Printer Friendly

Analysis of genetic diversity in cultivated jute determined by means of SSR markers and AFLP profiling.

AT THE END of the 18th century, Roxburg identified jute (Corchorus spp. 2n = 14) as an alternative to European hemp (Cannabis sativa L.) (Ghosh, 1983, p. 23-47). Jute is comprised of two cultivated species, Corchorus capsularis L. and C. olitorius L. Jute cultivation was initiated about 200 yr ago in localized agro climatic zones in the tropics that had high rainfall and plenty of retting water. The two species are distinct in their growth habitat, branching habit, and characteristics relating to leaf, flower, fruit, seed, bast fiber, and photosensitivity.

Jute is the second most important fiber crop after cotton (Gossypium hirsutum L. and Gossypium arboreum L.) on the Indian subcontinent. The crop has considerable commercial significance for the generation of diversified value-added industrial products, in addition to its immense potential for industrial production of packaging material. However, the crop demands the immediate attention of plant breeders. The available elite cultivars are essentially the products of pure line selection from a few common accessions. It has also been indicated that each of the two jute species contain very limited genetic variability with respect to (i) adaptability to different agronomic environments, (ii) fiber quality, (iii) fiber yield, and (iv) susceptibility to diseases and pests (Lafarge et al., 1997). Additionally, the two cultivated jute species do not cross-fertilize, possibly because of the presence of a strong sexual incompatibility barrier between them (Patel and Datta, 1960; Swaminathan et al., 1961). The Indian Council of Agricultural Research, New Delhi, has maintained more than 1450 C. olitorius and about 830 C. capsularis accessions of the IJO since 1993 (Palit et al., 1996). It is expected that this repository would provide valuable genetic variability that could be utilized by plant breeders.

For any meaningful plant-breeding program, accurate estimates of genetic diversity and partitioning within and between gene pools are important considerations. Estimation of genetic diversity and genetic advance of 192 C. olitorius and 216 C. capsularis accessions of IJO, inclusive of certain induced mutation lines of Indian cultivars has been reported (Palit et al., 1996). The estimation was based on four morpho-physiological attributes that are related to yield characters. Often estimations of genetic variability based on morphological traits have the disadvantages of being influenced by both environmental and genetic factors and may therefore not provide an accurate measure. With the availability of molecular-marker based techniques, the scope for characterization of genetic diversity in jute at the DNA level presents immense opportunities. Recently, random amplified polymorphic DNA (RAPD) analysis has been conducted on certain jute cultivars from Bangladesh (Hossain et al., 2002) of the two species, revealing polymorphism. However, the IJO collection of the jute germplasm has remained untested.

For a comprehensive analysis of a plant population, nuclear as well as chloroplastic and mitochondrial genomes need to be evaluated. In plants, chloroplastic and mitochondrial genomes exhibit different patterns of genetic differentiation compared with nuclear alleles because of their generally uniparental mode of transmission. The chloroplastic genome is highly conserved and has a much lower mutation rate than plant nuclear genomes. Analysis of the chloroplastic genome can provide information on the population dynamics of plants that is complementary to that obtained from the nuclear genomes. Length polymorphism at chloroplast simple sequence repeat (cpSSR) loci has been used as a high-resolution assay system for population, genotyping, and systematic studies (Powell et al., 1995a, 1995b, 1996a; Provan et al., 1996, 1997) and also for tracing the origin of plant species (Ribeiro et al., 2002). Estimation of chloroplastic genomic variability has also been evidenced by cross-species amplification of cpSSR markers (Thomas and Scott, 1993; Provan et al., 1996). On the other hand, amplified fragment length polymorphism (AFLP) is a high multiplex PCR-based system (Vos et al., 1995). It has the potential to generate large numbers of polymorphic loci (Vogel et al., 1994; Powell et al., 1996b) and has been successfully adapted in genetic diversity studies in many plant species including rice (Oryza sativa L.) (Mackill et al., 1996), lettuce (Lactuca biennis L.) (Hill et al., 1996), soybean [Glycine max (L.) Merrill] (Maughan et al., 1996), tea (Camellia sinensis L.) (Paul et al., 1997), barley (Hordeum vulgare L.) (Ellis et al., 1997), Arabidopsis thaliana (L.) Heynh. (Mayashita et al., 1999; Breyne et al., 1999), eggplant (Solanum melongena L.) (Mace et al., 1999), and willows (Salix spp.) (Barker et al., 1999). The two methods of analyses are expected to detect and quantify genetic variations present in two different target genomes of the same biological system where the mechanisms that govern genetic variation are independent of each other. The objective of this study was to evaluate the genetic diversity available in the cultivated species of jute.

MATERIALS AND METHODS

The experimental jute materials of the two species were selected on the basis of diverse geographical locations of their source (Table 1). One cultivar (JRC 212) and 21 wild accessions of C. capsularis, and two cultivars (JRO 632 and Chinsura Green) and 25 wild accessions of C. olitorius were evaluated. All the materials were obtained through the courtesy of the Director, Central Research Institute for Jute and Allied Fibers, Barrackpore, India, from the IJO world collection.

Total genomic DNA of cultivars and accessions was isolated from 7-d-old seedlings, following the protocol of Saghai-Maroof et al. (1984). Genomic DNA was PCR amplified with primers designed from the chloroplast sequence of N. tabacum (Table 2). The SSRs were revealed by means of N. tabacum chloroplast specific primers, and they might reside in either the plastid or nuclear genome. PCR was performed in a total volume of 10 mL containing 50 ng genomic DNA, 1 x PCR buffer, 200 mM dNTPs, 10 pmol [sup.32]P-end labeled forward primer, 10 pmol of reverse primer, and 0.1 unit Taq polymerase. PCR products were electrophoresed for 2 to 4 h at 80 W in 6% (w/v) polyacrylamide gels and visualized by exposure of dried gels to X-ray films. Sequencing reactions of M13 ssDNA were used as molecular-weight standards to determine the exact nucleotide length of the denatured PCR products. This provided the haplotype (a set of genetic determinants located on a single chromosome) determination for individuals (Table 3) by scoring amplified fragments with all sets of primers used in this study. Intense PCR fragments were considered as an actual allele and scored visually with the help of a molecular size marker. Determination of the genetic variation was estimated on the basis of the shared band similarity measurement. Sequencing of the amplified fragments was not done.

The protocol of Zabeau and Vos (1993) with modification was used for the AFLP analyses. The primary template was prepared by simultaneous digestion of genomic DNA with EcoRI and MseI and subsequent ligation of asymmetric quantities of enzyme specific adaptors. Preamplification of digested-ligated DNA was conducted with adaptor specific primers. Selective amplification of diluted preamplified products was done by combination of [gamma]--[sup.33]P end-labeled EcoRI primer and non-radioactive MseI primer. Both the primers used for selective amplification contain more than two additional nucleotides. Selectively amplified products were size-fractionated on 6% polyacrylamide gels for 1.45 h at 80W and visualized by exposure of dried gels to X-ray films. All PCR reactions were run in triplicate and only reproducible and consistent PCR fragments were scored visually as present and absent on the autoradiogram. Ten combinations of selective primers were used for this study (Table 4).

PCR products were scored to create a binary matrix. Diversity values based on phenotype frequency were calculated for individual primer pairs by Nei's (1978) index:

H = 1- [SIGMA] [pi2]

Where pi is the frequency of ith phenotype, phenotype in this case being defined as the PCR profile observed for a specific genotype by means of a single primer pair. A matrix of inter-phenotypic distances for cpSSR on the basis of combined data from all primer pairs was constructed from the shared band similarity measure of Nei and Li (1979).

Cluster analyses based on the similarity matrix were performed by GENSTAT (1987) V5.31 using group average linkage to produce a dendrogram showing the relationships between the accessions studied. Principal coordinate (PCO) analysis was performed by GENSTAT (1987). The similarity matrix was used to perform a hierarchical analysis of molecular variance (AMOVA; Excoffier et al., 1992) essentially as described by Huff et al. (1993) by the ARLEQUIN software (V1.1). The number of permutations for significance testing was set at 100 000 for all analyses.

RESULTS AND DISCUSSION

SSR Analysis

Seven out of eight pairs of primers designed to amplify the SSR loci generated polymorphic products in the jute accessions understudy (Table 5). Two representative autoradiograms show the length variability of PCR fragment with SSR primers (Fig. 1). A total of 18 alleles were detected in 34 accessions studied at seven SSR loci. It was ascertained that in the jute genome, occurrences for SSRs exist and that polymorphic mononucleotide repeat motifs could be found intraspecifically. The SSRs revealed with N. tabacum chloroplast-specific primers might reside in either the plastid or nuclear genome of jute. Insufficient data is available to make this determination.

[FIGURE 1 OMITTED]

Analysis of the distribution of the alleles among the genotypes of the two cultivated species could identify nine haplotypes. Haplotypes A and B have been restricted to C. capsularis alone, whereas the rest of the haplotypes (C-I) have been found in the C. olitorius accessions with C being the most frequent (Table 3). None of the haplotypes could be found to be common between the two species. Thus, the N. tabacum chloroplast markers used in this study turned out to be species specific.

The C. olitorius genotypes have a higher diversity index (H = 0.76 [+ or -] 0.15) compared to the C. capsularis accessions (H = 0.419 [+ or -] 0.32). The dendrogram generated from the DNA variation of the jute accessions using N. tabacum chloroplast-specific primers revealed wide variations between the two cultivated species (Fig. 2). It was confirmed by PCO analysis of genetic diversity values (data not shown), indicating that their maternal origins are different. The C. capsularis genotypes formed two distinct clusters among accessions of Southeast Asian source. The Indian cultivar, JRC 212 and accession MS from Bangladesh are grouped in the same cluster with genotypes from China, Thailand, and Nepal. The C. olitorius genotypes predominantly represented by African origin formed four distinct clusters indicating presence of more diversity than C. capsularis. Interestingly, it was observed that three accessions, KEN/SM/11 from Kenya, TAN/SM/74 from Tanzania, and RG from India, did not group with any other accessions, implying that each of them are genetically distinct from the others. Nested AMOVA was conducted to partition total genetic diversity present at the inter- and intraspecific level (Table 6). Although most of the variation could be ascribed to differences between the species (88.2%), a certain amount of variation could be associated within the location (Table 6). The similarity index among the accessions within one jute species ranged from 0.88 to 1.00. However, when the similarity matrix was compared between the two Indian cultivars, JRO 632 and Chinsura Green, it was observed that they are distantly related (similarity index 0.13). In spite of the fact that the Kenyan and Tanzanian accessions of two adjacent landmasses showed a high degree of similarity between them, two Kenyan accessions (KEN/BL/17 and KEN/DS/35C) revealed divergence from the rest of the accessions of C. olitorius. These two genotypes were collected from the districts of Baringo and Trans Nzoia in Kenya at an altitude of 990 and 1860 m, respectively (Denton, 1988). These altitudes are considered to be too high for jute, as it is usually cultivated near sea level.

[FIGURE 2 OMITTED]

AFLP Analysis

One of the main attractions of the AFLP method is its high multiplex ratio, which means that a large number of amplification products are generated in a single reaction. Moreover, the method is generic and does not depend on the availability of sequence information. It has been therefore considered appropriate for poorly characterized jute germplasms providing a rapid route to genotype rather than phenotypic evaluation.

AFLP analysis of 49 genotypes with 10 primer combinations produced 305 polymorphic products. The primer combination E-ACT/M-GTC generated the highest number of polymorphic bands (80%), whereas the primer combination E-ACA/M-CCCC generated fewer polymorphic bands (16%) between the two species (Table 4). A representative AFLP autoradiogram was developed (Fig. 3).

[FIGURE 3 OMITTED]

On the basis of group average linkage cluster analysis of pair wise genetic distances for all the genotypes studied, it was revealed that the two jute species are widely separated (Fig. 4). This was further confirmed by PCO analysis of genetic diversity values (data not shown). Partitioning of the AFLP variation produced a similar pattern as observed for the SSR data, with most variation being ascribed to between the two species (88.2%).

[FIGURE 4 OMITTED]

Genotypes of a particular geographical location did not form any distinct cluster pattern. MS, a Bangladesh accession, was placed apart from the rest of the accessions of C. capsularis, indicating it to be genetically distinct from the rest. Likewise, Chinese accession CHN/ FJ/69 showed some divergence from the rest of the accessions analyzed. JRC 212, an Indian cultivar has been grouped in a cluster along with accessions from Thailand and China (Fig. 4). The Tanzanian and Kenyan accessions of C. olitorius showed close interrelationships between them. The Tanzanian accessions TAN/Y/187 and TAN/SM/74 have been clustered in the same group with KEN/SM/11, a Kenyan accession. However, two accessions from Kenya, KEN/BL/17 and KEN/DS/35C, formed a separate duster, quite distant from the other C. olitorius members (Fig. 4). The Indian cultivar JRO 632 remained separated from the Kenyan and Tanzanian accessions, while the other Indian strain CG has been grouped with SG, an accession from Sudan. The similarity matrices based on Nei and Li's (1979) estimation were utilized to estimate the intraspecific relationship between the accessions of the two jute species. AFLP data revealed that the similarity index within C. capsularis genotypes varied from 0.89 (between MS and NPL/KUC/32; MS and THA/Y/129) and 0.99 (between CHN/FJ/30 and CHN/ZC/5; PI/404029 and CHN/C/227). Among the genotypes of C. olitorius, the similarity index ranged from 0.86 (between KEN/BL/17 and TAN/X/84C, KEN/DS/ 65C, JRO 632) to 0.99 (between TAN/X/22C and TAN/ X/84C). The similarity matrix revealed 89 to 99% similarity within C. capsularis and 86 to 99% within C. olitorius genotypes of diverse geographical locations. The data also indicated MS and KEN/BL/17 are the most closely related genotypes between the species (similarity index 0.46). It is apparent that the accessions representing the two jute species contained fairly low genetic diversity at the intraspecific level.

The present study revealed that the two jute species are distantly related. Presence of distinct patterns of diversity between the two species was also reported by Palit et al. (1996). Moreover, differences in geographical location of sources did not affect genetic diversity as reported also by Palit et al. (1996) in their work. Our results thus provide support to the earlier belief (Kundu, 1951) that the two species originated from two different geographical locations: C. capsularis originated from the Indo-Burma region and C. olitorius from Africa. On the basis of our findings, it is inferred that the two species are allopatric, sharing certain common alleles.

It has been further observed that some of the wild jute accessions of the two species in spite of containing diverse morphological characters, indeed originated from a very closely related common ancestor. Intraspecific genetic variability present among the accessions studied within each species was found to be low. Additional search for genotypes of interest from the remaining accessions of the IJO stock is needed. It should also be kept in mind that marker-based genomic analyses do not adequately indicate the full picture of the genetic variability present in the expressed portions of the crop genome. Nevertheless, it is significant that certain diverse genotypes, such as CHN/FJ/69 in C. capsularis and RG, KEN/BL/17, and KEN/DS/35C in C. olitorius exist in the gene pool. A major striking finding is that of RG, an Indian accession of C. olitorius, is the most diverse genotype. Such genotypes may turn out to be interesting genetic materials for their use in future breeding programs.

A major difficulty in the use of genetic variability that is present between the two species stems from their sexual isolation. Attempts to break the sexual barrier for genetic introgression by technologies as somatic hybridization (Saha et al., 2001), chromosome doubling, and embryo rescue and then by searching for suitable homologous recombination in the hybrid plants may bear fruit. Alternatively, transfer of genes of interest from genetic resource collections by genetic transformation techniques (Ghosh et al., 2002) may provide new ways to generate desired plant types with suitable agronomic traits.
Table 1. Jute accessions subjected to SSR and AFLP analyses to
determine genetic diversity.

C. capsularis genotypes              Status       Source
                                   ([dagger])

JRC 212                                C        India
Maniksari (MS) ([double dagger])       NC       Bangladesh
Tripura capsularis (TC)                NC       India
THA/Y/119                              NC       Thailand
CHN/ZC/5                               NC       China
CHN/FJ/23                              NC       China
THA/Y/129                              NC       Thailand
THA/YA/18                              NC       Thailand
THA/YA/53                              NC       Thailand
THA/Y/83                               NC       Thailand
THA/Y/117                              NC       Thailand
NPL/KUC/32                             NC       Nepal
CHN/C/227                              NC       China
CHN/ZC/3                               NC       China
PI 404029                              NC       America
CHN/FJ/16                              NC       China
CHN/FJ/24                              NC       China
CHN/FJ/30                              NC       China
CHN/FJ/39                              NC       China
CHN/FJ/58                              NC       China
CHN/FJ/69                              NC       China
PARC/2654                              NC       Pakistan

C. olitorius genotypes               Status     Source
                                   ([dagger])

JRO632                                 C        India
Chinsura Green (CG)                    C        India
Sudan Red (SR)                         NC       Sudan
Red Glossy Seed (RG)                   NC       India
Sudan Green (SG)                       NC       Sudan
TAN/NY/96                              NC       Tanzania
TAN/Y/187                              NC       Tanzania
KEN/SM/11                              NC       Kenya
KEN/DS/30                              NC       Kenya
TAN/SM/74                              NC       Tanzania
TAN/SM/46                              NC       Tanzania
KEN/BL/61                              NC       Kenya
TAN/X/77                               NC       Tanzania
KEN/BL/17                              NC       Kenya
KEN/DS/67                              NC       Kenya
KEN/DS/15C                             NC       Kenya
KEN/DS/38C                             NC       Kenya
KEN/DS/41C                             NC       Kenya
KEN/DS/58C                             NC       Kenya
KEN/DS/65C                             NC       Kenya
KEN/DS/69C                             NC       Kenya
KEN/DS/35C                             NC       Kenya
TAN/NY/235C                            NC       Tanzania
TAN/X/22C                              NC       Tanzania
TAN/X/84C                              NC       Tanzania
TAN/X/94C                              NC       Tanzania
TAN/X/125C                             NC       Tanzania

([dagger]) C, cultivars; NC, noncultivars.

([double dagger]) Abbreviations used in Fig. 4 to identify indicated
genotype.

Table 2. SSR primers from Nicotiana tabacum chloroplasts used
in PCR amplification of genomic DNA from jute cultivars
and accessions.

Locus     Sense primer             Antisense primer

NTCP 8    atattgttttagctcggtgg     tcattcggctcctttatg
NTCP 9    cttccaagctaacgatgc       ctgtcctatccattagacaatg
NTCP 10   tgctgaatcgacgaccta       aatattcggaggactcttctg
NTCP 12   tggtttgggtcgtgtatc       ccattttaggattccatttc
NTCP 28   tccaatggctttggcta        agaaacgaaggaacccac
NTCP 29   agtcggttgattagggtaaaat   aaagccctttcgttagaagtaa
NTCP 37   ttccgaggtgtgaagtgg       caggatgataaaaagcttaacac
NTCP 40   taatttgattcttcgtcgc      gatgtagccaagtggatca

Table 3. Haplotypes of jute accessions used in SSR study to determine
genetic diversity.

C. capsularis genotypes   Haplotype

JRC 212                       A
Maniksari (MS)                A
Tripura capsularis (TC)       B
THA/Y/119                     A
CHN/ZC/5                      B
THA/Y/129                     B
THA/YA/18                     A
THA/YA/53                     A
THA/Y/83                      B
THA/Y/117                     A
NPL/KUC/32                    A
CHN/C/227                     A
PI/404029                     A
CHN/FJ/24                     A
CHN/FJ/30                     A

C. olitorius genotypes    Haplotype

JRO632                        C
Sudan Red (SR)                E
Red Glossy Seed (RG)          I
Sudan Green (SG)              G
TAN/NY/96                     C
TAN/Y/187                     F
KEN/SM/11                     D
KEN/DS/30                     C
TAN/SM/74                     H
TAN/SM/46                     C
KEN/BL/61                     E
TAN/X/77                      C
KEN/BL/17                     G
KEN/DS/38C                    C
KEN/DS/41C                    F
KEN/DS/58C                    E
KEN/DS/69C                    C
KEN/DS/35C                    C
TAN/NY/235C                   C

([dagger]) Haplotypes A to I signify nine distinct combinations of SSRs
visualized from genomic DNA with Nicotiana lobacum chloroplast genome
specific primers.

Table 4. Distribution of AFLP within jute accessions using 10
combinations of selective primers to evaluate genetic diversity.

Primer combination   Total bands   Polymorphic bands

                       number              %

E-ACT/M-ACGG             44               45
E-ACT/M-CCCC             41               70
E-ACT/M-AAC              37               21
E-ACA/M-CCCC             38               16
E-ACA/M-ACG              25               60
E-TGC/M-ACGG             26               73
E-ACT/M-GTC              30               80
E-ACT/M-AGA              33               63
E-ACG/M-ACGG             16               44
E-ACA/M-ACGG             15               73

Table 5. Haplotypes of jute accessions based on Nicotiana tabaccum
chloroplast SSRs.

                   SSR allele sizes (bp)

Haplotypes   NTCP29   NTCP28   NTCP10   NTCP8

A             128      180      175      288
B             127      180      175      288
C             123      169      174      288
D             128      169      174      288
E             123      169      174      288
F             127      169      174      288
G             126      169      174      288
H             126      169      174      288
I             128      169      174      288

                   SSR allele sizes (bp)

Haplotypes   NTCP9    NTCP40   NTCP37   NTCP12

A             210      134      126      169
B             210      134      126      169
C             270      143      127      192
D             270      143      127      192
E             270      144      127      192
F             270      144      127      192
G             270      144      127      192
H             270      143      127      192
I             270      144      127      192

Table 6. Nested AMOVA of the jute genotypes using SSR markers
and AFLP profiling to determine genetic diversity.

Marker       Source of           Sum of    Variance     Percent of
system       variation      df  squares  components  total variation

cpSSR     between species    1  617.36    38.10 *         88.2
        Between location
          within species     5   18.44    -0.42 (NS)      -0.98
          within location   26  143.11     5.50 **        12.7

AFLP      between species    1  647.95    27.10 *         88.2
        Between location
          within species     5   32.13     0.54 **         1.7
          within location   41  126.50     3.09 *         10.0

* Significant at the 0.05 probability level.

** Significant at the 0.01 probability level.


ACKNOWLEDGMENTS

Thanks are due to the Director, Central Research Institute for Jute and Allied Fibers, ICAR, Barrackpore, India, for the supply of IJO jute germplasms and for technical information made available by Drs. A. Saha and S.K. Hazra of CRIJAF. Financial grant support to SKS from the UNDP (project #IND/ 92/325) is also acknowledged herewith.

Abbreviations: AFLP, amplified fragment length polymorphism: cpSSR, chloroplast simple sequence repeat; IJO, International Jute Organization, Dhaka, Bangladesh; JRC, Jute Research Capsularis; JRO, Jute Research Olitorius; PCR, polymerase chain reaction.

REFERENCES

Barker, J.H., M. Matthews, G.M. Arnold, K.I. Edwards, K.I. Ahman, S. Larsson, and A. Karp. 1999. Characterization of genetic diversity in potential biomass willows (Salix spp.) by RAPD and AFLP analyses. Genome 42:173-183.

Breyne, P., D. Rombaut, A. Van Gysel, M. Van Montagu, and T. Gerats. 1999. AFLP analysis of genetic diversity within and between Arabidopsis thaliana ecotypes. Mol. Gen. Genet. 261:627-634.

Denton, I.R. (ed.) 1988. Germplasm collection in East Africa, Mission II. International Jute Organisation, Bangladesh Publication, Dhaka.

Ellis, R.P., J.W. McNicol, E. Baird, A. Booth, P. Lawrence, B. Thomas, and W. Powell. 1997. The use of AFLPs to examine genetic relatedness in barley. Mol. Breed. 3:359-369.

Excoffier, L., P.E. Samuse, and J.M. Quattro. 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics 131:479-491.

GENSTAT 5.0 Committee. 1987. GENSTAT 5.0 reference manual. Clarendon Press, Oxford, England.

Ghosh, T. 1983. Handbook on jute. FAD Publication, Rome.

Ghosh, M., T. Saha, P. Nayak, and S.K. Sen. 2002. Genetic transformation by particle bombardment of cultivated jute, Corchorus capsularis L. Plant Cell Rep. 20:936-942.

Hili, M., H. Witsenborer, M. Zabeau, P. Vos, R. Kesseli, and R. Michelmore. 1996. PCR- based fingerprinting using AFLPs as a tool for studying genetic relationships in Lactuca sp. Theor. Appl. Genet. 93:1202-1210.

Hossain, M.B., S. Haque, and H. Khan. 2002. DNA fingerprinting of jute germplasm by RAPD. J. Biochem. Mol. Biol. 35(4):414-419.

Huff, D.R., R. Peakall, and P.E. Smouse. 1993. RAPD variation within and among natural population of outcrossing buffalo grass (Buchloe dactyloides (Nutt.) Engelm). Theor. Appl. Genet. 86:927-934.

Kundu, B.C. 1951. Origin of jute. Indian J. Genet. Plant Breed. 11: 95-99.

La Farge, T., S.T. Friedman, and C.G. Cock. 1997. Improvement of fiber crops using genetics and biotechnology, p. 39-59. In R.M. Powell et al. (ed.) Paper and composites from agro-based resources. CRC Lewis Publishers, Boca Raton, FL.

Mace, E.S., R.N. Lester, and C.G. Gebhardt. 1999. AFLP analysis of genetic relationship among the cultivated eggplant, Solanum melongena L., and wild relatives (Solanaceae). Theor. Appl. Genet. 99:626-633.

Mackill, D.J., Z. Zhang, E.D. Redona, and P.M. Colowit. 1996. Level of polymorphism and genetic mapping of AFLP markers in rice. Genome 39:969-977.

Maughan, P.J., M.A. Saghai-Maroof, G.R. Buss, and G.M. Huestis. 1996. Amplified fragment length polymorphism (AFLP) in soybean: Species diversity inheritance and near isogenic line analysis. Theor. Appl. Genet. 93:392-401.

Mayashita, N.T., A. Kawabe, and H. Innan. 1999. DNA variation in the wild plant Arabidopsis thaliana by amplified fragment length polymorphism analysis. Genetics 152:1723-1731.

Nei, M. 1978. Estimation of average heterozygosity and genetic distances from a small number of individuals. Genetics 89:583-590.

Nei, M., and W.H. Li. 1979. Mathematical modeling for studying genetic variation in terms of restriction endonuclease. Proc. Natl. Acad. Sci. (USA) 74:5269-5273.

Palit, P., B.C. Sasmal, and A.C. Bhattacharryya. 1996. Germplasm diversity and estimate of genetic advance of four morpho-physiological traits in a world collection of jute. Euphytica 90:49-58.

Patel, G.I., and R.M. Datta. 1960. Interspecific hybridization between Corchorus olitorius and C. capsulris and the cytogenetical basis of incompatibility between them. Euphytica 9:89-110.

Paul, S., F.N. Wachira, W. Powell, and R. Wough. 1997. Diversity and genetic differentiation among population of Indian and Kenyan tea (Camellia sinensis L.) revealed by AFLP markers. Theor. Appl. Genet. 94:255-263.

Powell, W., G. Machray, and J. Provan. 1996a. Polymorphism revealed by simple sequence repeats. Trends Plant Sci. 1:215-222.

Powell, W., M. Morganate, C. Andre, M. Hanafey, M.I. Vogel, S.V. Tingey, and J.A. Rafalski. 1996b. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol. Breed. 2:225-238.

Powell, W., M. Morganate, C. Andre, J.W. McNicol, G.C. Machray, J.J. Doyle, S.V. Tingey, and J.A. Rafalski. 1995a. Hypervariable microsatellites provide a general source of polymorphic DNA markers for the chloroplast genome. Curr. Biol. 5:1023-1029.

Powell, W., M. Morganate, R. McDevitt, G.G. Vendranin, and J.A. Rafalski. 1995b. Polymorphic simple sequence repeats regions in chloroplast genomes: Application to the population genetics of pines. Proc. Natl. Acad. Sci. (USA) 92:7759-7763.

Provan, I., G. Corbett, J.W. McNicoll, and W. Powell. 1997. Chloroplast variability in wild and cultivated rice (Oryza spp.) revealed by polymorphic simple sequence repeats. Genome 40:104-110.

Provan, I., G. Corbett, R. Waugh, J.W. McNicol, M. Morganate, and W. Powell. 1996. DNA fingerprints of rice (Oryza sativa) obtained from hypervariable chloroplast simple sequence repeats. Proc. R. Soc. London 263:1275-1281.

Ribeiro, M.M., S. Mariette, G.G. Vendramin, A.E. Szmidt, C. Plomion, and A. Kremer. 2002. Comparison of genetic diversity estimates within and among populations of maritime pine using chloroplast simple-sequence repeats and amplified fragment length polymorphism data. Mol. Ecol. 11(5):869-877.

Saghai-Maroof, M.A., K.M. Soliman, R.A. Iorgensen, and R.W. Allard. 1984. Ribosomal DNA spacer length polymorphism in barley: Mendelian inheritance, chromosomal location and population dynamics. Proc. Natl. Acad. Sci. (USA) 81:8014-8018.

Saha, T., S. Majumdar, N.S. Banerjee, and S.K. Sen. 2001. Development of interspecific somatic hybrid cell lines in cultivated jute and their early characterization using jute chloroplast RFLP marker. Plant Breed. 120:439-44.

Swaminathan, M.S., R.D. Iyer, and K. Sulbha. 1961. Morphology, cytology and breeding behavior of hybrids between Corchorus olitorius and C. capsularis. Curr. Sci. 30:67-68.

Thomas, M.R., and N.S. Scott. 1993. Microsatellite repeats in grapevine reveal DNA polymorphism when analyzed as sequence tagged sites. Theor. Appl. Genet. 86:985-990.

Vogel, I.M., W. Powell, A. Rafalski, M. Morganate, I.D. Tudo, G. Taramino, P. Biddle, M. Hanafey, and S.V. Tingey. 1994. Application of genetic diagnosis to plant genome analysis: Comparison of marker systems. Appl. Biotechnol. Tree Cult. 1: 119-124.

Vos, P., R. Hogers, M. Blecker, M. Reijans, T.V.D. Lee, M. Homes, A. Frijters, L. Pot, I. Peleman, M. Kuiper, and M. Zabeau. 1995. AFLP: A new technique for DNA fingerprinting. Nucleic Acid Res. 23: 4407-4414.

Zabeau, M., and P. Vos. 1993. Selective restriction fragment amplification. A general method for DNA fingerprinting. European patent application no. 924026297. Publication no. 0534858.

A. Basu, M. Ghosh, R. Meyer, W. Powell, S. L. Basak, and S. K. Sen *

A. Bash, M. Ghosh, S.L. Basak, and S.K. Sen, IIT-BREF-Biotek, Indian Institute of Technology, Kharagpur-721 302, India; R. Meyer and W. Powell, Division of Genetics, Scottish Crop Research Institute, Dundee DD2 SDA Scotland, UK. Joint contribution of the SCRI and IIT-BREF-Biotek. Journal no. (202-348. Received 30 Sep. 2002. * Corresponding author (sk_sen55@yahoo.co.in).
COPYRIGHT 2004 Crop Science Society of America
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2004 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Plant Genetic Resources
Author:Basu, A.; Ghosh, M.; Meyer, R.; Powell, W.; Basak, S.L.; Sen, S.K.
Publication:Crop Science
Date:Mar 1, 2004
Words:4861
Previous Article:Evaluation and classification of leaflet shape and size in wild soybean.
Next Article:Registration of 'Hamria' lentil.

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |