Printer Friendly

Analysis of cyanine dye-labeled PCR product and restriction fragments by capillary electrophoresis and laser-induced fluorescence.

Capillary gel electrophoresis (CGE) has been used for analysis of double-stranded DNA, including products of PCR [1-5]. Compared with conventional methods, CGE analysis offers higher resolution and better reproducibility and is capable of direct quantification and automation. CGE coupled with laser-induced fluorescence (LIF) system can detect as few as six molecules of stained DNA [6]. Meanwhile, the most popular CGE/LIF detection involves the use of fluorescent DNA intercalating dyes, including ethidium bromide, YO-PRO3, and SYBR Green I [7]. However, efficient separations are obtained only over a narrow range of DNA--dye ratios [8]. In some cases, broad peaks may result from the presence of multiple dye--DNA binding. Fluorescent DNA derivatives obtained by covalent binding of DNA with fluorescent dye is more stable and may be more suitable for CGE/LIF analysis. Previously, an activated cyanine dye (Cy-5), which can be readily coupled with peptide, proteins, and amino-linked oligonucleotides [9], was synthesized. The dye contains two broad absorption maxima at 630 and 655 nm with a very high absorptivity and fluorescence quantum yield. Cy-5-labled molecules are suitable subjects for LIF detection with a semiconductor laser source emitting at 653 nm. Chen et al. have reported synthesis and CE/LIF detection of a Cy-5-conjugated [M.sub.13] primer [10]. It thus follows that fluorescent PCR products could be obtained if the primers used were first conjugated with Cy-5 dye. In this report, molecular diagnosis of a mitochondrial DNA genetic disease, MELAS (myopathy, encephalopathy with lactic acidosis and stroke-like episodes) [11,12], was used as a model for investigating the feasibility of CGE/LIF analysis of Cy-5-labeled PCR product and its restriction fragments.

[FIGURE 1 OMITTED]

A P/ACE 5500 CE equipped with a 2.5 mW diode laser emitting at 652 nm and a LIF detector (Beckman Instruments) was used for the CE runs. Capillary columns, typically of 27 cm length (20 cm to detector window) X 50 [micro]m i.d., were assembled in the P/ACE cartridge format. The columns were silaned with [gamma]-methacrylopropyltrimethoxysilane (Sigma) for 2 h and coated with 2% polyacrylamide for 1 h as described by Figeys et. al [4]. The cathode was set on the injection side. Before each separation step, the coated column was filled with replaceable gel buffer [4% linear polyacrylamide in TB buffer (0.1 mol/L Tris, 0.25 mol/L borate, pH 8.3)] by high-pressure [103.4 kPa (15 psi)] rinsing for 3 min. Electrophoresis was performed with TB buffer at a field strength of 500 V/cm. Postrun data analysis was performed with System Gold [TM] (version 8.0) software (Beckman Instruments).

The PCR primers used for amplfying the 739 bp mitochondrial DNA sequence encompassing the MELAS-3243 mutation site were selected with Oligo 40-S software (a multifunctional program for selecting appropriate oligonucleotides for DNA amplification). The primer sequences were: (forward) 5'-(2715)AGACGAGAAGA000TATGGA(2734)-3' and (reverse) 5'-(3473)AAGAGTTTTATGGCGTCAGC(3493)-3'. The primers were synthesized with a hexylamino terminus at its 5' end by Applied Biosystems. Both 5'-amino-linked forward and reverse primers (30 nmol each) dissolved in 300 [micro]L of 100 mmol/L [Na.sub.2]C[O.sub.3] (pH 9.5) were added to the Cy-5 dye vial from Amersham and allowed to stand at room temperature for 60 min. Fifty microliters of the conjugation mixture was loaded on a G-25 spin column and centrifuged at 1000g for 1 min to obtain purified Cy-5-labeled primer. All the conjugation and purification steps were monitored by CGE/LIF. The samples were hydrodynamically injected for 2 s under low pressure [3.45 kPa (0.5 psi)]. As demonstrated in Fig. 1A, in the conjugation mixture, the Cy-5-labeled primers migrate in front of Cy-5 diacid, which is a hydrolyzed product of Cy-5 in an alkaline condition [10]. After G25 spin column purification, Cy-5 diacid was almost completely absorbed, while the labeled primer was all spun down without a decrease of concentration (Fig. 1B). Less than one microliter of the purified, labeled primer mixture was enough for a PCR reaction.

MELAS disease has been characterized by a major point mutation (A to G at 3243) in mitochondrial DNA. An ApaI restriction digestion site is generated at the site of mutation [12]. Muscle DNA extracted from a MELAS patient with Puregene DNA purification kit (Gentra) was used as a positive control. The sequence encompassing the MELAS mutation site was PCR-amplified with the Cy-5-labeled primer mixture according to the conditions described by Goto et al. [12] to generate a 739-bp PCR product. The MELAS-specific PCR product can be digested by ApaI into 211- and 528-bp restriction fragments. The size of the DNA fragments were verified by 2% agarose gel electrophoresis with [phi]X174 as the size marker (data not shown). For CGE/LIF analysis, the undiluted PCR-amplified mixture was hydrodynamically injected for 60 s with a prior injection of 0.1 mol/L Tris acetate (pH 8.3), which may improve peak resolution as described by Van der Schan et al. [13]. As demonstrated in Fig. 1C, the PCR product was detected at 7.2 min. After ApaI digestion, the two restriction fragments appeared at 5.7 min and 6.9 min and were well separated from the undigested PCR product (Fig. 1D). The relative migration times (RMTs) of the PCR product and its restriction fragments with respect to the fastest moving primer (as indicated in the parentheses) are highly reproducible. The intraday and interday precisions for the RMT of each peak, expressed as CV (n = 5), were <0.08% and 0.12%, respectively.

The concentrations of the PCR products were determined by the peak heights expressed as relative fluorescence units (RFUs) on the CGE/LIF electropherogram based on the calibration factor generated from serial dilutions of the PCR product with known concentration determined by a DNA concentrator (DyNA Quant 200 from Hoefer). To do this, MELAS PCR mixture with no excess primer was obtained by performing 45 thermal cycles. Serial 10-fold dilutions of such pure MELAS PCR product were analyzed by CGE/LIF. The peak height of each fragment was plotted against the concentration of the PCR product over the range of 5 ng/L to 50 [micro]g/L, within which a linear relation was obtained (data not shown). As each PCR product contains two Cy-5 molecules (conjugated with the forward and reverse primers), the fluorescence intensity of the Cy-5-labeled PCR product is in proportion to its molar concentration. The limit of detection of the 739-bp PCR product was ~3 ng/L (equal to 500 fmol/L) determined at 4:1 signal-to-noise ratio.

CGE/LIF detection of fluorescent PCR product derived from Cy-5-labeld primer is highly specific and reproducible. Apart from its application in the area of molecular diagnosis, this methodology has great potential in many areas such as gene expression and gene mutation studies.

This work was sponsored by Kaohsiung Medical College and the Department of Health, Executive Yuan (DOH 85-MA-006). We thank C.-W. Lion for providing the muscle biopsy of the MELAS patient and Ming-Sun Liu for helpful discussion.

References

[1.] Lu W, Han DS, Yuan J, Andrieu J-M. Multi-target PCR analysis by capillary electrophoresis and laser-induced fluorescence. Nature 1994;368:269-71.

[2.] Heiger DN, Cohen AS, Karger BL. Separation of DNA restriction fragments by high performance capillary electrophoresis with low and zero cross linked polyacrylamide using continuous and pulsed electric fields. J Chromatogr 1990;516:33-48.

[3.] Sudor J, Novotony MV. Separation of large DNA fragments by capillary electrophoresis under pulsed-field conditions. Anal Chem 1994;66:2446-50.

[4.] Figeys D, Arriaga E, Renborg A, Dovichi NJ. Use of the fluorescent intercalating dye POPO-3, YOYO-1 for ultrasensitive detection of double strand DNA separated by capillary electrophoresis with hydroxypropylmethyl cellulose and non-cross-linked polyacrylamide. J Chromatogr A 1994;669:205-16.

[5.] Arakawa H, Uetanaka K, Maeda M, Tsuji A, Matsubura Y, Narisawas K. Analysis of polymerase chain reaction product by capillary electrophoresis with laser-induced fluorescence detection and its application to the diagnosis of medium-chain acyl-coenzyme A dehydrogenase deficiency. J Chromatogr A 1994;680:517-25.

[6.] Chen D, Adelheim K, Cheng XL, Dovichi NY. A simple laser-induced fluorescence detector for sulforhodamine 101 in a capillary electrophoresis system: detection limit of 10 yoctomoles or six molecules. Analyst 1994;119:349-52.

[7.] Skeidsvol J, Ueland PM. Analysis of double stranded DNA by capillary electrophoresis with laser-induced fluorescence detection using the monomeric dye SYBR Green I. Anal Biochem 1995;231:359-65.

[8.] Zhu H, Clark SM, Benson SC, Rye HS, Glazer AZ, Mathies RA. High-sensitivity capillary electrophoresis of double stranded DNA fragments using monomeric and dimeric intercalating dyes. Anal Chem 1994;66:1941-8.

[9.] Mujumdar RB, Ernst LA, Mujumdar SR, Lewis CJ, Waggoner AS. Cyanine dye labeling reagents: sulfoindocyanine, succinimidyl esters. Bioconjug Chem 1992;4:105-11.

[10.] Chen Fu-Tai A, Tusak A, Pentoney S Jr, Konrad K, Lew C, Kon E, Sternberg J. Semicoductor laser-induced fluoresence detection in capillary electrophoresis using a cyanine dye. J Chromatogr A 1993;652:355-60.

[11.] Pavlakis SG, Phillips PC, Di Mauro S, De Vivo DC, Rowland LP. Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS): a distinctive clinical syndrome. Ann Neurol 1984;16:481-8.

[12.] Goto Y-J, Nonka I, Horal S. A mutation in the [tRNA.sup.LEU(UUR)] gene association with the MELAS subgroup of mitochondrial encephalomyopathies. Nature 1990;348:651-3.

[13.] Van der Schan MJ, Allen JK, Wanders BJ, Guttman A. Effect of sample matrix and injection plug on ds DNA migration in capillary gel electrophoresis. J Chromatogr A 1994;680:511-6.

Wen-Shen Wu and Jin-Lian Tsai * Poison Control and Analysis Center and Graduate Institute of Occupational Safety and Health, Kaohsiung Medical College, Kaohsiung 80708, Taiwan R.O.C.; * address for correspondence: Graduate Institute of Occupational Safty and Health, Kaohsiung Medical College, No.100 Shih-Chuan 1st Rd., Kaohsiung City 80708, Taiwan, Republic of China; fax 07-3162632, e-mail jilits@cc.kmc.edu.tw
COPYRIGHT 1997 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 1997 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Technical Briefs
Author:Wu, Wen-Shen; Tsai, Jin-Lian
Publication:Clinical Chemistry
Date:Sep 1, 1997
Words:1639
Previous Article:Automated on-line hydrolysis of benzodiazepines improves sensitivity of urine screening by a homogeneous enzyme immunoassay.
Next Article:Simple method to evaluate specificity of osteocalcin immunoassays.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters