hou et al., 2004; Koh et al., 2011; Yang et al., 2007). EGCG activates numerous signaling pathways, which can inhibit cancer cell proliferation, modulate the cell cycle, and suppress tumor invasion or metastasis (Lambert and Yang, 2003; Lim et al., 2008; Yang et al., 2011). Previously, our group reported that EGCG inhibits the growth and progression of HNC. However, the molecular mechanisms of the antitumor effects of EGCG on HNC have not been well characterized.

[beta]-catenin regulates cell-to-cell adhesion and plays a crucial role in Wnt signaling, acting as a transcription cofactor with T cell/lymphoid enhancer factor (TCF) (Ponti et al., 2005). Wnt signaling activation results in the cytoplasmic accumulation of [beta]-catenin and its consequent translocation into the nucleus (Iki and Pour, 2006). Aberrant [beta]-catenin expression is frequently observed in various cancers, including colorectal cancers, lung cancers, breast cancers and head and neck squamous cell carcinoma (Lee et al., 2014).

Here, we report that ECCG inhibited HNC growth and induced apoptosis through suppression of [beta]-catenin pathway, especially in regard to p53 mutation status. In vitro study indicates the mechanisms of [beta]-catenin downregulation by EGCG, and in vivo study supports anti-tumorigenic activities of EGCG in a syngeneic mouse model.

Materials and methods

Patients

Between 2007 and 2011, 18 patients (12 men and 6 women, with an average age of 58.6 years and ranging between 33-84 years), who underwent surgical treatment at the Ajou University Hospital (Suwon, Korea), were enrolled in this study. All patients included in the study provided written informed consent. All studies were carried out in accordance with the approved guideline of the Ajou University Hospital institutional review board.

Cell culture

Human HNC cell lines, KB (oral cavity squamous cell carcinoma) and FaDu (hypopharynx squamous cell carcinoma), were obtained from American Type Culture Collection (Rockville, MD, USA). SNU899 (larynx squamous cell carcinoma) was obtained from Korean Cell Line Bank (Seoul, Korea). AMC-HN9 (parotid gland undifferentiated carcinoma) was kindly provided by Dr. Sang-Yoon Kim at Asan Medical Center (Seoul, Korea). KB and AMC-HN9 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco/Invitrogen, Carlsbad, CA, USA). FaDu cells were cultured in minimum essential medium (MEM) supplemented with 1% nonessential amino acid and 1% sodium pyruvate, and SNU899 cells were cultured in RPMI 1640. All culture media were supplemented with 10% fetal bovine serum and 1% antibiotics. Cell cultures were maintained at 37[degrees]C in a humidified incubator with 5% C[O.sub.2].

Cell proliferation assay

For cell viability assays, HNC cells were seeded in 96-well plates at a cell density of 5 x [10.sup.3] cells/well with 1 mL of complete medium and with various concentrations of EGCG (0-200 [micro]m) (Sigma-Aldrich, St. Louis, MO, USA) for 24 h. MTT, also known as 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (Sigma-Aldrich), was added to 40 [micro]l of the cell suspension for 4h. After three washes with phosphate buffered saline (PBS, pH 7.4), insoluble formazan product was dissolved in dimethyl sulfoxide (DMSO). The optical density (OD) of each culture well was measured at 540 nm using a microplate reader (Bio-Tek, Winooski, VT, USA). Cell viability results were presented as percentages normalized to untreated cells.

Western blot analysis

Cells were lysed in RIPA (radioimmunoprecipitation) buffer containing 150 mM NaCl, 1.0% NP-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 50 mM Tris-HCI (pH 8.0), and protease inhibitor cocktail (Roche Applied Science, Vienna, Austria, pH 7.4). The reaction mixture was centrifuged at 12,000 rpm and 4[degrees]C for 5 min, and the supernatant was used in western blot analysis. The following antibodies were used for western blot analysis; [beta]-catenin, Cyclin Dl, cleaved caspase-3, PARP, phospho-AKT, total AKT, phospho-GSK-3[beta], Lamin A, and [alpha]-tubulin (1:1000, Cell Signaling Technology, Danvers, MA, USA).

Immunofluorescence

Cells were cultured on microscope coverslips (Thermo Fisher Scientific, Rochester, NY, USA) and treated with vehicle or 30 pm of EGCG. After 24 h, the slides were washed with PBS, fixed for 20 min in 3.7% formaldehyde, and rehydrated in PBS. After blocking for 45 min in BSA (in 5% PBS), the slides were incubated with polyclonal rabbit anti-[beta]-catenin antibodies (1:50; Cell Signaling Technology) for 1 h, washed with PBS, and incubated with Alexa 488-labeled goat anti-rabbit antibodies (1:250; Molecular Probes, Eugene, OR, USA) for 45 min. After rinsing in PBS, Hoechst 33,258 was added for 15 min to counterstain the nuclei. The slides were washed with PBS and mounted with Vectashield (Vector Laboratories, Inc., Burlingame, CA, USA). Cells were imaged using a fluorescence microscope (Carl Zeiss, Germany).

Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was extracted from homogenized cells using TRIzol[R] reagent (Gibco-BRL, Grand Island, NY, USA). Total RNA (1 [micro]g) was mixed with 10 [micro]g of the ReverTrace qPCR RT (Toyobo Co. Ltd., Osaka, Japan) mixture and cDNA was synthesized according to the manufacturer's instruction. cDNA was added to a mixture of Quick Taq HS DyeMix (Toyobo Co. Ltd.) and specific primers, and amplified using a T100[TM] Thermal Cycler (Bio-Rad, Waltham, MA, USA). The following [beta]-catenin and [beta]-actin primer sequences were used: [beta]-catenin-forward, 5'-ACC TGG ATG CCG TCG TGG AC-3'; [beta]-catenin-reverse, 5'-TGT GGC AGC ACC AGG GCA GC-3'; 0-actin-forward, 5'-GGG GAA GAT G CT GTT CA-3'; and [beta]-actin-reverse, 5'-GGT CCC AGT GGG CAT TTA CA-3'. The following PCR reaction conditions were used: 1 cycle of [3 min at 94[degrees]C (denaturation)], 35 cycles of [30 s at 94[degrees]C (denaturation), 30 s at 60[degrees]C (annealing), and 30 s at 72[degrees]C (elongation)], and 1 cycle of 15 min extension at 72[degrees]C). PCR products were separated by electrophoresis in a 1.5% agarose gel and detected using ultraviolet light (Bio-Rad, Hercules, CA, USA).

Luciferase reporter assay

Transient transfections with luciferase constructs containing the [beta]-catenin promoter were performed using Lipofectamine 2000 (Invitrogen Corporation, Carlsbad, CA, USA) following the manufacturer's instruction. Cells were seeded in 60 mm plates at a cell density of 3 x [10.sup.5] cells/well. Cells were transfected with plasmids containing [beta]-catenin/TCF-LEF-responsive (TOP-FLASH) and mutant (FOP-FLASH) promoters prepared with 10 [micro]l of Lipofectamine 2000 reagent (Invitrogen) for 24 h. After 24 h, cells were harvested in 1 x luciferase lysis buffer, and luciferase activity was determined and normalized to the [beta]-Gaiactosidase Enzyme Assay System with Reporter Lysis Buffer (Promega). Luminescence was measured using a Victor 1420 multilabel counter (Perkin-Elmer Life Sciences, Turku, Finland).

Isolation of nuclear and cellular extracts

Nuclear and cellular extracts were isolated from cells treated with vehicle or 30 pm EGCG for 24 h using the NE-PER Nuclear and Cytoplasmic Extraction Reagents kit (Pierce Biotechnology, Rockford, IL, USA), following the manufacturer's protocol.

Immunoprecipitation

Cells were lysed in RIPA buffer containing 150 mM NaCl, 1.0% NP-40, 0.5% sodium deoxycholate. 0.1% SDS, 50 mm Tris (pH 8.0), and protease inhibitor cocktail (Roche Applied Science, Vienna, Austria, pH 7.4) for 30 min and centrifuged at 13,000 x g at 4[degrees]C. The resulting supernatant was incubated with polyclonal anti-[beta]catenin antibody (1:100) overnight at 4[degrees]C, followed by incubation with protein G beads (Invitrogen Corporation) for 2 h at 4[degrees]C. After washing four times with ice-cold PBS, the protein complex was boiled in an equal volume of 2x SDS sample buffer and used for immunoblotting with a monoclonal anti-ubiquitin antibody.

Transfection of p53 complementary DNA and [beta]-catenin siRNA

All transfection experiments were performed using Lipofectamine 2000 (Invitrogen Corporation) as described previously (Chang et al., 2014). After incubation for 24 h, the medium was removed and the cells were washed with PBS and treated with either EGCG or vehicle for 24 h. The control siRNA, and siRNAs for [beta]-catenin (sense: AGCUGAUAUUGAUGGACAGUU, and antisense: CUGUCCAUCAAUAUCAGCUUU) were obtained from Genolution Pharmaceuticals (Seoul, Korea) and p53 DNA and siRNA was purchased from Invitrogen Corporation.

In vivo syngeneic mouse C3H/HeJ model

Animal experiments were approved by the Animal Care and Use Committee of Ajou University and were performed in accordance with relevant guidelines and regulations. A syngeneic mouse model (C3H/HeJ mice, SCC Vil/SF cell) was used in vivo studies, as previously described (Lim et al., 2010). Six week old female C3H/HeJ syngeneic mice (~20g) were obtained from Orient (Orient Bio, Seoul Korea) and maintained in the pathogen free animal laboratory for at least one week. All mice were then injected subcutaneously with 5 x [10.sup.5] viable SCC VII/SF cells into the flank. Three mice were given daily intraperitoneal injections of distilled water (D.W, control group), and the other three mice received intraperitoneal injections of 25 or 50mg/kg EGCG (treatment group) 5 days a week. After the final injection, animals were euthanized and tumor samples were collected at 22 days after implantation, [beta]-catenin immunohistochemistry was performed on paraffin-embedded SCC VII/SF tumor sections collected on polylysine-coated slides.

Statistical analysis

Data from at least three independent experiments were expressed as means [+ or -]SD. Comparisons of the means of different groups were performed using one-way analysis of variance (ANOVA). The Student-Newman-Keuls test was used for pairwise comparisons of results, which were found to be significant by ANOVA. P values < 0.05 were determined to be statistically significant.

Results

[beta]-catenin expression is elevated in tumor samples of HNC patients

The protein expression levels of [beta]-catenin were examined in lysates of tumor tissue samples from HNC patients who underwent surgery, and compared to adjacent normal tissue samples from the same patients, [beta]-catenin protein levels were moderate to high in HNC tumors; whereas, [beta]-catenin protein levels were low in adjacent normal tissues, with the exceptions of an oral cavity tissue sample and a tissue sample from a patient with larynx cancer (Fig. 1).

EGCC induces apoptosis and downregulates [beta]-catenin signaling in HNC cells

Treatment with increasing concentrations of EGCG decreased the viability of various HNC cell lines in a dose-dependent manner, comparable to cisplatin. In particular, EGCG effects were notable in KB and FaDu cells (Fig. 2). [beta]-catenin is associated with the tumorigenesis of various cancers. Therefore, we investigated whether [beta]-catenin and its downstream pathway were suppressed by EGCG. Western blot analysis showed that treating KB and FaDu cells with 30 [micro]m of EGCG significantly downregulated [beta]-catenin protein levels (Fig. 3A); whereas, the same concentration of EGCG had minimal or no effect on [beta]-catenin protein levels in HN9 and SNU899 cells (Fig. 3A), respectively. In KB and FaDu cells, downregulation of [beta]-catenin by 30 [micro]m of EGCG was time-dependent and associated with an increase of phosphorylated GSK-3[beta] at serine 9 residue. (Fig. 3B). We also performed immunofluorescence to confirm that EGCG treatment downregulated [beta]-catenin protein levels in KB and FaDu cells. Immunofluorescence results revealed decreased [beta]-catenin immunofluorescence (green) in the cells treated with EGCG; DAP1 counterstaining (blue) was similar in the cells treated with or not treated with EGCG (Fig. 3C). Next, we determined the effect of EGCG on upstream and downstream signaling pathways of [beta]-catenin. As determined by western blotting analysis, EGCG treatment decreased p-AKT and cyclin D1 protein levels and increased p-GSK-3[beta] levels. EGCG treatment also induced the processing of apoptotic proteins, including the cleavage of PARP and caspase-3 which are molecular marker of apoptosis (Fig. 3D). These results suggest that EGCG decrease cell viability and induces apoptotic cell death by downregulating [beta]-catenin signaling.

siRNA-mediated knockdown of [beta]-catenin enhances ECCC-induced cytotoxicity

To investigate whether the expression level of [beta]-catenin influenced EGCG-induced cytotoxicity, KB and FaDu cells were transfected with either [beta]-catenin siRNA or control siRNA and treated with 0.10, 30, and 50 [micro]m of EG CG for 24 h. Western blot analysis demonstrated successful [beta]-catenin knockdown with [beta]-catenin siRNA (Fig. 4A). In addition, knocking down [beta]-catenin with siRNA enhanced EGCG-induced cleavage of caspase-3, particularly in KB cells (Fig. 4A). Knocking down [beta]-catenin with siRNA also enhanced EGCG-induced cytotoxicity in KB cells but not in FaDu cells (Fig. 4B, C). Taken together, these results suggest that [beta]-catenin plays a pivotal role in EGCG-induced apoptotic cell death in KB cells.

EGCC inhibits [beta]-catenin transcription and translation

To determine whether EGCG downregulated [beta]-catenin by inhibiting its transcription, KB and FaDu cells were treated with different concentrations of EGCG (0, 10 or 30 [micro]m) and the mRNA levels of [beta]-catenin were measured using RT-PCR. RT-PCR analysis revealed that 30 [micro]m of EGCG decreased [beta]-catenin transcript levels in KB cells (Fig. 5A). However, EGCG did not affect mRNA of [beta]-catenin in FaDu cells. Next to determine whether the downregulation of [beta]-catenin by EGCG affected [beta]-catenin/TCF-dependent activity, luciferase reporter assays were performed using TOP-FLASH or FOP-FLASH constructs containing six copies of wild-type or mutated TCF binding sites, respectively. EGCG treatment (30 [micro]m) significantly reduced the ratio of TOP/FOP in KB and FaDu cells (Fig. 5B), indicating that the downregulation of [beta]-catenin by EGCG inhibited [beta]-catenin/TCF-dependent transcriptional activity.

The nuclear translocation of [beta]-catenin is also closely associated with its transcriptional activity. To determine whether EGCG alters the nuclear localization of [beta]-catenin, we measured [beta]-catenin protein levels in fractionated nuclear or cytosolic lysates after EGCG treatment (24 h). The successful fractionation of nuclear and cytosol proteins was validated with Lamin A, which was detected only in the nuclear fraction by western blot analysis. EGCG treatment decreased [beta]-catenin protein levels in both nuclear and cytosolic fractions (Fig. 6A). These results indicated that EGCG treatment globally reduced [beta]-catenin protein levels in KB cells.

On the other hand, cellular levels of [beta]-catenin are affected by protein degradation and stability. To determine whether EGCG also affected [beta]-catenin via post-translational modification, we treated cells with vehicle and EGCG (30 [micro]m) and then co-trerated with the protein synthesis inhibitor, cycloheximide (CHX; 10 [micro]m). Co-treatment of cells with CHX and EGCG resulted in a decrease of [beta]-catenin synthesis compared to vehicle-treated cells (Fig. 6B). Therefore, EGCG inhibits [beta]-catenin expression through decreasing transcription in KB cells.

EGCG induces ubiquitination and proteasomal degradation of [beta]-catenin

To determine whether EGCG downregulates [beta]-catenin protein levels by inducing its proteasomal degradation, cells were treated with various proteasome inhibitors (MG-132, lactacystin, epoxomicin) and with or without EGCG (0 or 30 [micro]m). Interestingly, pretreatment with lactacystin reduced EGCG-mediated [beta]-catenin downregulation and PARP and caspase-3 cleavage in KB cells (Fig. 7A).

[beta]-catenin is degraded by the 26S proteasome after its modification by ubiquitin. To determine whether EGCC-induced proteasomal degradation of [beta]-catenin requires ubiquitination, we performed immunoprecipitation to see if EGCG increases ubiquitinated [beta]-catenin. In lysates of cells treated with 30 [micro]m EGCG, increased levels of ubiquitinated proteins were observed, indicated by a ladder of the ubiquitin protein (Fig. 7B, lower column). Immunoblotting the same samples with a [beta]-catenin antibody revealed that [beta]-catenin was downregulated by EGCG treatment (Fig. 7B, upper column) in KB cells but not in FaDu cells.

Up and down regulation of p53 modulates ECCG-induced cytotoxicity

To investigate whether the level of p53 influenced [beta]-catenin expression and EGCG-induced cytotoxicity, KB cells were transfected with either p53 cDNA or p53 siRNA and treated with 30 [micro]m of EGCG for 24 h. Western blot analysis indicated successful p53 up and down regulation (Fig. 8A). As shown in Fig. 8A left column, p53 overexpression resulted in decreased [beta]-catenin expression, cleaved PARP activity and apoptosis. Treatment of 30 [micro]m EGCG further enhanced [beta]-catenin expression, compared to EGCG-treated control cells (Fig. 8A). In parallel to [beta]-catenin activity, KB/p53 cells markedly increased typical morphological features of apoptosis, including Annexin V-positive and TUNEL-positive cell staining compared to control cells. This effect was further increased by EGCG treatment (Fig. 8B, C, left column). In addition, knocking down p53 with siRNA reduced EGCG-induced [beta]-catenin depression, cleavage of PARP and apoptosis in KB cells (Fig. 8A, B, and C, right column). Taken together, these results suggest that p53 mediated [beta]-catenin regulation plays a pivotal role in EGCG-induced apoptotic cell death in KB cells.

EGCG inhibits [beta]-catenin expression and increases tumor cell apoptosis in a syngeneic mouse model

To determine whether EGCG treatment had similar effects in vivo, we treated an immunocompetent syngeneic mouse model (C3H/HeJ mice, SCC VII/SF cells) with various concentrations of EGCG (0, 25, or 50mg/kg). Immunohistochemical analysis of [beta]-catenin in mice tissues revealed reduced [beta]-catenin immunopositive staining as the dosage of EGCG increased from 25 to 50 mg/kg (Fig. 9A). We also performed western blotting analysis of [beta]-catenin and cleaved caspase-3 in tumor samples of C3H/HeJ syngeneic mice, [beta]-catenin protein levels were reduced and cleaved caspase-3 levels were elevated in tumors treated with increasing concentrations of EGCG (Fig. 9B), indicating that EGCG treatment is effective in vivo as well as in vitro.

Discussion

Green tea is one of the most frequently and heavily consumed beverages worldwide. Polyphenols, abundant in green tea, have been extensively investigated with health benefits, including antibacterial, (Edwards-Jones et al., 2004) antioxidative,(Scott et al., 1993) and antitumor activities (Masuda et al., 2011). Our previous studies demonstrated that EGCG treatment significantly induced the growth arrest and apoptosis of human HNC cells by suppressing HGF/c-Met and downstream MAPK pathway (Koh et al., 2011; Lim et al., 2008) HGF-induced the activation of Akt and Erk were successfully down regulated by EGCG treatment in oral cavity and hypopharyngeal cancers. However, the specific underlying mechanisms by which EGCG affects human HNC cells have only been partially determined, especially involving [beta]-catenin. Therefore, we sought to better understand the in vitro effects of EGCG on [beta]-catenin transcription, translation, and degradation. Moreover, antitumor effects of EGCG were studied in vivo in a syngeneic mouse model.

In this study, we demonstrated that [beta]-catenin protein expression was elevated in tumor samples of various HNC patients. In addition, EGCG induced apoptosis in HNC cell lines, especially in KB and FaDu cells, by suppressing [beta]-catenin signaling. [beta]-catenin protein levels were reduced by EGCG treatment. In addition, the levels of proteins downstream of [beta]-catenin signaling, including for Akt, GSK-3[beta], and cyclin D-l, were also reduced by EGCG treatment. Knockdown of [beta]-catenin by siRNA enhanced the cytotoxic effect of EGCG in HNC cells. EGCG inhibited the transcription and translation of [beta]-catenin, and enhanced the ubiquitination and proteasomal degradation of [beta]-catenin. EGCG treatment also reduced [beta]-catenin expression and induced apoptosis in a syngeneic mouse model. These findings suggest that the antitumor effects of EGCG are mediated by the downregulation and enhanced degradation of [beta]-catenin, resulting in decreased [beta]-catenin-dependent transcriptional activity.

[beta]-catenin, which is localized on the membrane of epithelial cells, is involved in cellular processes that contribute to oncogenesis, including cell motility, differentiation, and sternness (Buchert et al., 2015; Jung et al., 2015). Furthermore, [beta]-catenin plays an important role in cancer metastasis and progression through E-cadherin-dependent cell adhesion (Gavard and Mege, 2005). The expression level of [beta]-catenin has been positively correlated with histologic grade, aggressive clinical features, poor prognosis, and metastasis in HNC (Iwai et al., 2010; Santoro et al., 2014).

In this study, [beta]-catenin expression was elevated in tumor samples of HNC patients. In general, EGCG downregulates [beta]-catenin transcription and translation and enhances its degradation. However, the effects of EGCG were different in KB cells than in FaDu cells. EGCG downregulated [beta]-catenin mRNA expression and translation in KB cells. In addition, a reduction in [beta]-catenin protein levels were greater in KB cells co-treated with EGCG and a protein synthesis inhibitor than in KB cells treated only with EGCG. Apoptotic cell death induced by EGCG treatment was significantly enhanced in KB cells transfected with [beta]-catenin siRNA but not in FaDu cells transfected with [beta]-catenin siRNA. We hypothesized that the differential response of KB (p53 wild-type) and FaDu (p53 mutant) cells to EGCG might depend on p53 mutation status. An association between [beta]-catenin and the p53 pathway has been suggested in oncogenesis of cancers, especially of human colon cancers, which exhibit high rates of p53 mutations and aberrant [beta]-catenin expression(Kinzler and Vogelstein, 1996; Levina et al., 2004). As a key tumor suppressor, p53 can be activated by deregulated [beta]-catenin, resulting in feedback downregulation of its expression. In addition, Darmalas et al. revealed a direct association between p53 and [beta]-catenin by showing that increased [beta]-catenin levels could stabilize p53, resulting in greater activation of p53 target genes (Damalas et al., 1999). Activation of the p53 pathway induces degradation of [beta]-catenin via the ubiquitin-proteasome pathway (Liu et al., 2001; Matsuzawa et al., 1998). Therefore, the transcriptional activation of p53 target genes might accelerate [beta]-catenin degradation. Activation of p53 can also result in the activation of GSK-3[beta] in the nucleus and an eventual decrease in [beta]-catenin levels (Watcharasit et al., 2002).

In conclusion, we demonstrated that EGCG inhibited [beta]-catenin transcription and translation and enhanced its degradation. These effects were associated with multiple cellular mechanisms that potentially depend on the p53 mutation status of the cell. Our studies provide a molecular rationale for the use of green tea as a potential chemotherapeutic in HNCs.

ARTICLE INFO

Article history:

Received 26 March 2016

Revised 16 July 2016

Accepted 19 July 2016

Conflict of interest

We wish to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome.

Acknowledgment

This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2013R1A1A2059489), Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT and Future Planning (2015R1A2A1A01002968) and the National Research Foundation of Korea (NRF) grant funded by the Korean Government (MSIP) (No. 2011-0030043 (SRC)).

References

Buchert, M., Rohde, F., Eissmann, M., Tebbutt, N., Williams, B., Tan, C.W., Owen, A., Hirokawa, Y., Gnann, A., Orend, G., Orner, C., Dashwood, R.H., Heath, J.K., Ernst, M., Janssen, K.P., 2015. A hypermorphic epithelial beta-catenin mutation facilitates intestinal tumorigenesis in mice in response to compounding WNT-pathway mutations. Dis. Models Mech.

Chang, J.W., Kang, S.U., Choi, J.W., Shin, Y.S., Baek, S.J., Lee, S.H., Kim, C.H., 2014. Tolfenamic acid induces apoptosis and growth inhibition in anaplastic thyroid cancer: Involvement of nonsteroidal anti-inflammatory drug-activated gene-1 expression and intracellular reactive oxygen species generation. Free Radical Biol. Med. 67. 115-130.

Damalas, A., Ben-Ze'ev, A., Simcha, I., Shtutman, M., Leal, J.F., Zhurinsky, J., Geiger, B.. Oren, M., 1999. Excess beta-catenin promotes accumulation of transcriptionally active p53. EMBO J. 18 (11), 3054-3063.

Edwards-Jones, V., Buck, R., Shawcross, S.G., Dawson, M.M., Dunn, K., 2004. The effect of essential oils on methicillin-resistant Staphylococcus aureus using a dressing model. Burns 30 (8). 772-777.

Gavard, J., Mege, R.M., 2005. Once upon a time there was beta-catenin in cadherin mediated signalling. Biol. Cell Auspices Eur. Cell Biol. Org. 97 (12). 921-926. Hou, Z., Lambert, J.D., Chin, K.V., Yang, C.S., 2004. Effects of tea polyphenols on signal transduction pathways related to cancer chemoprevention. Mut. Res. 555 (1-2), 3-19.

Iki, K., Pour, P.M., 2006. Expression of Oct4. a stem cell marker, in the hamster pancreatic cancer model. Pancreatol. 6 (4), 406-413.

Iwai, S., Yonekawa, A., Harada, C., Hamada, M., Katagiri, W., Nakazawa, M., Yura, Y., 2010. Involvement of the Wnt-beta-catenin pathway in invasion and migration of oral squamous carcinoma cells. Int. J. Oncol. 37 (5). 1095-1103.

Jung, K.W., Won, Y.J., Kong, H.J., Oh, C.M., Lee, D.H., Lee, J.S., 2014. Cancer statistics in Korea: incidence, mortality, survival, and prevalence in 2011. Cancer Res. Treat. 46 (2). 109-123.

Jung, Y.S., Jun, S., Lee, S.H., Sharma, A., Park, J.I., 2015. Wnt2 complements Wnt/beta-catenin signaling in colorectal cancer. Oncotarget.

Kinzler, K.W., Vogelstein, B., 1996. Lessons from hereditary colorectal cancer. Cell 87 (2). 159-170.

Koh, Y.W., Choi, E.C., Kang, S.U., Hwang, H.S., Lee, M.H., Pyun, J., Park, R., Lee, Y., Kim, C.H., 2011. Green tea (-)-epigallocatechin-3-gallate inhibits HGF-induced progression in oral cavity cancer through suppression of HGF/c-Met. J. Nutrition. Biochem. 22 (11), 1074-1083.

Lambert, J.D., Yang, CS., 2003. Mechanisms of cancer prevention by tea constituents. J. Nutrition 133 (10). 3262S-3267S.

Lee, S.H., Koo, B.S., Kim, J.M., Huang, S., Rho, Y.S., Bae, W.J., Kang, H.J., Kim, Y.S., Moon, J.H., Lim, Y.C., 2014. Wnt/beta-catenin signalling maintains self-renewal and tumourigenicity of head and neck squamous cell carcinoma stem-like cells by activating Oct4. J. Pathol. 234 (1). 99-107.

Levina, E., Oren, M., Ben-Ze'ev, A., 2004. Downregulation of beta-catenin by p53 involves changes in the rate of beta-catenin phosphorylation and Axin dynamics. Oncogene 23 (25), 4444-4453.

Lim, Y.C., Cho, K.W., Kwon, H.C., Kang, S.U., Pyun, J.H., Lee, M.H., Hwang, H.S., Kim, J.H., Lee, H.N., Choi, E.C., Kim, C.H., 2010. Growth inhibition and apoptosis with H31 metabolites from marine bacillus SW31 in head and neck cancer cells. Clinic. Exp. Otorhinolaryngol. 3 (4), 217-225.

Lim, Y.C., Park, H.Y., Hwang, H.S., Kang, S.U., Pyun, J.H., Lee, M.H., Choi, E.C., Kim, C.H., 2008. (-)-Epigallocatechin-3 gallare (EGCG) inhibits HGF-induced invasion and metastasis in hypopharyngeal carcinoma cells. Cancer Lett. 271 (1), 140-152.

Liu, J., Stevens, J., Rote, CA, Yost, H.J., Hu, Y., Neufeld, K.L, White, R.L, Matsunami, N., 2001. Siah-1 mediates a novel beta-catenin degradation pathway linking p53 to the adenomatous polyposis coli protein. Molecular Cell 7 (5). 927-936.

Masuda, M., Wakasaki, T., Toh, S., Shimizu, M., Adachi, S., 2011. Chemoprevention of head and neck cancer by green tea extract: EGCG-the role of EGFR signaling and "lipid raft". J. Oncol. 2011. 540148.

Matsuzawa, S., Takayama, S., Ftoesch, BA, Zapata, J.M., Reed, J.C., 1998. p53-inducible human homologue of Drosophila seven in absentia (Siah) inhibits cell growth: suppression by BAG-1. EMBO J. 17 (10). 2736-2747.

Ponti, D., Costa, A., Zaffaroni, N., Pratesi, G., Petrangolini, G., Coradini, D., Pilotti, S., Pierotti, MA, Daidone, M.G., 2005. Isolation and in vitro propagation of tumorigenic breast cancer cells with stem/progenitor cell properties. Cancer Res. 65 (13), 5506-5511.

Santoro, A., Pannone, G., Papagerakis, S., McGuff, H.S., Cafarelli, B., Lepore, S., De Maria, S., Rubini, C., Mattoni, M., Staibano, S., Mezza, E., De Rosa, G., Aquino, G., Losito, S., Loreto, C., Crimi, S., Bufo, P., Lo Muzio, L, 2014. Beta-catenin and epithelial tumors: a study based on 374 oropharyngeal cancers. BioMed Res. Int. 2014. 948264.

Scott, B.C., Butler, J., Halliwell, B., Aruoma, O.I., 1993. Evaluation of the antioxidant actions of ferulic acid and catechins. Free Radical Res. Commun. 19 (4). 241253.

Siegel, R., Ma, J., Zou, Z., Jemal, A., 2014. Cancer statistics, 2014. CA 64 (1), 929.

Takes, R.P., Rinaldo, A., Silver, C.E., Haigentz Jr., M., Woolgar, JA, Triantafyllou, A., Mondin, V., Paccagnella, D., de Bree, R., Shaha, A.R., Hartl, D.M., Ferlito, A., 2012. Distant metastases from head and neck squamous cell carcinoma. Part 1. Basic aspects. Oral Oncol. 48 (9). 775-779.

Watcharasit, P., Bijur, G.N., Zmijewski, J.W., Song, L., Zmijewska, A., Chen, X., Johnson, G.V., Jope, R.S., 2002. Direct, activating interaction between glycogen synthase kinase-3beta and p53 after DNA damage. Proc. Nation. Acad. Sei. USA 99 (12), 7951-7955.

Yang, C.S., Lambert, J.D., Ju, J., Lu, G., Sang, S., 2007. Tea and cancer prevention: molecular mechanisms and human relevance. Toxicol. Appl. Pharmacol. 224 (3), 265-273.

Yang, C.S., Wang, H., Li, GX, Yang, Z., Cuan, F., Jin, H., 2011. Cancer prevention by tea: Evidence from laboratory studies. Pharmacol. Res. 64 (2), 113-122.

Yoo Seob Shin (a,b), (1), Sung Un Kang (a,b), (1), Ju Kyeong Park (a,b) Yang Eun Kim (a,b), Yeon Soo Kim (a), Seung Joon Baek (c), Seong-Ho Lee (d), Chul-Ho Kim (a,b), *

(a) Department of Otolaryngology, School of Medicine

(b) Department of Molecular Science & Technology, Ajou University, Suwon, Korea

(c) Department of Biomedical and Diagnostic Sciences, College of Veterinary Medicine, University of Tennessee, Knoxville

(d) Department of Nutrition and Food Science, College of Agriculture and Natural Resources, University of Maryland, College Park, USA

Abbreviations: HNC, Head and neck cancer: EGCG, (-)-Epigallocatechin-3-gallate; TCF, T cell/lymphoid enhancer factor; DMEM, Dulbecco's modified Eagle's medium; MEM. Minimum essential medium; DMSO. Dimethyl sulfoxide; OD. Optical density: SDS. Sodium dodecyl sulfate; ICC. Immunocytochemisty; FBS, Fetal bovine serum.

* Corresponding authors. Fax: +82 31 219 5264.

E-mail address: ostium@ajou.ac.kr (C.-H. Kim).

(1) These authors contributed equally to the paper as first author.

http://dx.doi.org/10.1016/j.phymed.2016.07.005

----------

Please note: Some tables or figures were omitted from this article.
COPYRIGHT 2016 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Shin, Yoo Seob; Kang, Sung Un; Park, Ju Kyeong; Kim, Yang Eun; Kim, Yeon Soo; Baek, Seung Joon; Lee,
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Geographic Code:9SOUT
Date:Nov 15, 2016
Words:5220
Previous Article:Carnosic acid acts synergistically with gentamicin in killing methicillin-resistant Staphylococcus aureus clinical isolates.
Next Article:Ginkgo biloba L. extract protects against chronic cerebral hypoperfusion by modulating neuroinflammation and the cholinergic system.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters