Printer Friendly

Analisis de expresion genica durante la respuesta de defensa de la yuca a la bacteriosis vascular (anublo bacteriano).

Gene expression analysis during cassava defense response to bacterial blight disease

RESUMEN

La bacteriosis vascular de la yuca es una destructiva enfermedad en Sur America y Africa, causada por la bacteria Xanthomonas axonopodis pv. manihotis (Xam). Produce perdidas entre el 12% y 100% de los cultivos. Algunos estudios se han realizado a nivel bioquimico y citoquimico para conocer las respuestas de defensa de la yuca a Xam; sin embargo, las bases moleculares de los mecanismos de defensa no han sido aun caracterizadas. Con el proposito de identificar genes diferencialmente expresados durante la respuesta de la planta al patogeno, se ha construido una libreria sustractiva, usando el metodo de Sustraccion Diferencial en Cadena (DSC), con 1536 clones de dos variedades resistentes (MBRA 685 y SG 107-35). De esta libreria fueron seleccionados al azar 110 clones para ser secuenciados y realizar busquedas de similitud en bases de datos publicas. El analisis de secuencia mostro 14 clones con similitud a genes previamente reportados como involucrados en procesos de defensa en plantas, 70 clones con similitud a genes de plantas sin funcion conocida o que no presentaron similitud, representando nuevos genes potencialmente involucrados en las respuestas de defensa de la yuca. Finalmente fueron construidos microarreglos de ADNc, usando los clones seleccionados de las librerias sustractivas para confirmar su expresion diferencial durante el desarrollo de la infeccion.

Palabras clave: yuca, anublo bacteriano, identificacion de genes, librerias sustractivas, microarreglos.

ABSTRACT

Cassava bacterial blight (CBB) caused by Xanthomonas axonopodis pv. manihotis (Xam) is a destructive disease in the South America and Africa and yield losses range between 12 and 100%. Cytochemistry and biochemistry of defense response to CBB have been well studied. However, the response of the plant to pathogen attack at the molecular and cellular level remains uncharacterized. Identification of genes associated with defense responses is one of most critical steps leading to the elucidation of disease resistance mechanisms in cassava. In this study, we identified differentially expressed genes during pathogen attack by subtractive hybridization, using the Differential Subtraction Chain method (DSC). A population of cDNA obtained from infected plants was used as "treatment" and a population of cDNA obtained from healthy plants was used as "control". 1536 clones were isolated from the resistant varieties (MBRA 685 and SG 107-35). Of these, 110 randomly selected clones were sequenced and a homology search was conducted. The sequence analysis showed that 14 cDNA clones shared homology with plant genes involved in defense responses, 70 clones were either homologous to plant genes of unknown function or showed no homology, representing new genes potentially involved in cassava defense responses. A cDNA microarray was constructed by spotting the clones identified from our subtractive libraries. Other clones potentially involved in cassava defense responses were also included. The cassava defense cDNA microarray was used to confirm the differential expression of the clones.

Keywords: cassava, bacterial blight, gene expression, subtractive library, microarrays.

INTRODUCCION

La yuca (Manihot esculenta Crantz) es la especie productora de carbohidratos mas eficiente por unidad de area en el tropico. Es el cuarto producto basico mas importante en el mundo y hace parte de la dieta de mas de 1000 millones de personas. La bacteriosis vascular de la yuca es considerada una de las enfermedades mas limitantes para la producci on de yuca en el tropico, las perdidas del cultivo oscilan entre 12% y 100% (Lozano, 1986). Algunos trabajos han sido desarrollados con el animo de caracterizar citoquimica y bioquimicamente la interaccion con el agente etiologico Xanthomonas axonopodis pv. manihotis (Xam) (Boher et al., 1997; Kpemoua et al., 1996), identificar las variedades resistentes y susceptibles a las diferentes cepas del patogeno (Restrepo et al., 2000) y medir su diversidad genetica y diferenciaci on geografica (Restrepo and Verdier, 1997), entre otros. Sin embargo, los genes que gobiernan las respuestas de defensa en contra del ataque del patogeno no han sido aun identificados.

Muchos detalles de los procesos de interacci on planta-patogeno son conocidos (Baker et al., 1997). Una vez la planta y el patogeno entran en contacto, el organismo hospedero activa una serie de respuestas de defensa. Son inducidas diferentes vias de senalizacion, entre ellas las mediadas por Intermediarios con Oxigeno Reactivo (ROS), acido salicilico, oxido nitrico, etileno y acido jasmonico. Tambien es activada la expresion de genes Relacionados con Patogenicidad (PR) y la sintesis de compuestos antimicrobianos que son generalmente fitoalexinas, defensinas, compuestos fenolicos y flavonoides producidos para atacar directamente al patogeno (Baker et al., 1997). La activaci on de todas estas vias de senalizacion termina en la induccion de la Respuesta Hipersensible (HR), una muerte celular programada localizada en el sitio del ataque, con el fin de impedir la dispersion del patogeno, y la Respuesta Sistemica Adquirida (SAR) mediada por el acido salicilico, que distribuye la resistencia a todos los organos de la planta (Hammond-Kosack and Jones, 1996). En yuca no han sido aun caracterizadas las vias de respuesta a sus diferentes patogenos.

Utilizando innovadoras herramientas de gen omica funcional se ha avanzado en el entendimiento de la biologia molecular en los procesos de resistencia a enfermedades y condiciones de estres en general. Con la aplicacion de estas herramientas, tales como la construccion de librerias sustractivas y la tecnologia de microarreglos, se pueden realizar analisis globales de expresion de cientos o miles de genes bajo condiciones ambientales y fisiologicas espec ificas; por ejemplo identificar genes involucrados en las respuestas de defensa en contra del ataque de patogenos. En el caso particular de la yuca, la aplicacion de genomica funcional en el estudio de su interaccion con Xam podra contribuir en la solucion de un problema que le resta interes al cultivo y lo hace menos rentable en comparacion con otros productores de carbohidratos.

En este trabajo se han utilizado herramientas de la genomica funcional: construccion de librerias sustractivas y microarreglos de ADN, a fin de identificar genes expresados en las respuestas de la yuca para defenderse del ataque de Xam.

MATERIALES Y METODOS

Inoculacion de dos variedades resistentes de yuca con Xanthomonas axonopodis pv. manihotis

Las estacas de plantas de las dos variedades resistentes a la cepa de Xam (CIO-151) SG 107-35 y MBRA 685 (Restrepo et al., 2002) mantenidas en campo fueron sembradas en bolsas de plastico perforadas de 6 cm x 7 cm. con una proporcion de tierra:arena (1:3) esteril, cuatro semanas despues fueron transferidas a condiciones de invernadero (temperatura de 28[grados]C / 19[grados]C (temperaturas dia/ noche), 12 horas de fotoperiodo (luz de dia) y 80% de humedad relativa, en el Centro Internacional de Agricultura Tropical (CIAT).

Se inocularon las dos variedades con la cepa CIO-151 de Xanthomonas axonopodis pv. manihotis por puncion de tallos en la variedad SG 107-35 y de hojas en la variedad MBRA 685. Se colectaron los tallos y hojas respectivamente pasadas 6, 12, 24, 48, 72 horas y 7 dias de la inoculacion. Fueron utilizadas 4 plantas para inocular con Xam por cada tiempo. Adicionalmente, para cada conjunto de 4 plantas tratamiento (tiempos de inoculacion con Xam) se colectaron el mismo numero de plantas sanas y estresadas por puncion, para un total de 24 plantas inoculadas (6 tiempos, 4 replicas por tiempo), 24 plantas sanas (4 replicas control por cada tiempo) y 24 plantas estresadas por puncion (6 tiempos, 4 replicas por tiempo). Para la inoculaci on en hojas se abrieron orificios de 2 mm de diametro y se colocaron sobre ellos 10 [micron]L de una suspension bacteriana (108 unidades formadoras de colonias/mL) (Restrepo et al., 2000a). Inmediatamente despues de colectar el tejido se introdujo en nitrogeno liquido para su preservaci on y luego fue almacenado a -80[grados]C.

Extraccion de ARN total, aislamiento de ARNm y sintesis de ADNc

Para cada variedad dos extracciones de ARN total fueron hechas paralelamente. En la primera se pesaron 600 mg de cada tejido perteneciente a los tiempos 6, 12, 24, 48, 72 horas y 7 dias despues de la inoculacion, para un total de 3 gr. de tejido, cuyo ARN representa todos los tiempos del proceso de infeccion por Xam. En la segunda se pesaron 420 mg del tejido estresado por puncion perteneciente a los tiempos 0, 6, 12, 24, 48, 72 horas y 7 dias, para un total de 3 g de tejido, cuyo ARN representa los genes expresados por una planta sana y los expresados en respuesta al estres por puncion. De esta manera se extrajo manualmente ARN total de tallos y hojas de SG 107-35 y MBRA 685 respectivamente, siguiendo las modificaciones hechas por Rocha, P.J. (1995) al protocolo descrito por Hall et al., (1978). Se aislo el ARNm utilizando el kit "Oligotex mRNA Midi (QIAGEN, CA)", siguiendo fielmente las indicaciones del productor, luego se sintetizo el ADNc usando el kit "SMART[TM] PCR cDNA synthesis (CLONTECH, CA)", siguiendo las instrucciones del productor, a partir de 400-500 ng de ARNm.

Al final de este proceso se contaba con una "Poblacion 1" de ADNc que representa la expresion genica en todos los tiempos de la infeccion despu es de la inoculacion y una "Poblacion 2" de ADNc perteneciente a plantas sanas y estresadas. Todo esto para cada variedad.

Libreria sustractiva de ADNc por el metodo de DSC

Con el fin de aislar unicamente los genes que se expresan en respuesta al ataque del patogeno, fue implementada una metodologia de sustraccion que puede hallar rapidamente diferencias entre dos poblaciones de ADN Luo et al. (1999). Brevemente, El ADNc de la "Poblacion 1" proveniente de plantas inoculadas fue usado como "tratamiento" y el ADNc de la "Poblacion 2" proveniente de plantas sanas y estresadas fue usado como "control". Ambos ("control" y "tratamiento") fueron digeridos con la enzima de restriccion DpnII. Seguidamente, el producto de la digestion fue ligado con un adaptador/primer diferente para cada poblacion de ADNc (Poblacion 1: BamIa, ATGAAGTGCACCCTACGATTCGAG; BamIb, pGATCCTCGAAATCGTA GGGGTGCACT. Poblacion 2: BamIIa, ATGAGAC ATGTTTCGTAGCCTAGG, BamIIb, pGATCCC TAGGCTACGAAACATGTC).

El producto de la ligacion fue sujeto a amplificaci on por PCR bajo las siguientes condiciones: 94[grados]C por 2 min., 94[grados]C por 30 seg., 68[grados]C por 2 min. por 30 ciclos de amplificacion. Para la primera ronda de hibridacion del DSC, 10 [micron]g de "control" previamente digerido con DpnII (para remover de nuevo los adaptadores) fue mezclado con 100 ng de "tratamiento", la mezcla fue precipitada y resuspendida en un volumen final de 32 [micron]L de buffer de hibridacion (50 mM Hepes, 1M CTAB). La mezcla fue calentada a 98-100[grados]C por 5 min y se adicionaron 8 [micron]L de 5 M NaCl para un volumen de 40 [micron]L. Luego se incubo a 67[grados]C por 14-16 h. El ADN renaturado fue purificado con el kit "QIAquick PCR purification" (QIAGEN, CA) y resuspendido en 50 [micron]L de buffer 1X para la enzima exonucleasa "mung bean" (New England Biolabs, MA) con 10U de enzima "mung bean" e incubado a 30[grados]C por 25-30 min. Para inactivar la exonucleasa, la muestra fue purificada con el kit "QIAquick PCR purification" (QIAGEN, CA). Una alicuota de 2.5 [micron]L del ADN purificado fue tomada para examinar la eficiencia de la sustraccion por PCR bajo las siguientes condiciones: 94[grados]C por 2 min., 94 [grados]C por 30 seg., 68[grados]C por 2 min. por 35 ciclos de amplificacion. El producto restante (+/- 55 [micron]L) fue concentrado al vacio, resuspendido en 32 [micron]L de buffer de hibridacion y recalentado a 98 [grados]C para una segunda ronda de hibridacion.

Con el producto de PCR de la segunda y tercera ronda de hibridacion para SG 107-35, y la tercera y cuarta ronda de hibridacion para MBRA 685, se construyo una libreria de 384 clones para cada variedad. Para ello se transformaron por electroporacion celulas competentes de la cepa DH-5[alfa] de E. coli. El vector utilizado fue el pGEM[TM]-Teasy.

Secuenciacion y analisis de secuencias

Cuarenta y ocho clones para las dos ultimas rondas de hibridacion en ambas variedades fueron secuenciados utilizando el secuenciador automatico ABI Prism 377, disponible en el CIAT. Estas secuencias fueron editadas usando el programa Sequencher 4.1 (Gene Codes Corporation). De los 192 clones secuenciados en total (48 de cada ronda de sustraccion para las dos variedades) se obtuvieron en total 110 secuencias unicas, 63 para MBRA 685 y 47 para SG 107-35. Con el fin de encontrar posibles funciones para el grupo de secuencias, se realizaron busquedas de similitud con BLASTn y BLASTx contra la base de datos del NCBI, teniendo como valor de probabilidad limite E = 1,0 x [10.sup.-4].

Construccion del microarreglo, hibridacion y analisis de datos

Los 110 clones seleccionados de la libreria sustractiva fueron utilizados para construir un microarreglo. Cada clon fue replicado 8 veces en el microarreglo. Con el proposito de ejercer un control de calidad sobre el microarreglo, fueron organizados genes control de tomate, papa, humano y genes constitutivos de yuca. Los clones fueron organizados en laminas de poli-lisina (Telechem International, Sunnyvale, CA) usando el robot SPBIO Microarray Spotting Station (MiraiBio Inc.).

Plantas de MBRA 685 y SG 107-35 fueron inoculadas como se describio anteriormente y colectadas despues de 24, 48 horas (h) de infecci on, el tejido fue agrupado por genotipo. La hibridacion al microarreglo fue realizada con el conjunto de ADNc de plantas infectadas vs. plantas sanas. Para confirmar la reproduccion del experimento cada hibridacion se hizo por duplicado. El ARN fue extraido usando el kit SV total RNA isolation system (Promega Corp.). El ADNc fue sintetizado usando el kit SMART[TM] PCR cDNA synthesis (CLONTECH, CA). En el marcaje con fluorescencia se incorporo Cye3-dUTP (fluorescencia verde) al ADNc de plantas sanas y Cye5-dUTP (fluorescencia roja) al ADNc de plantas infectadas.

El arreglo fue escaneado usando el escaner Virtek Chip-Reader scanner (BIO-RAD). La obtenci on de valores para cada senal, eliminacion de hibridacion inespecifica y normalizacion de los datos por LOESS, fue realizada usando el programa ArrayPro 4.0. (BIO-RAD). Los genes diferencialmente expresados fueron detectados usando el programa de analisis SAM (Significance Analysis of Microarrays) (Tusher et al., 2001).

RESULTADOS Y DISCUSION

Analisis funcional de las secuencias aisladas por la sustraccion

Provenientes de la libreria sustractiva fueron obtenidas 110 secuencias unicas, 63 para MBRA 685 y 47 para SG 107-35. En ambas variedades fueron encontrados 14 genes que hacen parte de las respuestas de defensa de la planta al ataque del patogeno, entre ellos genes que participan en vias completas de senalizacion, desarrollo de estres oxidativo, que muy probablemente activa la HR y SAR, modificacion de la pared celular y degradaci on proteica (tabla 1).

Flujo de calcio

Numerosas vias de senalizacion en las respuestas de defensa son activadas por el flujo de calcio ([Ca.sup.2+]) (Kim et al., 2002). Se ha demostrado que el calcio es esencial para la activacion de la sintesis de fitoalexinas, induccion de genes PR y HR (Zimmermann et al., 1997). Puesto que gran parte de las senales de [Ca.sup.2+] son mediadas por proteinas de union a calcio como calmodulinas (CaM), se ha propuesto la importancia de estas proteinas como moduladores de las senales de transduccion mediadas por calcio en las respuestas de defensa (Kim et al., 2002). La produccion de ROS, compuestos que generan el estres oxidativo, depende en gran medida de la activacion del flujo de calcio y su modulacion por calmodulinas (Grant and Loake, 2000). Estas proteinas de union a calcio generalmente presentan el dominio "EF hand", al cual se une el [Ca.sup.2+] para luego ser cargado a una via NADPH quinasa dependiente y terminar en la produccion de ROS (Grant and Loake, 2000).

En ambas variedades de yuca fue aislada una secuencia que codifica para la enzima calmodulina (SUS01) y presenta un dominio "EF hand". Para confirmar su posible papel en las respuestas de defensa fue alineada con siete secuencias CaM encontradas por Kim et al. (2002) y que estan asociadas con respuestas de defensa a hongos en arroz. Se encontro una similitud del 98% con estas secuencias. El resultado sugiere que la calmodulina aislada en la sustraccion podria pertenecer a este grupo de genes con secuencias altamente conservadas.

Estres oxidativo.

Todos los organismos usan el [O.sub.2] como aceptor final en la cadena de transporte de electrones de la respiracion; en este proceso el [O.sub.2] puede ser reducido para formar ROS, tales como el radical superoxido ([O.sub.2.sup.-]). Los principales componentes celulares son susceptibles al dano por radicales libres, ya que estos tienen gran efecto sobre proteinas, lipidos, carbohidratos y acidos nucleicos (Blokhina et al., 2003). Con el fin de prevenir danos ocasionados por ROS, los organismos aerobicos poseen enzimas que rapidamente los degradan, una de ellas es la catalasa, esta enzima protege la celula del [H.sub.2][O.sub.2] y de otros ROS por conversion del [H.sub.2][O.sub.2] en agua y oxigeno molecular durante una reaccion catalitica (Blokhina et al., 2003).

Esta bien documentado que la catalasa cumple un importante papel en las respuestas de defensa en plantas en contra de un amplio rango de patogenos (Yi et al., 1999). Una de las mas rapidas respuestas de defensa seguidas al reconocimiento del patogeno la constituye la producci on de ROS, se ha sugerido que el aumento de ROS representa una via de senalizacion para el inicio de la HR y SAR (Grant et al., 2000). Para que los compuestos con oxigeno reactivo se acumulen en la celula es necesaria la inhibicion de la enzima calatasa. El acido salicilico es el encargado de inhibir tanto la transcripcion como la actividad enzimatica de la catalasa (Yi et al., 1999). Algunos experimentos han sido ejecutados con el fin de dilucidar el papel de la catalasa y ROS en la activacion de respuestas de defensa. Plantas transgenicas de tabaco expresando genes con orientacion antisentido de dos familias de catalasa que se unen a acido salicilico (CAT1 y CAT2) mostraron el desarrollo de HR, induccion de genes PR de la familia PR-1 y el aumento de la resistencia al virus del mosaico del tabaco (Chamnongpol et al., 1998).

Durante la sustraccion realizada en las dos variedades resistentes MBRA 685 y SG 107-35 fueron encontrados genes que codifican enzimas catalasas (SUS02) pertenecientes a la familia CAT1 que es inhibida por acido salicilico, este resultado sugiere un papel importante de CAT1 en la interacci on yuca-Xam. Las secuencias que codifican para catalasa CAT1 tienen una similitud del 89% (valor E = 4e-18) con el gen Ngcat1 aislado por Yi et al. (1999) durante un estudio realizado para evaluar el papel de la catalasa en respuestas de defensa en tabaco.

En la sustraccion fueron aisladas otras dos secuencias que cumplen importantes papeles en el estres oxidativo de la planta durante las respuestas de defensa. La primera de ellas es la Nucleosido Difosfato Quinasa (SUS03), capaz de inhibir la generacion de ROS (Moon et al., 2003). La segunda es la Glutarredoxina (SUS04), una pequena oxido-reductasa que participa, entre otros, en el plegamiento y regulacion de proteinas y en la reparacion de proteinas que han sido afectadas por el estres oxidativo (para una revisi on, ver Grant, 2001).

Expresion de genes PR

En la libreria sustractiva fue aislada, para la variedad SG 107-35, una secuencia perteneciente a la familia PR-10 que se caracteriza por presentar el dominio Betv1 (SUS05) (81% de similitud) (Van Loon et al., 1994). Se ha demostrado que el dominio Betv1 tiene actividad ribonucleasa (ARNasa) (Bufe et al., 1996). Recientemente fue aislado el gen PPRG2 durante la infeccion por la planta parasitica Cuscuta trifolii en alfafa; este gen contiene el dominio Betv1 y se expresa en grandes cantidades durante la infeccion por Xanthomonas (Borsics and Lados, 2002).

Otra secuencia relacionada con patogenicidad fue aislada durante la sustraccion en la variedad MBRA 685, pertenece a la familia PR-14 y codifica una proteina de transferencia de lipidos (LPT)(SUS06) que contribuye en la transferencia de lipidos, particularmente fosfolipidos, a traves de membranas (Borsics and Lados, 2002); su relacion con la respuesta al ataque de patogenos ya ha sido estudiada. Molina et al. (1993) mostraron que cuatro LPTs de cebada y maiz eran potentes inhibidores de los patogenos Clavibacter michiganensis subsp. sepedonicus, Pseudomonas solanacearum y Fusarium solani. Ese mismo ano, Molina et al. (1993) estudiaron el comportamiento de tres de estas LPTs durante la infeccion por una cepa avirulenta y otra virulenta de Erysiphe graminis en cebada; en ambos casos se observo comportamiento bifasico en la acumulacion de LPTs con un alto incremento en las primeras horas de infeccion y una fuerte reduccion en las siguientes. La secuencia aislada en la sustraccion presenta una similitud del 58% con Cw20, una de las tres LPT aisladas en cebada.

Al parecer la expresion de genes PR esta altamente controlada y es dependiente de SAR. Uno de los genes candidatos para controlar la expresi on de algunos genes PR es el NPR1 en Arabidopsis. Mutantes con NPR1 defectuosos no activan SAR, disminuyen la expresion de genes PR y se hacen susceptibles (Cao et al., 1997). El gen NPR1 codifica una proteina que contiene repeticiones de ankirina, los mutantes NPR1 presentan una interrupcion en estas repeticiones, lo que sugiere que son importantes en la funcion de NPR1. Cuando se introduce el NPR1 silvestre dentro de mutantes NPR1 se restablece la inducci on de SAR, la expresion de genes PR y la resistencia a Pseudomonas syringae (Cao et al., 1997). Una proteina con repeticiones de ankirina fue encontrada en la respuesta de defensa del arroz contra el ataque del hongo patogeno Pyricularia grisea y en respuesta al tratamiento con Benzotiadiazol un homologo funcional del acido salicilico (Xiong et al., 2001).

En la sustraccion fue aislada en la variedad SG 107-35 una secuencia (SUS07) que muestra una similitud del 98% con una ankirina de Oryza sativa (numero de accesion AAN64471) y del 90% con una de Arabidopsis (numero de accesion NP_187842); probablemente la ankirina este involucrada en procesos de interaccion proteina proteina durante la induccion de SAR en las respuesta de defensa de yuca contra Xam, de la misma manera como ha sido demostrado para otros patosistemas (Cao et al., 1997; Kuhlmann et al., 2003).

Modificaciones de la pared celular

Una de las estrategias para combatir el ataque de patogenos radica en la modificacion de la pared celular y sus componentes (Baker et al., 1997). En la sustraccion fue aislada para la variedad SG 107-35 una secuencia que codifica la proteina Xiloglucan endotransglicosilasa (XET) (SUS08). En la decada pasada se realizaron muchos estudios sobre esta enzima por su papel determinante en los procesos de expansion de la pared celular durante el crecimiento y desarrollo de la planta Cosgrove (2000). Hacia 1994 fue reportado el BRU1, un gen regulado por Brasinosteroides (BRs) y que codifica la proteina XET (Zurek and Clouse, 1994). Los Brasinosteroides son compuestos poli-hidroxilados derivados del esterol que estan presentes en todas las plantas y se encuentran ampliamente involucrados en la regulacion de numerosos genes que controlan los procesos de crecimiento y desarrollo (Clouse and Sasse, 1998) y en procesos mas especificos de morfogenesis y expansion de la pared celular. Tambien estan involucrados en la respuesta a estres biotico y abiotico, incluyendo estres por salinidad, temperaturas extremas y ataque de patogenos (Clouse and Sasse, 1998).

Recientemente se ha demostrado con evidencia experimental el importante papel de los BRs en el desarrollo de resistencia a enfermedades en plantas (Nakashita et al., 2003). Plantas silvestres de tabaco fueron tratadas con un Brasinolido (un tipo de BRs) y mostraron alta resistencia a TMV, al pat ogeno bacteriano Pseudomonas syringae pv. tabaci y al hongo Oidium sp., tambien demostraron que el desarrollo de la resistencia por BRs no requiere biosintesis de acido salicilico y es independiente del SAR y de la resistencia inducida por heridas. Tambien comprobaron la resistencia inducida por BRs contra Magnaporthe grisea y Xanthomonas Oryzae pv. oryzae en arroz.

La secuencia que codifica para XET aislada en la variedad SG 107-35 presenta una similitud del 82% con el gen regulado por BRs (BRU1) reportado por Zurek et al. (1994) (numero de accesi on P35694). Ha sido reportada la expresion de BRU1 en tejidos vasculares y su posible papel en la formacion de pared celular. Tambien se ha confirmado su expresion en celulas parenquimaticas alrededor del tejido vascular en tallos de soya (Oh et al., 1998).

Los anteriores resultados sugieren que los BRs pueden regular la expresion de XET e inducir lignificacion del tejido vascular durante la interacci on yuca-Xam. Resultados que concuerdan con previos estudios bioquimicos e histologicos que confirman el refuerzo de las paredes celulares en los tejidos vasculares de la yuca con el fin de impedir la dispersion del patogeno durante la infeccion por Xam (Kpemoua et al., 1996).

Factores de transcripcion

El papel de los factores de transcripcion en las respuestas a estres biotico y abiotico ha sido estudiado desde hace pocos anos pero con resultados productivos respecto a su identificacion en las respuestas de defensa (para una revision ver Singh et al. 2002). La induccion de la expresion genica en respuesta a un estres ocurre inicialmente a nivel de la transcripcion, regular los patrones de expresion temporal y espacial de aquellos genes es una de las principales tareas de la planta en la respuesta a un tipo determinado de estres. El genoma de Arabidopsis codifica por lo menos 1500 factores de transcripcion (Riechmann et al., 2000); sin embargo, para la gran mayoria no se conocen detalles de su funcion.

Una de las familias de factores de transcripci on identificadas en las respuestas de defensa a estres son los genes MYB (Jin et al., 1999). Estas proteinas participan en las vias de produccion de metabolitos secundarios, proliferacion y forma celular, entre otros. Algunos de ellos son expresados en respuesta al tratamiento con hormonas y al ataque de patogenos (Kranz et al., 1998). En la sustraccion fue aislado un factor de transcripcion MYB (SUS09) en la variedad MBRA 685, aunque no hubo ninguna similitud con MYB1, ATR1 y otros genes MYB reportados en la literatura como expresados en las respuestas de defensa, su presencia en la libreria sustractiva sugiere una posible participaci on en la interaccion yuca-Xam..

Otro factor de transcripcion cuya expresion es inducida en respuesta a estres biotico y abiotico es la proteina Dedo de Cinc (ZFP, del ingles "Zinc Finger Protein") (Xiong 2001); ha sido demostrada su participacion en la respuesta de defensa de Oriza sativa al ataque por Pyricularia grisea (Xiong, et al., 2001). Recientemente se ha realizado un estudio de la expresion diferencial de factores de transcripci on a gran escala, 402 factores de transcripcion ubicados en un microarreglo fueron evaluados utilizando como sonda ARNm de diferentes tipos de estres y estados de desarrollo en Arabidopsis (Chen et al., 2002). La expresion diferencial tanto de genes MYB como ZFP es evidente, ambos tipos de factores de transcripcion se expresan en respuesta tanto a estres biotico (ataque de bacterias, hongos y virus) como abiotico (frio, salinidad, tratamiento con acido jasmonico), algunos de estos genes se expresan simultaneamente durante estres biotico o abiotico sugiriendo un cruzamiento en las vias de senalizaci on que responden a ambos tipos de estres.

En la libreria sustractiva fue aislada una secuencia en la variedad SG 107-35 que codifica un ZFP (SUS10), el resultado sugiere una regulacion transcripcional en las respuestas de defensa a Xam en esta variedad resistente.

Degradacion de proteinas. La degradacion selectiva de proteinas es un mecanismo empleado para activar una variedad de senales de transduccion en plantas superiores (Callis et al., 2000). Esta degradacion de proteinas intracelulares se realiza a traves del complejo de ubiquitinas presentes en los eucariotas. Las ubiquitinas se unen covalente y especificamente a las proteinas que van a ser destinadas a la degradacion a traves de una via dependiente de ATP. Fuertes evidencias sugieren que muchas respuestas a estres abiotico y resistencia a patogenos son activadas y mediadas por degradacion proteica (Ellis et al., 2002).

En la sustraccion fueron aisladas dos secuencias que codifican para la poliubiquitina 10 (UBQ10) (SUS11) en ambas variedades y la poliubiquitina 12 (UBQ12)(SUS12) en la variedad SG 107-35. El resultado sugiere que el sistema ubiquitina podria estar involucrado en la activacion de vias de senalizaci on mediadas por lisis proteica para responder al ataque por Xam.

Literatura reciente ha mostrado el papel de las proteinasas como un activo mecanismo de defensa en contra del ataque por hongos, virus y bacterias, y la induccion de su expresion en respuesta a estres abiotico (Liu et al., 2001). Los mecanismos utilizados por las proteinasas para impedir el ataque del patogeno son muy diversos; por ejemplo, la activacion de algunas senales de transduccion para responder a la infeccion es trabajo de las ubiquitinas. Sin embargo, la planta puede expresar proteinasas como compuestos antimicrobianos que atacan de manera directa al patogeno, a este grupo pertenecen las proteinasas defensinas como tioninas e inhibidores de proteinasas que causan lisis a la membrana plasmatica de hongos invasores impidiendo su crecimiento (Toma et al., 2002). Ademas de las defensinas otras proteinas proteoliticas participan en las respuestas de defensa, entre ellas estan las metaloproteinasas (Liu et al., 2001). Se ha clonado la secuencia completa de ADNc de una metaloproteinasa (Cs1-MMP) en pepino (Cucumis sativus), los resultados sugirieron que Cs1-MMP estaba involucrada en el desarrollo de senescencia y muerte celular programada y que podria participar en la degradacion de la matriz extracelular (Delorme et al., 2000).

En el estudio realizado por Liu et al. (2001) proponen que la metaloproteinasa GmMMP2 aislada en soya esta involucrada en un nuevo mecanismo de defensa de la planta en contra de la infeccion por patogenos. Los niveles de transcripci on de GmMMP2 incrementan rapidamente durante la interaccion compatible (desarrollo de la enfermedad) o incompatible (produccion de resistencia) con el hongo Phytophhtora sojae y la bacteria Pseudomonas syringae; sin embargo, GmMMP2 tambien se acumula durante el estres por deshidrataci on y herida, ademas su expresion es independiente de la presencia de los acidos salicilico y jasmonico y no esta correlacionada con la inducci on de HR. Varias funciones fueron sugeridas para GmMMP2: (1) regular indirectamente la biosintesis de fitoalexinas; (2) liberar una serie de sustancias antimicrobianas que retardan el crecimiento del patogeno y (3) regular vias de senalizacion diferentes a las reguladas por acido salicilico y jasmonico. Recientemente han sido encontradas las metaloproteinasas en la respuesta del tomate a una toxina del hongo patogeno Fussicocum amygdali (Frick et al., 2002), en este estudio fue construido un microarreglo con 235 secuencias de ADNc e interrogado con ARN proveniente de plantas tratadas con la toxina, una rapida y transitoria induccion de la expresion fue vista en la metaloproteinasa MMP1.

En la libreria sustractiva fue encontrada para la variedad SG 107-35 la secuencia que codifica para la enzima metaloproteinasa (SUS13). Esta secuencia presenta una similitud del 48% (Valor E = 1x [10.sup.-9]) con Cs1- MM P, la secuencia relacionada con muerte celular aislada en pepino, y una similitud del 46% con MMP1, la metaloproteinasa aislada en tomate.

Eficiencia en el trafico de proteinas

Durante las respuestas de defensa a patogenos en plantas, grandes cantidades de prote inas son sintetizadas en el Reticulo Endoplasmatico Rugoso (RER) y dirigidas via tra- fico vesicular a compartimentos especificos intra celulares o a la matriz extracelular (Jelitto-Van Dooren et al., 1999). Esta demostrado que cuando la planta es sometida a estres o atacada por un patogeno se acumulan una serie de proteinas residentes en RER con el fin de asistir el plegamiento, ensamblaje y formacion de puentes disulfuro en las proteinas recien sintetizadas (Cunnea et al., 2003; Jelitto-Van Dooren et al., 1999). Entre estas proteinas se encuentran las chaperonas y las prote inas residentes en RER de la familia DnaJ (Cunnea et al., 2003), estas proteinas estan relacionadas con el apropiado plegamiento proteico y su transporte a traves de RER.

En la sustraccion fue aislada, para la variedad SG 107-35, una proteina de la familia DnaJ (SUS14), su presencia sugiere una posible participaci on durante la sintesis de proteinas que responden al ataque de Xam con el fin de hacer mas eficiente la respuesta de defensa de la yuca en contra del patogeno.

Es importante notar que las secuencias con las que se hizo el analisis funcional pertenecen a un porcentaje inferior al 30% de las secuencias aisladas para ambas variedades, el 64% de las secuencias aisladas tanto en MBRA 685 como SG 107-35 no presentan funcion conocida o no tienen secuencias similares en la base de datos del GenBank. Este resultado sugiere que existe un gran potencial de nuevas secuencias, probablemente especificas de yuca que se expresan en respuesta al ataque de Xam.

El analisis funcional permite elaborar un flujo hipotetico (figura 1) de la respuesta de defensa de la yuca a la infeccion por Xam. Una vez el patogeno ha sido reconocido se desencadenan una serie de respuestas locales para impedir su dispersion, la primera de ellas es la sintesis de ROS que esta altamente controlada durante el proceso de infecci on por proteinas como CAT1 y NDPKs. En algun momento de la infeccion, tal vez en sus etapas tempranas, la celula aumenta su metabolismo, por ejemplo el trafico vesicular, y protege sus enzimas del estres oxidativo induciendo la expresion de glutarredoxinas. Cuando el ataque del patogeno es mas fuerte, la celula activa el proceso contrario y entonces muchas vias de senalizacion son activadas, entre ellas las mediadas por calcio, que resultan en la expresion de genes PR como el Betv1 y los LPTs y la induccion (conjuntamente con ROS) de la HR. Todos estos procesos de activaci on de genes y control son muy probablemente regulados en gran parte por la expresion de factores de trascripcion como los genes MYB y ZFP. Con el fin de inducir rapidamente la HR, complejos de ubiquitina activan vias de senalizacion mediadas por degradacion proteica y las metaloproteinasas podrian atacar directamente al patogeno. Es importante aclarar que el flujo hipot etico no pretende mostrar como se suceden los eventos de respuesta al patogeno en el tiempo, ademas, por ser hipotetico, cada una de las vias que se muestran deben ser confirmadas con otros experimentos. Sin embargo, es el primer modelo hipotetico de respuesta de defensa de la yuca al ataque por Xam, y ahi radica su valor.

[FIGURA 1 OMITIR]

Identificacion de genes expresados diferencialmente usando microarreglos

Con el fin de confirmar la expresion diferencial de los genes aislados en la libreria sustractiva, fue construido un microarreglo de ADNc y evaluado con plantas sanas vs. plantas infectadas y colectadas despues de 24 y 48 h. El analisis de datos revelo que 9 genes (5 genes despues de 24h y 4 genes despues de 48h) se encuentran diferencialmente expresados durante la respuesta de defensa de la yuca contra la infeccion por Xam, entre ellos la glutarredoxina (SUS04), el gen PR (SUS06), el factor de transcripcion Dedo de Cinc (SUS10), la ubiquitina (SUS11), genes de Arabidopsis con funcion no conocida (A.th) y algunos genes que no presentan similitud en las bases de datos (NH) (tabla 2). En el futuro podria ser interesente evaluar otros tiempos de infeccion usando microarreglos, de forma que pueda ser caracterizada en detalle la expresion de genes en las respuestas de defensa para este importante cultivo. En orden a seleccionar fuertes genes candidatos que puedan ser utilizados en posteriores estudios de transformacion genetica o silenciamiento de genes, recientemente se han validado estos y otros genes diferencialmente expresados encontrados en otros experimentos, usando la tecnologia de PCR en Tiempo Real (RTPCR). La correspondencia encontrada entre los resultados de microarreglos y RT-PCR fue del 100% (Lopez et al., 2005).

CONCLUSIONES

Con este estudio se ha logrado el primer acercamiento al conocimiento de los patrones de expresion genica que estan asociados con las respuestas de defensa de la yuca a la bacteriosis vascular. Muchas vias de senalizacion dirigen respuestas como estres oxidativo, induccion de genes PR y factores de transcripcion, modificaciones de la pared celular y regulacion del trafico de proteinas. Se ha demostrado que la genomica funcional y sus tecnologias de alto alcance pueden ser de gran utilidad para avanzar hacia la solucion de problemas en cultivos de alto interes economico en Colombia.

Recibido: octubre 22 de 2004 Aceptado: mayo 11 de 2005

REFERENCIAS

Baker, B.; Zambryski, P.; Staskawicz, B.; Dineshkumar S.P. 1997. Signaling in Plant-Microbe Interaction. Science. 276: 726-733.

Blokhina, O.; Virolainen, E.; Fagerstedt, K.V. 2003. Antioxidants, oxidative damage and oxygen deprivation stress: a review. Annals of Botany. 91: 179-94.

Boher, B.; Nicole, M.; Potin, M.; Geiger, J.P. 1997. Extracellular Polysaccharides from Xanthomonas axonopodis pv. manihotis Interact with Cassava Cell Walls During Pathogenesis. Molecular Plant Microbe Interaction. 10: 803-811.

Borsics, T.; Lados, M. 2002. Dodder infection induces the expression of a pathogenesis-related gene of the family PR-10 in alfalfa. Journal of Experimental Botany. 53(375): 1831-1832.

Bufe, A.; Spangfort, M.D.; Kahlert, H.; Schlaak, M.; Becker, W.M. 1996. The major birch pollen allergen, Bet v 1, shows ribonuclease activity. Planta. 199(3): 413-5.

Callis, J.; Vierstra, R.D. 2000. Protein degradation in signaling. Current Opinion in Plant Biology. 3(5): 381-386.

Cao, H.; Glazebrook, J.; Clarke J.D.; Volko, S.; Dong, X. 1997. The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell. 88(1): 57-63.

Clouse, S.D.; Sasse, J.M. 1998. BRASSINOSTEROIDS: Essential Regulators of Plant Growth and Development. Annual Review in Plant Physiology and Plant Molecular Biology. 49: 427.451.

Cosgrove, D.J. 2000. Expansive growth of plant cell walls. Plant Physiology and Biochemistry. 38(1): 109-24.

Cunnea, P.M.; Miranda-Vizuete, A.; Bertoli, G.; Simmen, T.; Damdimopoulos, A.E.; Hermann, S.; Leinonen, S.; Huikko, M.P.; Gustafsson, J.A.; Sitia, R.; Spyrou, G. 2003. ERdj5 an endoplasmic reticulum (ER)-resident protein containing DnaJ and thioredoxin domains, is expressed in secretory cells or following ER stress. Journal in Biological Chemistry. 278(2): 1059-1066.

Chamnongpol, S.; Willekens, H.; Moeder, W.; Langebartels, C.; Sandermann, H.; Van Montagu, M.; Inze, D.; Van Camp, W. 1998. Defense activation and enhanced pathogen tolerance induced by [H.sub.2][O.sub.2] in transgenic tobacco. Proceedings of the National Academy of Science USA. 95(10): 5818-23.

Chen, W.; Provart, N.J.; Glazebrook, J.; Katagiri, F.; Chang, H.S.; Eulgem, T.; Mauch, F.; Luan, S.; Zou, G.; Whitham, S.A. 2002. Expression profile matrix of Arabidopsis transcription factor genes suggests their putative functions in response to environmental stresses. The Plant Cell. 14: 559-574.

Delorme, V.G.; McCabe, P.F.; Kim, D.J.; Leaver, C.J.; 2000. A matrix metalloproteinase gene is expressed at the boundary of senescence and programmed cell death in cucumber. Plant Physiology. 123(3): 917-927.

Ellis, C.; Turner, J.G.; Devoto, A. 2002. Protein complexes mediate signalling in plant responses to hormones, light, sucrose and pathogens. Plant Molecular Biology. 50(6): 971-980.

Grant, C.M. 2001. Grant and Loake Role of the glutathione/ glutaredoxin and thioredoxin systems in yeast growth and response to stress conditions. Molecular Microbiology. 39(3): 533-541.

Grant, J.J.; Loake, G.J. 2000. Role of Reactive Oxygen Intermediates and Cognate Redox Sinaling in Disease Resistance. Plant Physiology. 124: 21-29.

Hall, T.C.; Buchbinder, B.U.; Pyne, J.W.; Sun, S.M.; Bliss, F.A. 1978. Messenger RNA for G1 protein of french bean seeds: cell-free translation and product characterization. Proceedings of the National Academy of Science USA. 75: 3196-3200.

Hammond-Kosack, K.E.; Jones, J.D. 1996. Resistance Gene-depent Plant Defensa Response. Plant Cell. 8: 1773-1791.

Harrington, C.A.; Rosenow, C.; Retief, J. 2000. Monitoring genes expression using DNA microarrays. Current Opinion in Microbiology. 3: 285-291.

Jelitto-Van Dooren, E.; Vidal, S.; Denecke, J. 1999. Anticipating Endoplasmic Reticulum Stress: A Novel Early Response before Pathogenesis-Related Gene Induction. The Plant Cell. 11: 1935-1943.

Jin, H.; Martin, C. 1999. Multifunctionality and diversity within the plant MYB-gene family. Plant Molecular Biology. 41: 577-585.

Kehoe, D. 1999. DNA microarrays for estudies of higher plants and other photosynthetic organisms. Trends in Plant Science. 4(1)1: 38-41.

Kim, M.C.; Lee, S.H.; Kim, J.K.; Chun, H.J.; Choi, M.S.; Chung, W.S.; Moon, B.C.; Kang, C.H.; Park, C.Y.; Yoo, J.H.; Kang, Y.H.; Koo, S.C.; Koo, Y.D.; Jung, J.C.; Kim, S.T.; Schulze-Lefert, P.; Lee, S.Y.; Cho, M.J. 2002. Mlo, a modulator of plant defense and cell death, is a novel calmodulin-binding protein. Isolation and characterization of a rice Mlo homologue. The Journal of Biological Chemistry. 277(22): 19304-14.

Kpemoua, K.; Boher, B.; Nicole, M.; Calatayud, P.; Geiger, J.P. 1996. Cytochemistry of defense responses in cassava infected by Xanthomonas campestris pv. Manihotis. Can.Journal of. Microbiol. 42: 1131-1143.

Kranz, H.D.; Denekamp, M.; Greco, R.; Jin, H.; Leyva, A.; Meissner, R.C.; Petroni, K.; Urzainqui, A.; Bevan, M.; Martin, C.; Smeekens, S.; Tonelli, C.; Paz-Ares, J.; Weisshaar, B. 1998. Towards functional characterisation of the members of the R2R3-MYB gene family from Arabidopsis thaliana. The Plant Journal. 16(2): 263-276.

Kuhlmann, M.; Horvay, K.; Strathmann, A.; Heinekamp, T.; Fischer, U.; Bottner, S.; Droge-Laser, W. 2003. The alpha -Helical D1 Domain of the Tobacco bZIP Transcription Factor BZI-1 Interacts with the Ankyrin-repeat Protein ANK1 and Is Important for BZI-1 Function, Both in Auxin Signaling and Pathogen Response. Journal Biological Chemistry. 278(10): 8786-8794.

Liu, Y.; Dammann, C.; Bhattacharyya, M.K. 2001. The matrix metalloproteinase gene GmMMP2 is activated in response to pathogenic infections in soybean. Plant Physiology. 127(4): 1788-1797.

Lopez, C.; Soto-Suarez, M.; Restrepo, S.; Piegu, B.; Cooke, R.; Delseny M.; Tohme, J.; Verdier, V.; 2005. Global transcriptome analysis of cassava responses to Xanthomonas axonopodis pv. manihotis infection using a cassava cDNA microarray. Plant Molecular Biology. 57: 393-410.

Lozano, J.C. 1986. Cassava bacterial blight: a manageable disease. Plant Disease. 70: 1089-1093.

Luo, J.; Puc, J.; Slosberg, E.; Yao, Yao.; Bruce, J.; Wright, T.; Becich, M.; Parsons, R. 1999. Differential subtraction chain, a method for identifying differences in genomic DNA and mRNA. Nucleic Acids Research, 27(19): e24 1-8.

Molina, A.; Garcia-Olmedo, F. 1993. Developmental and pathogen-induced expression of three barley genes encoding lipid transfer proteins. The Plant Journal. 4(6): 983-991.

Molina, A.; Segura, A.; Garcia-Olmedo, F. 1993. Lipid transfer proteins (nsLTPs) from barley and maize leaves are potent inhibitors of bacterial and fungal plant pathogens. FEBS. 316(2): 119-122.

Moon, H.; Lee, B.; Choi, G.; Shin, D.; Prasad, T.; Lee, O.; Kwak, S-S.; Kim, D.H.; Nam, J.; Bahk, J.; Hong, J.C.; Lee, S.Y.; Cho, M.J.; Lim, L.O.; Yun, D.L. 2003. NDP kinase 2 interacts with two oxidative stressactivated MAPKs to regulate cellular redox state and enhances multiple stress tolerance in transgenic plants. Proceeding of the National Academy of Science USA. 100(1): 358-363.

Nakashita, H.; Yasuda, M.; Nitta, T.; Asami, T.; Fujioka, S.; Arai, Y.; Sekimata, K.; Takatsuto, S.; Yamaguchi, I.; Yoshida, S.; 2003. Brassinosteroid functions in a broad range of disease resistance in tobacco and rice. Plant Journal. 33(5): 887-898.

Oh, M.H.; Romanow, W.G.; Smith, R.C.; Zamski, E.; Sasse, J.; Clouse, S.D. 1998. Soybean BRU1 encodes a functional xyloglucan endotransglycosylase that is highly expressed in inner epicotyl tissues during brassinosteroid-promoted elongation. Plant Cell Physiology. 39: 124-130.

Restrepo, S.; Verdier, V. 1997. Geographical Differentiation of the Population of Xanthomonas axonopodis pv. manihotis in Colombia. Applied and Enviromental Microbiology. 63(11): 4427-4434.

Restrepo, S.; Duque, M.C.; Verdier, V. 2000. Characterization of pathotypes among isolates of Xanthomonas axonopodis pv. manihotis in Colombia. Plant Pathology. 49: 680-687.

Riechmann, J.L.; Ratcliffe, O.J. 2000. A genomic perspective on plant transcription factors. Current Opinion in Plant Biology. 3(5): 423-434.

Rocha, P.J. 1995. Evaluacion comparativa de ARN mensajero de Phaseolus vulgaris L. entre una variedad resistente y una susceptible A Acanthoscelides obtectus (Say). Trabajo de Grado. Departamento de Biologia. Universidad Nacional de Colombia Sede Bogota.

Singh, K.B.; Foley, R.C.; Onate-Sanchez, L. 2002. Transcription factors in plant defense and stress responses. Current Opinion in Plant Biology. 5: 430-436.

Thomma, B.P.; Cammue, B.P.; Thevissen, K. 2002. Plant defensins. Planta. 216(2): 193-202.

Tusher, V.G.; Tibshirani, R.; Chu, G. 2001. Significance analysis of microarrays applied to the ionizing radiation response. Proceedings of the National Academy of Science USA. 98(9): 5116-5121.

Van Loon, L.C.; Pierpoint, W.S.; Boller, T.; Conejero, V. 1994. Recommendations for naming plant pathogenesis-related proteins. Plant Molecular Biology Reporter. 12: 254-264.

Xiong, L.; Lee, M.W.; Qi, M.; Yang, Y. 2001. Identification of defense-related rice genes by suppression subtractive hybridization and differential screening. Molecular Plant Microbe Interaction. 14(5): 685-692.

Yi, S.Y.; Yu, S.H.; Choi, D. 1999. Molecular cloning of a catalase cDNA from Nicotiana glutinosa L. and its repression by tobacco mosaic virus infection. Molecular Cells. 9(3): 320-325.

Zimmermann, S.; Nurnberger, T.; Frachisse, J.M.; Wirtz, W.; Guern, J.; Hedrich, R.; Scheel, D. 1997. Receptor-mediated activation of a plant Ca(2+)-permeable ion channel involved in pathogen defense. Proceedings of the National Academy of Science USA. 94: 2751-2755.

Zurek, D.M.; Clouse, S.D. 1994. Molecular cloning and characterization of a brassinosteroid-regulated gene from elongating soybean (Glycine max L.) epicotyls. Plant Physiology. 104(1): 161-170.

Mauricio Soto-Suarez * , Silvia Restrepo ** , Gloria Mosquera ***, Valerie Verdier ****, Joe Tohme *****

* Biologo. Asistente Investigacion. Centro Internacional de Agricultura Tropical CIAT, Cali-Palmira, Colombia. Correo electronico: m.soto.suarez@gmail.com

** Ph. D Fitopatologia Molecular. Profesor asociado. Universidad de los Andes.

*** MS. c Microbiologia. Estudiante doctorado. Kansas State University.

**** Ph. D Fitopatologia Molecular. Lider Proyecto Bacteriosis. CIAT-IRD.

***** Ph. D Genetista. Lider Proyecto Agro-biodiversidad y Biotecnologia. CIAT.
Tabla 1. Secuencias aisladas en la libreria sustractiva para ambas
variedades que estan asociadas en procesos de defensa a patogenos en
plantas. Se muestran los valores de probabilidad E que resultan de las
busquedas de similitud en la base de datos del NCBI usando el algoritmo
BLASTx, como puede verse todas las secuencias tienen un nivel de
similitud alto.

Clon    Similitud                                            Valor E

SUS01   Calmodulina                                           4E-44
SUS02   Catalasa CAT1 [Manihot esculenta]                     3E-43
SUS03   Nucleosido Difosfato Quinasa (ndpk3) [Arabidopsis     1E-38
          thaliana]
SUS04   Glutaredoxina [Ricinus communis]                      4E-38
SUS05   Proteina de la familia Bet v I                        2E-14
SUS06   Proteina de Transferencia de Lipidos (LTP)            2E-14
SUS07   Proteina Ankirina [Arabidopsis thaliana]              5E-16
SUS08   Xiloglucan Endotransglicosilasa [Arabidopsis          9E-47
          thaliana]
SUS09   Factor de transcripcion MYB [Arabidopsis thaliana]    2E-08
SUS10   Proteina Dedo de Cinc (ZFP) [Arabidopsis thaliana]    9E-57
SUS11   Poliubiquitina (UBQ10) [Arabidopsis thaliana]         5E-36
SUS12   Ubiquitin (UBQ12) [Arabidopsis thaliana]              1E-31
SUS13   Metaloproteinasa [Arabidopsis thaliana]               5E-13
SUS14   Proteina DnaJ [Hevea brasiliensis]                    7E-24

Tabla 2. Resumen de estadisticos para el programa SAM y numero de genes
diferencialmente expresados a 24 y 48h durante la infeccion por Xam

Expresion              24h    48h

Delta                  1.23   1.41
Tasa sobre-expresion   2      2
No. Falsos             0      0
Significativos
Genes activado         5      4
Genes reprimidos       0      0
COPYRIGHT 2006 Universidad Nacional de Colombia, Instituto de Biotecnologia
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Soto-Suarez, Mauricio; Restrepo, Silvia; Mosquera, Gloria; Verdier, Valerie; Tohme, Joe
Publication:Revista Colombiana de Biotecnologia
Date:Dec 1, 2006
Words:8364
Previous Article:Evaluacion de un modelo piloto integrado para postratamiento del efluente del RAP utilizando Spirodela sp.
Next Article:Analisis de la variacion genetica en clones de caucho (Hevea brasiliensis) de Asia, Suramerica y Centroamerica usando marcadores RAPD.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters