Printer Friendly

Analisis con micromatrices de la respuesta granulomatosa in vitro a Mycobacterium tuberculosis H37Ra.

Microarray analysis of the in vitro granulomatous response to Mycobacterium tuberculosis H37Ra

Introduccion

La tuberculosis (TB) es una enfermedad altamente contagiosa causada por la bacteria Mycobacterium tuberculosis, que amenaza actualmente una proporcion significativa de la poblacion mundial, principalmente gracias a su capacidad para inducir una infeccion latente. Se ha estimado que esta enfermedad causa aproximadamente 9 millones de casos nuevos y 1.4 millones de muertes cada ano, lo que ubica a la tuberculosis en el segundo lugar en mortalidad entre todas las enfermedades infecciosas en el mundo (1). Despues de la infeccion, la tuberculosis activa se desarrolla en el 5% de los individuos mientras que el 90% porta la infeccion latente por el resto de sus vidas, ya que son incapaces de lograr la completa erradicacion del patogeno (2,3). Durante el encuentro con el hospedero, los bacilos entran a los pulmones en particulas en aerosol, causando la infeccion y activando a los macrofagos alveolares y celulas dendriticas. Los macrofagos infectados liberan citoquinas y quimiocinas que disparan una fuerte respuesta inflamatoria que conduce a la formacion de un granuloma.

El granuloma es una acumulacion celular organizada que se forma alrededor de los bacilos (4). Se ha sugerido que la respuesta inmune del hospedador es capaz de ajustarse y responder al estado fisiologico de la bacteria, causando una modulacion en la expresion de genes directamente en el sitio de la infeccion (5). La completa erradicacion de los bacilos no se lleva a cabo, ya que la bacteria ha desarrollado estrategias que le permiten persistir dentro del granuloma por largo tiempo, pudiendo en algunas ocasiones escapar del granuloma y diseminarse local y sistemicamente (6). Por lo tanto, bajo ciertas condiciones fisiologicas (desnutricion, envejecimiento, etc.) o patologicas (infeccion por VIH, diabetes, cancer, etc.), M. tuberculosis es capaz de reactivarse y escapar del granuloma y diseminarse (7). Un mejor entendimiento de los mecanismos involucrados en la formacion y mantenimiento del granuloma puede ayudar en el desarrollo de terapias dirigidas contra la tuberculosis (4).

Diversos modelos animales (8,9) y humanos in vitro (10-12) han sido desarrollados para tratar de entender la compleja secuencia de eventos moleculares tempranos involucrados en la formacion del granuloma. Los modelos in vitro en particular representan un valioso instrumento para la identificacion de los mecanismos implicados en la respuesta inmune temprana dirigida contra micobacterias definidas (13). En el presente estudio hemos utilizado el modelo in vitro para el desarrollo del granuloma propuesto y caracterizado por Puissegur et al. (11), el cual ha demostrado su utilidad para el estudio de las interacciones moleculares entre la micobacteria y las celulas hospedadoras humanas usando micobacterias vivas y celulas mononucleares de sangre periferica (PBMCs: peripheral blood mononuclear cells). Usando este modelo, en el presente estudio hemos determinado los perfiles globales de la expresion genica que se inducen durante la formacion in vitro de granulomas en respuesta a la infeccion con la cepa M. tuberculosis H37Ra. El analisis de genes y vias alteradas durante el desarrollo de estos granulomas in vitro puede ser de gran utilidad para entender los eventos moleculares tempranos que tienen lugar durante la interaccion hospedador-patogeno.

Materiales y Metodos

Celulas inmunes y bacteria

Se obtuvo sangre periferica a partir de donantes sanos luego que los mismos aceptaron participar del estudio y firmaron un consentimiento informado. Las celulas mononucleares de sangre periferica (PBMCs) se aislaron usando un gradiente de centrifugacion en Ficoll-Hipaque 1077 (Sigma Chemical Co., St Louis MO, USA) y luego se resuspendieron en medio RPMI 1640 suplementado con 10% de suero fetal bovino. Las celulas bacterianas de la cepa H37Ra de M. tuberculosis se cultivaron en el medio basal modificado de Lowenstein-Jensen. Las bacterias fueron recolectadas en caldo Middlebrook 7H9 (BD Difco Biosciences, Mountain View, CA, USA) y mezcladas extensivamente con agujas de jeringa, para ser posteriormente cultivadas con diluciones seriadas en medio Lowenstein-Jensen modificado. La viabilidad de las celuas se determino mediante conteo de unidades formadoras de colonias (CFU) en el medio basal.

Induccion de los granulomas in vitro

Las PBMCs se transfirieron a platos de cultivo celular de 24 pozos a una concentracion de 1 x [10.sup.5] celulas por pozo en RPMI 1640 suplementado con 10% FBS. Seguidamente se agrego a cada pozo una suspension de celulas frescas de M. tuberculosis H37Ra o BCG con una multiplicidad de infeccion (MOI) de 0.1. Las celulas fueron de inmediato cultivadas a 37[grados]C y monitoreadas en periodos de 24 h durante 5 dias. Se hizo recambio del medio de cultivo cada 48 h. Para evaluar la especificidad de la reaccion del granuloma, se hicieron cultivos adicionales de PBMCs en presencia de Escherichia coli ATCC 25922 o Staphylococcus aureus ATCC 25923, con MOI de 0.1. Tambien se incluyeron como controles PBMCs cultivadas en ausencia de bacterias.

Microscopia optica y monitoreo celular

Para monitorear el progreso de la agregacion celular, las celulas cultivadas fueron observadas bajo un microscopio invertido (Nikon, Chiyoda-ku, Tokyo, Japan) y se tomaron fotografias con un sistema de captura Nikon. Cada 24 h durante un total de 5 dias de cultivo, las celulas fueron sometidas a tincion Wright-Giemsa (W-G) modificada (Sigma-Aldrich, St Louis, MO, USA) siguiendo las instrucciones del fabricante.

Microscopia de transmision electronica

A las 48 h post-infeccion, los agregados celulares fueron recolectados cuidadosamente, fijados por 4 h a 4[grados]C en 2% glutaraldehido en 0.1 M de bufer de cacodilato con 6 mM Ca[Cl.sub.2] pH 7.4. Despues de lavar con bufer cacodilato, los granulomas fijados fueron tratados durante una hora con tetroxido de osmio al 1% en 0.1 M bufer cacodilato, luego se deshidrataron y se embebieron en una resina Epon-araldita. Secciones de 0.5 [micron]m se obtuvieron en un microtomo y se montaron en rejillas de cobre, se tineron con acetato de uranilo y citrato de plomo al 3%, y se examinaron con un microscopio de transmision electronica Zeiss 10 C.

Perfiles de expresion con micromatrices

Para los estudios con micromatrices, los granulomas fueron preparados in vitro por triplicado, mediante infeccion de las PBMCs con Mtb H37Ra durante 24 h. Al cabo de este tiempo, los granulomas se recolectaron y se sometieron a extraccion de ARN. Como control del experimento, PBMCs fueron tambien cultivadas por triplicado en las mismas condiciones. El ARN total de los granulomas inducidos por H37Ra y de las PBMCs controles fueron procesadas en las instalaciones de micromatrices del New York Medical College e hibridizadas en forma individual a chips de Affymetrix Human Genome GeneChip U133 plus2 (Affymetrix, Santa Clara, CA). Los archivos escaneados resultantes fueron analizados con el programa dChip v1.3 (www.dchip.org) y con Affymetrix MicroArray Suite 5.0 (MAS 5.0). Los datos de las micromatrices fueron normalizados con el programa dChip v1.3 usando el metodo de normalizacion del grupo invariante (14), y se obtuvieron los estimados de expresion genica basados en modelo y algoritmo de deteccion de "valores atipicos" de acuerdo al modelo "perfect-match-only" desarrollado por Li-Wong (14); los transcritos considerados como "valores atipicos" fueron excluidos de los analisis subsiguientes. El programa Affymetrix MAS 5.0 fue usado para determinar si los transcritos fueron detectados como presentes, ausentes, marginal, o no detectados. Para el nivel de expresion significativo, se uso un punto de corte de 500 unidades. Los datos de ADN generados por las micromatrices a partir de los granulomas in vitro fueron comparados a los datos generados por las micromatrices a partir de PBMCs no infectadas usando el programa dChip v1.3 y los archivos de expresion resultantes fueron sometidos a analisis de vias biologicas y de grupos funcionales para determinar la significancia de los cambios en un contexto biologico. Todos los datos generados por las micromatrices siguieron las normas MIAME (Minimum Information about a Microarray Experiment) y los datos crudos fueron depositados en la base de datos GEO (Gene Expression Omnibus, Accession Number: Series GSE16250).

Analisis de las vias biologicas

Para identificar las vias biologicas afectadas durante la formacion in vitro de los granulomas, los datos de micromatrices fueron analizados con los programas GenMAPP (Gene Map Annotator and Pathway Profiler) y MAPPFinder desarrollados en los Institutos Gladstone de la Universidad de California en San Francisco (15) (www.genmapp.org). Los criterios usados para el analisis GenMAPP/MAPPFinder para la expresion aumentada fueron: una intensidad promedio minima de 500 unidades, un porcentaje de deteccion de P (presente) de 100, un "fold change" [mayor que o igual a] 2.0 entre los granulomas comparados con las PBMCs no infectadas. Los criterios para la expresion disminuida fueron un minimo de intensidad de 500 unidades, un porcentaje de P (presente) de 100, y un "fold change" de <-2.0 entre los granulomas comparados con las PBMCs no infectadas. Los programas generaron un valor Z basado en la distribucion hiper-geometrica.

Validacion de los datos de las micromatrices por PCR cuantitativa en tiempo real

Para validar los datos de expresion generados por las micromatrices, se realizo una PCR cuantitativa en tiempo real (qRT-PCR) para genes seleccionados utilizando los mismos RNAs individuales usados en los experimentos con las micromatrices (16).

[FIGURA 1 OMITIR]

Acido ribonucleico total (1 [micron]g) de cada muestra fue sometido a una transcripcion inversa para generar cADN de primera cadena en un volumen de reaccion de 20 [micron]L, usando QuantiTect Reverse Transcriptase kit (Qiagen) y la qRT-PCR se realizo con QuantiTect SYBR Green PCR Master Mix (Qiagen) siguiendo las instrucciones del fabricante. Los niveles de expresion genica fueron determinados en un termociclador StepOne (Applied Biosystems, Grand Island NY, USA). Se disenaron cebadores especificos para los genes blanco seleccionados y para genes constitutivos usando el programa Primerblast software. Para estimar la reproducibilidad de los datos, cada muestra fue analizada en duplicado en la reaccion de PCR.

Analisis estadistico

Para evaluar la reproducibilidad, todos los experimentos se realizaron en replicas, y ademas tambien se realizaron experimentos independientes. Los calculos de la expresion genica se efectuaron con el programa Sequence Detection System 2.1 (Applied Biosystems) usando el metodo comparativo CT ([2.sup.-[DELTA][DELTA]CT]). [BETA]-actin e Hypoxanthine-guanine phosphoribosyl transferase (HPRT) se utilizaron como genes constitutivos de referencia. Los datos fueron analizados usando el programa SPSS 19.0 (SPSS Inc, Chicago, IL, USA). La significancia estadistica de los cambios se determino mediante la prueba t de Student.

Resultados

La infeccion de PBMCs humanas induce la formacion de granulomas

Para replicar la formacion de los granulomas en un modelo in vitro, se infectaron PBMCs humanas con M. tuberculosis H37Ra o BCG, y seguidamente se incubaron por 5 dias. A las 24 h de incubacion, las PBMCs tendieron a formar agregaciones celulares de linfocitos en presencia de H37Ra (Fig. 1A) o BCG (Fig. 1B). Las muestras controles correspondientes de los mismos donadores cultivadas en presencia de Escherichia coli ATCC 25922 o Staphylococcus aureus ATCC 25923, o cultivadas en ausencia de bacterias no formaron estos agregados (Figs. 1C, 1D, 1E) indicando que los agregados celulares se forman especificamente en respuesta a la infeccion con micobacterias. Estas acumulaciones celulares con forma similar a los granulomas, fueron confirmadas mediante tincion WrightGiemsa a las 24 h siguientes a la infeccion con M. tuberculosis H37Ra (Fig. 1F). La microscopia de transmision electronica de estos agregados evidencio el atrapamiento de las micobacterias por los fagocitos presentes en las agregaciones celulares a las 48 h post-infeccion (Fig. 2). Las estructuras granulomatosas formadas in vitro persistieron por 96 h, y luego comenzaron a desvanecerse.

[FIGURA 2 OMITIR]

Perfiles de expresion con micromatrices de granulomas in vitro inducidos por H37Ra

Del total de 25,690 genes analizados con los microarreglos, 2,195 se encontraron sobreexpresados ("fold change" [mayor que o igual a] 2, p [menor que o igual a] 0.05) y 106 subexpresados ("fold change" [menor que o igual a]-2, p [mayor que o igual a] 0.05) en los granulomas in vitro comparados con las PBMCs no infectadas. Se encontro que el 60% de los genes alterados estuvieron relacionados con la respuesta inmune, tales como el procesamiento antigenico, vias de senalizacion (TLR2, TNF-, IL6-, IL-8, quimiocinas), 25% de los genes estuvieron relacionadas con procesos metabolicos y 15% estuvieron relacionados con estres oxidativo y apoptosis (Tabla 1). Se encontro sobreexpresion de TLR2, CD14, CD86 y MyD88, los cuales corresponden a componentes principales de la via de senalizacion de TLR2 de la respuesta inmune innata. Tambien encontramos expresion aumentada de moleculas MHC-I y MHC-II involucradas en la presentacion antigenica por celulas presentadoras de antigenos (APC), un proceso esencial para la contencion de la infeccion por M. tuberculosis. En nuestro modelo del granuloma in vitro, a las 24 h post-infeccion con M. tuberculosis H37Ra, observamos una induccion significativa de un numero de transcritos implicados en las vias de senalizacion de la respuesta inmune proinflamatoria dependientes de quimiocinas, incluyendo XCL1(3.7), XCL2(5.1), CCL2(8.3), CCL4(10.0), CCL5(5.7), CCL7(5.6), CCL8(11.1), CCL18(10.3), CCL19(2.15), CCL20(8.9), CXCL1(2.1), CXCL2(8.3), CXCL5(11.6), CXCL10(7.7), y receptores de quimiocinas CCR2(3.8) y CXCR4(7.1). Se encontro ademas expresion aumentada de genes relacionados con apoptosis tales como caspasa-1 (5.0), caspasa-2 (2.2), caspasa-3 (3.7), caspasa-4 (4.5) y caspasa-9 (2.9). Tambien se encontro expresion aumentada de granulisina y granzimas A, B y H, las cuales son componentes mayores de los granulos citoplasmaticos de los linfocitos T citotoxicos y celulas NK, los cuales estan involucrados en la apoptosis mediada por celulas. Adicionalmente observamos expresion aumentada de genes codificantes de las catepsinas A, C, D, y W, las cuales son un tipo de peptidasas implicadas en la activacion de los linfocitos T CD8+. Tambien se identifico la expresion alterada de un numero de quimiocinas no previamente implicadas en la respuesta inmune a M. tuberculosis, tales como CCL8 (MCP-2), CCL7 (MCP-3), XCL1 (linfotactina) y XCL2.

Validacion por qRT-PCR de la expresion de genes seleccionados Para validar los datos obtenidos con los microarreglos, se realizo qRT-PCR para un grupo de 10 genes, incluyendo las quimiocinas proinflamatorias (CCL2, IL8, CCL5, CCL18), moleculas efectoras involucradas en los mecanismos de muerte celular dependiente de celulas T citotoxicas (cistatina B, granzima B, granulisina), y metalotioneinas (1H, 1M, 1G). Los resultados se muestran en la Tabla 2. Los valores positivos indican un aumento en la expresion genica en los granulomas in vitro a las 24 h posteriores a la infeccion con H37Ra comparado con PBMCs cultivadas por 24 h en ausencia de bacterias. Los niveles de expresion genica obtenidos por qRT-PCR fueron concordantes con los niveles correspondientes observados con los experimentos con micromatrices.

Discusion

En este estudio se utilizo un modelo previamente descrito en la literatura para el desarrollo del granuloma tuberculoso in vitro, con el objetivo de determinar los perfiles de expresion genica asociados con este proceso. Usando este modelo, observamos que los linfocitos presentes en PBMCs humanas se agruparon alrededor de los bacilos infectantes semejando microagregados tipo granuloma (Fig. 1). Los microgranulomas se formaron especificamente en respuesta a la infeccion con M. tuberculosis, ya que no hubo formacion de estas estructuras cuando las PBMCs se cultivaron en presencia de celulas vivas de E. coli o S. aureus ni cuando las PBMCs se cultivaron en ausencia de bacterias. El desarrollo y mantenimiento de los granulomas en el pulmon es la principal defensa del hospedador contra la infeccion por M. tuberculosis (17,18). Los analisis con micromatrices de estos granulomas formados in vitro nos permitio un mejor entendimiento de las interacciones tempranas que tienen lugar entre el hospedador y el patogeno durante la formacion del granuloma en respuesta a la infeccion por M. tuberculosis H37Ra (ATCC 25177). El reconocimiento inicial del M. tuberculosis por la respuesta inmune innata involucra la senalizacion a traves de los TLR2, el cual esta influenciado por varios receptores accesorios, principalmente CD14 (17,1) 8. Los lipomananos de las especies de micobacterias son agonistas de TLR2, los que luego de la union del ligando inducen la activacion de macrofagos, que se caracteriza por la expresion en la superficie celular de CD40 y CD86, produccion de citoquinas y quimiocinas, presentacion antigenica, entre otras caracteristicas de la respuesta inmunes innata (19). La activacion de macrofagos esta mediada a traves de la proteina adaptadora MyD88 (factor de diferenciacion mieloide 88), pero de forma independiente del reconocimiento por TLR4 o TLR6 (20,21). De manera consistente con esta informacion, en el presente estudio encontramos la sobreexpresion de TLR2, CD14, CD86 y MyD88, lo cual apoya la importancia de la via de senalizacion TLR2 en la respuesta inmune innata a M. tuberculosis H37Ra. Las interacciones entre M. tuberculosis y las celulas de la respuesta inmune innata lleva a la secrecion de quimiocinas y citoquinas, de las cuales el IFN[gamma] y el factor de necrosis tumoral (TNF) son particularmente importantes en la TB. Un efecto importante del IFN[gamma] es el de activar macrofagos y aumentar en los mismos la expresion de moleculas MHC clase II, conducentes a un aumento en la presentacion de antigenos a celulas T, lo que constituye un evento crucial para la contencion de la infeccion por la micobacteria (22). En este trabajo encontramos que la infeccion por H37Ra resulto en un aumento en la expresion de moleculas MHC-I y MHC-II involucradas en la presentacion antigenica de celulas presentadoras de antigenos (APC), un proceso esencial para contener la infeccion por M. tuberculosis.

El efecto mas prominente observado en este estudio fue la induccion de muchos genes codificantes de quimiocinas y citoquinas. Se conoce que varias citoquinas juegan un papel importante en la inmunidad contra el bacilo de la tuberculosis. Se ha descrito previamente la expresion aumentada de transcritos para IFN[gamma] TNF[alfa], IL-6, IL-8 e IL-12 en el granuloma tuberculoso (23) y la secrecion de citoquinas IL-1[beta], TNF[alfa] e IL-6 en el lavado broncoalveolar en la tuberculosis pulmonar (24). El analisis transcriptomico de las lesiones granulomatosas tempranas en los pulmones de primates no-humanos con tuberculosis activa, revelo la presencia de un microambiente altamente inflamatorio, con niveles de expresion elevados de componentes de las vias de senalizacion inmunes, tales como IFN[gamma], TNF[alfa], JAK, STAT y quimiocinas CC/CXC (25). En nuestro estudio en el que se utilizo un modelo in vitro del granuloma, a las 24 h posteriores a la infeccion con M. tuberculosis H37Ra, observamos una induccion significativa de un numero de vias de senalizacion proinflamatorias dependientes de quimiocinas, IFN[gamma] y TNF.

Ha sido ampliamente demostrado que las quimiocinas participan activamente en la respuesta inmune protectora contra la infeccion por M. tuberculosis (26), siendo muchas de ellas quimioatrayentes para leucocitos hacia los sitos de infeccion. Nuestro analisis de expresion global con microarreglos revelo diferencias significativas en la expresion de quimiocinas CXCL- y CCL- tales como CXCL1 (Gro-[alfa]), CXCL2 (Gro-[beta]), CXCL5 (ENA-78), CXCL8 (IL-8) y CXCL10 (IP-10). Entre ellas, los transcritos para CXCL5 fueron los mas altamente sobreexpresados. Esta quimiocina, junto con IL-8, es inducida en respuesta a citoquinas proinflamatorias tales como IL-1 o TNF[alfa], las cuales son potentes activadores de neutrofilos (27). Estudios previos han mostrado que CXCL5 conlleva a un aumento en el numero de neutrofilos infiltrantes en carcinoma broncoalveolar y en la infeccion por Rhinovirus (28); sin embargo, su funcion en la tuberculosis no esta esclarecida (29).

Este estudio nos permitio identificar niveles aumentados de transcritos para CCL19 y CCL20. Estas dos quimiocinas participan en el reclutamiento y activacion de linfocitos a los sitios de inflamacion. La induccion de numerosas quimiocinas en el granuloma in vitro temprano es un hallazgo esperado, ya que se conoce que los gradientes de quimiocinas guian diferentes celulas inmunes efectoras a los sitios de infeccion. Se ha demostrado que las quimiocinas estan asociadas estrechamente con las infecciones por micobacterias, requiriendose niveles apropiados de ellas para prevenir la migracion celular fuera del granuloma, contribuyendo asi al mantenimiento de la estructura del granuloma (30).

La funcion ejercida por las vias de senalizacion inmunes proinflamatorias que implican al IFN[gamma] y al TNF[alfa] en la proteccion contra la infeccion por M. tuberculosis esta bien comprendida (31). Entre los genes sobreexpresados encontrados en este trabajo estan la IL15 e IL15R. Varios estudios han suministrado evidencia de que la via activada por esta citoquina puede aumentar la respuesta inmune protectora contra la infeccion por M. tuberculosis (32). Otra quimiocina altamente sobreexpresada encontradas en los granulomas in vitro de este estudio fue CXCL8 (IL8). Esta quimiocina ha sido implicada previamente en la formacion del granuloma tuberculoso y en la inmunidad a M. tuberculosis (33).

El presente trabajo permitio identificar la expresion alterada de varios genes relacionados con apoptosis, incluyendo caspasas, granulisina, granzimas y catepsinas. Se ha reportado que la infeccion por M. tuberculosis causa apoptosis de neutrofilos (34) y monocitos/ macrofagos (34,35). Los macrofagos son las celulas hospedadoras primarias para M. tuberculosis y como consecuencia hay extensa muerte celular en esta poblacion celular. Especificamente se ha demostrado que cepas atenuadas o avirulentas de micobacterias, tales como BCG y H37Ra, principalmente inducen apoptosis de macrofagos, mientras que las cepas virulentas principalmente inducen necrosis. Estas observaciones han generado interes en el campo del desarrollo de vacunas contra la TB ya que cepas de micobacteria con actividad pro-apoptotica capaces de inducir una mayor apoptosis de los macrofagos estimularian una mejor respuesta cuantitativa de celulas T (36). La catepsina C, la cual se encontro sobreexpresada en este estudio, participa en la activacion de granzimas y en el proceso de muerte celular mediado por celulas T citoliticas (37,38), mientras que la catepsina W se asocia con celulas NK. Por lo tanto estas moleculas juegan un papel esencial en la citotoxicidad39. La expresion aumentada de todos estos genes proapoptoticos puede reflejar el intento del sistema inmune innato de limitar la infeccion al restringir el crecimiento del M. tuberculosis, y revela el rol que cumplen las diferentes caspasas, granzimas, y catepsinas en este proceso.

Ademas se encontro la induccion de metalotioneinas y metaloproteasas en los granulomas tempranos analizados en este estudio. Las metalotioneinas son proteinas ricas en cisteina, de union a metales, de bajo peso molecular, (6 a 8 KDa), las cuales son inducidas por diferentes estimulos, incluyendo el estres oxidativo generado durante el estallido respiratorio de los fagocitos (40). La metalotioneina 1H ha sido implicada en la induccion de quimiocinas in vitro (41). En cuanto a las metaloproteasas, detectamos un aumento significativo en los niveles de transcritos de MMP9 y de varias cistatinas. MMP9 es estabilizada y protegida por miembros de la superfamilia de las cistatinas sin que se afecte su actividad (42). Estudios recientes han mostrado la importancia de MMP9 en la interaccion con proteinas secretadas por M. tuberculosis y en la induccion de la formacion de las lesiones granulomatosas (43). Se ha reportado que el lipomanano de las micobacterias induce la expresion de MMP9 en macrofagos humanos a traves de un mecanismo dependiente de TLR2 y CD14 (44). La importancia de las celulas Th1 en el control de la tuberculosis esta ampliamente aceptado (45) y nuestro estudio claramente muestra que M. tuberculosis H37Ra induce una fuerte respuesta Th1, reflejada en el aumento en la expresion de citoquinas Th1 tales como IFN[gamma], TNF[alfa], IL-6 e IL-1, las cuales median la exitosa resistencia contra la infeccion por M. tuberculosis (45,46). Nuestros resultados soportan esta informacion, ya que observamos que muchos genes inducibles y regulados por IFN[gamma], tales como IFI-16, IFI-30, IFI-44, IRF-3, IRF7 y IRF-1 estuvieron aumentados en los granulomas.

Finalmente, en este estudio identificamos la expresion alterada de un numero de quimiocinas que no habian sido previamente implicadas en la respuesta inmune a M. tuberculosis, tales como CCL8 (MCP-2), CCL7 (MCP-3), XCL1 (linfotactina) y XCL2. La funcion potencial ejercida por estas quimiocinas en el establecimiento del granuloma tuberculoso requiere de investigacion adicional. Todos los cambios descritos aqui tuvieron lugar a las 24 h posteriores a la infeccion de PBMCs por la cepa de M. tuberculosis H37Ra, lo que condujo a la formacion temprana del granuloma. Por lo tanto, este modelo in vitro del granuloma en el que participan PBMCs humanas es adecuado para el estudio de los cambios muy tempranos que ocurren en la expresion genica durante la induccion de la formacion del granuloma en respuesta a la infeccion por M. tuberculosis. El modelo puede ser usado para determinar cambios asociados a diferentes tipos de cepas de M. tuberculosis, incluyendo aislamientos clinicos. Este modelo pudiera ser de utilidad en el diseno de vacunas, para decidir cuales cepas serian mejores candidatos, tomando como base los perfiles especificos de expresion genica que ellas sean capaces de inducir.

Historia

Recibido: 8 mayo 2014

Revisado: 29 octubre 2014

Aceptado: 24 febrero 2015

Conflicto de interes:

Los autores declaran no tener ningun conflicto de intereses

Financiacion:

Universidad de Cartagena, Investigacion Intramural Grant.

Agradecimientos:

Este estudio fue apoyado por una beca de investigacion intramural otorgado por la Universidad de Cartagena al Investigador Principal Niradiz Reyes, PhD. Estamos agradecidos al Instituto Nacional de Salud de Colombia por la amabilidad de ofrecer la cepa H37Ra utilizada en el estudio.

Referencias

(1.) WHO. Global Tuberculosis. Geneva, Switzerland: 2012.

(2.) Parrish NM, Dick JD, Bishai WR. Mechanisms of latency in Mycobacterium tuberculosis. Trends Microbiol. 1998; 6(3): 107-12.

(3.) Glickman MS, Jacobs WR Jr. Microbial pathogenesis of Mycobacterium tuberculosis: dawn of a discipline. Cell. 2001; 104(4): 477-85.

(4.) Ramakrishnan L. Revisiting the role of the granuloma in tuberculosis. Nat Rev Immunol. 2012; 12(5): 352-66.

(5.) Zhu G, Xiao H, Mohan VP, Tsen F, Salgame P, and Chan J. Gene expression in the tuberculous granuloma: analysis by laser capture microdissection and real-time PCR. Cell Microbiol. 2003; 5(7): 445-53.

(6.) Davis JM, Ramakrishnan L. The role of the granuloma in expansion and dissemination of early tuberculous infection. Cell. 2009; 136(1):37-49.

(7.) Guirado E, Schlesinger LS. Modeling the Mycobacterium tuberculosis granuloma--the critical battlefield in host immunity and disease. Front Immunol. 2013; 4: 98.

(8.) Kunkel SL, Lukacs NW, Strieter RM, Chensue SW Animal models of granulomatous inflammation. Semin Respir Infect. 1998; 13(3): 221-8.

(9.) Davis JMC, H Lewis, J. L. Ghori, N. Herbomel, P. Ramakrishnan, L. Real-time visualization of Mycobacterium-macrophage interactions leading to initiation of granuloma formation in zebrafish embryos. Immunity. 2002; 17(6): 693-702.

(10.) Kapoor N, Pawar S, Sirakova TD, Deb C, Warren WL, Kolattukudy PE. Human granuloma in vitro model, for TB dormancy and resuscitation. PLoS One. 2013; 8(1): e53657.

(11.) Puissegur MP, Botanch C, Duteyrat JL, Delsol G, Caratero C, Altare F. An in vitro dual model of mycobacterial granulomas to investigate the molecular interactions between mycobacteria and human host cells. Cell Microbiol. 2004; 6(5): 423-33.

(12.) Birkness KA, Guarner J, Sable SB, Tripp RA, Kellar KL, Bartlett J, et al. An in vitro model of the leukocyte interactions associated with granuloma formation in Mycobacterium tuberculosis infection. Immunol Cell Biol. 2007; 85(2): 160-8.

(13.) Rivero-Lezcano OM. In vitro infection of human cells with Mycobacterium tuberculosis. Tuberculosis (Edinb) 2012; 93(2): 123-9.

(14.) Li C, Hung Wong W Model-based analysis of oligonucleotide arrays: model validation, design issues and standard error application. Genome Biol. 2001; 2(8): RESEARCH0032.

(15.) Dahlquist KD, Salomonis N, Vranizan K, Lawlor SC, Conklin BR. GenMAPP, a new tool for viewing and analyzing microarray data on biological pathways. Nat Genet. 2002; 31(1): 19-20.

(16.) Rajeevan MS, Ranamukhaarachchi DG, Vernon SD, Unger ER. Use of real-time quantitative PCR to validate the results of cDNA array and differential display PCR technologies. Methods. 2001; 25(4): 443-51.

(17.) Russell DG. Mycobacterium tuberculosis: here today, and here tomorrow. Nat Rev Mol Cell Biol. 2001; 2(8): 569-77.

(18.) Russell DG. Who puts the tubercle in tuberculosis. Nat Rev Microbiol. 2007; 5(1): 39-47.

(19.) Drage MG, Pecora ND, Hise AG, Febbraio M, Silverstein RL, Golenbock DT, et al. TLR2 and its co-receptors determine responses of macrophages and dendritic cells to lipoproteins of Mycobacterium tuberculosis. Cell Immunol. 2009; 258(1): 29-37.

(20.) Vignal C, Guerardel Y, Kremer L, Masson M, Legrand D, Mazurier J, et al. Lipomannans, but not lipoarabinomannans, purified from Mycobacterium chelonae and Mycobacterium kansasii induce TNF-alpha and IL-8 secretion by a CD 14-toll-like receptor 2-dependent mechanism. J Immunol. 2003; 171(4): 2014-23.

(21.) Quesniaux VJ, Nicolle DM, Torres D, Kremer L, Guerardel Y, Nigou J, et al. Toll-like receptor 2 (TLR2)-dependent-positive and TLR2-independent-negative regulation of proinflammatory cytokines by mycobacterial lipomannans. J Immunol. 2004; 172(7): 4425-34.

(22.) Harding CV, Boom WH. Regulation of antigen presentation by Mycobacterium tuberculosis: a role for Toll-like receptors. Nat Rev Microbiol. 2010; 8(4): 296-307.

(23.) Bergeron A, Bonay M, Kambouchner M, Lecossier D, Riquet M, Soler P, et al. Cytokine patterns in tuberculous and sarcoid granulomas: correlations with histopathologic features of the granulomatous response. J Immunol. 1997; 159(6): 3034-43.

(24.) Law K, Weiden M, Harkin T, Tchou-Wong K, Chi C, Rom WN. Increased release of interleukin-1 beta, interleukin-6, and tumor necrosis factoralpha by bronchoalveolar cells lavaged from involved sites in pulmonary tuberculosis. Am J Respir Crit Care Med. 1996; 153(2): 799-804.

(25.) Mehra S, Pahar B, Dutta NK, Conerly CN, Philippi-Falkenstein K, Alvarez X, et al. Transcriptional reprogramming in nonhuman primate (Rhesus macaque) tuberculosis granulomas. PLoS One. 2010; 5(8): e12266.

(26.) Jo EK, Park JK, Dockrell HM. Dynamics of cytokine generation in patients with active pulmonary tuberculosis. Curr Opin Infect Dis. 2003; 16(3): 205-10.

(27.) Sachse F, Ahlers F, Stoll W, Rudack C. Neutrophil chemokines in epithelial inflammatory processes of human tonsils. Clin Exp Immunol. 2005; 140(2): 293-300. 28

(28.) Donninger H, Glashoff R, Haitchi HM, Syce JA, Ghildyal R, van Rensburg E, et al. Rhinovirus induction of the CXC chemokine epithelial-neutrophil activating peptide-78 in bronchial epithelium. J Infect Dis. 2003; 187(11): 1809-17.

(29.) Jang S, Uzelac A, Salgame P. Distinct chemokine and cytokine gene expression pattern of murine dendritic cells and macrophages in response to Mycobacterium tuberculosis infection. J Leukoc Biol. 2008; 84(5): 1264-70.

(30.) Algood HM, Lin PL, Flynn JL. Tumor necrosis factor and chemokine interactions in the formation and maintenance of granulomas in tuberculosis. Clin Infect Dis. 2005; 41(3): S189-93.

(31.) Kaufmann SH. Protection against tuberculosis: cytokines, T cells, and macrophages. Ann Rheum Dis. 2002; 61(2): 54-8.

(32.) Lazarevic V, Yankura DJ, DiVito SJ, Flynn JL. Induction of Mycobacterium tuberculosis-specific primary and secondary T-cell responses in interleukin-15-deficient mice. Infect Immun. 2005; 73(5): 2910-22.

(33.) O'Kane CM, Boyle JJ, Horncastle DE, Elkington PT, Friedland JS. Monocyte-dependent fibroblast CXCL8 secretion occurs in tuberculosis and limits survival of mycobacteria within macrophages. J Immunol. 2007; 178(6): 3767-76.

(34.) Perskvist N, Long M, Stendahl O, Zheng L. Mycobacterium tuberculosis promotes apoptosis in human neutrophils by activating caspase-3 and altering expression of Bax/Bcl-xL via an oxygen-dependent pathway. J Immunol. 2002; 168(12): 6358-65.

(35.) Placido R, Mancino G, Amendola A, Mariani F, Vendetti S, Piacentini M, et al. Apoptosis of human monocytes/macrophages in Mycobacterium tuberculosis infection. J Pathol. 1997; 181(1): 31-8.

(36.) Behar SM, Martin CJ, Booty MG, Nishimura T, Zhao X, Gan HX, et al. Apoptosis is an innate defense function of macrophages against Mycobacterium tuberculosis. Mucosal Immunol. 2011; 4(3): 279-87.

(37.) Lieberman J. Granzyme A activates another way to die. Immunol Rev. 2010; 235(1): 93-104.

(38.) Getachew Y, Stout-Delgado H, Miller BC, Thiele DL. Granzyme C supports efficient CTL-mediated killing late in primary alloimmune responses. J Immunol. 2008; 181(11): 7810-7.

(39.) Stoeckle C, Gouttefangeas C, Hammer M, Weber E, Melms A, Tolosa E. Cathepsin W expressed exclusively in CD8+ T cells and NK cells, is secreted during target cell killing but is not essential for cytotoxicity in human CTLs. Exp Hematol. 2009; 37(2): 266-75.

(40.) Ruttkay-Nedecky B, Nejdl L, Gumulec J, Zitka O, Masarik M, Eckschlager T, et al. The role of metallothionein in oxidative stress. Int J Mol Sci. 2013; 14(3): 6044-66.

(41.) Aydemir TB, Blanchard RK, Cousins RJ. Zinc supplementation of young men alters metallothionein, zinc transporter, and cytokine gene expression in leukocyte populations. Proc Natl Acad Sci USA. 2006; 103(6): 1699-704.

(42.) Ochieng J, Chaudhuri G. Cystatin superfamily. J Health Care Poor Underserved. 2010; 21(Suppl 1): 51-70.

(43.) Volkman HE, Pozos TC, Zheng J, Davis JM, Rawls JF, Ramakrishnan L. Tuberculous granuloma induction via interaction of a bacterial secreted protein with host epithelium. Science. 2010; 327(5964): 466-9.

(44.) Elass E, Aubry L, Masson M, Denys A, Guerardel Y, Maes E, et al. Mycobacterial lipomannan induces matrix metalloproteinase-9 expression in human macrophagic cells through a Toll-like receptor 1 (TLR1)/TLR2- and CD14-dependent mechanism. Infect Immun. 2005; 73(10): 7064-8.

(45.) Kaufmann SH. The contribution of immunology to the rational design of novel antibacterial vaccines. Nat Rev Microbiol. 2007; 5(7): 491-504.

(46.) Martinez AN, Mehra S, Kaushal D. Role of interleukin 6 in innate immunity to Mycobacterium tuberculosis infection. J Infect Dis. 2013; 207(8): 1253-61.

Niradiz Reyes [1], Alfonso Bettin [1], Ismael Reyes [2], Jan Geliebter [3]

[1] Research Group of Genetics and Molecular Biology. University of Cartagena. Cartagena, Colombia

[2] Westchester Medical Center, Valhalla, NY, United States

[3] New York Medical College, Valhalla, NY, United States

Autor de correspondencia:

Niradiz Reyes. University of Cartagena. Cartagena, Colombia. Associate Professor.

Department of Basic Sciences. School of Medicine. University of Cartagena.

Cartagena--Colombia. E-mail: nreyesr@unicartagena.edu.co
Tabla 1. Vias biologicas alteradas identificadas en los granulomas
in vitro

Identificacion de           Genes      Gen (fold change)
la via Biologica         alterados *

Interaccion                  11        TLR-2(2.7), TLR-6(-2.7), CD14
Hospedador-patogeno                    molecule A157(4.0),
                                       CD86(3.8),
                                       MYD88(3.4),STAT4(3.6),
                                       STAT1(16.7), STAT6(2.9),
                                       ILIR-associated kinase1(7.5),
                                       IL8(11.7), IL6(8.8)

Complejo Mayor de            10        MHC-IB(2.6), MHC-IC(5.3),
Histocompatibilidad                    MHC-IE(2.6), MHC-IF(3.9),
                                       MHC-IIDMalpha(3.7),
(MHC I/II)                             MHC-IIDOalpha(7.6), MHC-
                                       IIDPalpha1(6.8),
                                       MHC-IIDPbeta1(8.2),
                                       MHC-IIDQalpha1(6.9),
                                       MHC-IIDRalpha(6.0)

Via de senalizacion           5        IL1-alpha(4.3),
de la IL1                              IL1-beta(4.4),
                                       ILIR-associated kinase1(7.5),
                                       SRPalpha(3.13), calpain small
                                       subunit1(5.6)

Via de senalizacion           8        TNF-member2 (3.8), activador
TNF-[alfa]-NFkB                        de NFkB TRAF-asociado (4,75),
                                       TNFRSF1A asociado-a traves de
                                       dominio de muerte (9,0),
                                       TNFAIP3 protein2 interactuar
                                       (9.3), Factor5 TNFR-asociado
                                       (3.5), factor de TNFR-1
                                       asociada (11.5), protein3
                                       inducida por TNF-(3.5),
                                       TNFR-1B (3,0)

Via de senalizacion          11        IFN (7.0), CathepsinA (3.0),
del [IFN.sub.[gamma]]                  CathepsinC (3.3), IFNgammaR1
                                       (3.6), estimulada por IFN,
                                       TF3 gamma 48kDa (9.3), IFI44L
                                       (18,0), IL1beta (4.5), MHC-IB
                                       (3,5), NKp46 (3.6), NKTR
                                       (6.8), subfamilyB
                                       ABC-transporter1 (7.3)

Respuesta inflamatoria       27        XCL1 (3.7), XCL2 (5.1), CCL2
y quimiocinas                          (8.3), CCL4 (10.0), CCL5
                                       (5.7), CCL7 (5.6), CCL8
                                       (11.1), CCL18 (10.3), CCL19
                                       (2,15), CCL20 (8.9), CD86
                                       (3.8), CXCL1 (2.1), CXCL2
                                       (8.3), CXCL5 (11.6), CXCL10
                                       (7.7), CCR2 (3.8), CXCR4
                                       (7.1), IL12p40 (IL12B) (-
                                       3,3), IL15 (4,7), IL15Ralpha
                                       (5.8), IL2Ralpha (4.8),
                                       IL2Rgamma (4.6), IL4R (2.9),
                                       IL6 (8,8), de linfocitos
                                       especifica de la proteina
                                       tirosina quinasa (2.9),
                                       secuencia de reconocimiento
                                       de NK-tumor (6.8), la
                                       adhesion molecule1 de
                                       regulacion (7.2)

Apoptosis                    26        Apoptosis factor de
                                       transcripcion antagonizar
                                       (4,1), inhibidor de la
                                       activacion de la caspasa
                                       apoptosis (2,7), factor
                                       mitocondria-associated2
                                       inductor de apoptosis (2,4),
                                       domain1 TAF9-como inductor de
                                       apoptosis (2,1), baculoviral
                                       IAP repeticion-containing2
                                       (2.8), BCL2 (3,0 ),
                                       Componente3 vinculante BCL2
                                       (5.6), X proteina
                                       BCL2-asociado (3,2),
                                       BCL2-like2 (3.7), BH3
                                       agonista interactuar muerte
                                       de dominio (6.9), CASP8 y
                                       FADD-como regulador de la
                                       apoptosis (10.4), la
                                       caspasa-1 (5,0 ), caspasa-2
                                       (2.2), la caspasa-3 (3,7), la
                                       caspasa-4 (4,5), la caspasa-9
                                       (2.9), la cistatina-A (7,7),
                                       la cistatina-B (6,6), la
                                       cistatina-C (6,1) , dano de
                                       ADN especifico vinculante
                                       protein2 48kDa (7,4), el
                                       defensa contra muerte1 celda
                                       (3,5), el dano de
                                       ADN-inducible transcript3
                                       (11,6), Fas (7.1),
                                       granulisina (6.9), granzymeA
                                       (4.4), granzymeB (9.6),
                                       granzymeH (3.2)

Estres oxidativo             16        Activador de plasminogeno,
                                       receptor de uroquinasa (5.2),
                                       proteina de union a ADN TAR
                                       (4.3), metalotioneina 1X
                                       (46.0), 1H metalotioneina
                                       (36.2), 1E metalotioneina
                                       (33.0), la metalotioneina 1G
                                       (32.5), la metalotioneina 1 M
                                       (30,9), 1F metalotioneina
                                       (29.8), inhibidor de
                                       peptidasa de serina, Kazal
                                       tipo 1 (30.8), MMP9 (10.8),
                                       la fosfolipasa A2 groupIVB
                                       (4.6), SOD1 (3.7),
                                       peroxidase1 glutation (6,1),
                                       glutation peroxidasa 4 (3,6),
                                       SOD2 (3.4), TP53 (3.0),

* Total numero de genes alterados

Tabla 2. Validacion por PCR cuantitativo en tiempo real de un grupo
seleccionado de genes

Gen                 Forward/Reverse Primer *      PCR cuantitativo

                    5'.......3'                Fold change   valor p

CCL2                GCCTCCAGCATGAAAGTCTC           6.0       0.0005
                    CAGATCTCCTTGGCCACAAT
Cistatina B         AGTCATTCAAGAGCCAGGTG          96.1       0.0056
                    AGCTCATCATGCTTGGCTTT
Granzima B          GGGGGACCCAGAGATTAAAA          76.0       0.0011
                    GTGGCGTTTCATGGTTTTCT
Interleuquina 8     GTGCAGTTTTGCCAAGGAGT          43.0       0.0001
                    CTCTGCACCCAGTTTTCCTT
Metalotioneina 1H   CTTGCAATGGACCCCAACT           39.0       0.0386
                    CAGCAGCTGCACTTCTCTGA
Granulisina         CCAGGTCTGGTCTTCTCTCG          41.0       0.0001
                    TGGGCTTATCCACCATCTTC
CCL4                GCTTCCTCGCAACTTTGTGGTAG       12.6       0.0001
                    GGTCATACACGTACTCCTGGAC
CCL5                CCTGCTGCTTTGCCTACATTGC        15.7       0.0020
                    ACACACTTGGCGGTTCTTTCGG
Interleuquina 6     AGACAGCCACTCACCTCTTCAG        28.6       0.0001
                    TTCTGCCAGTGCCTCTTTGCTG
CCL20               AAGTTGTCTGTGTGCGCAAATCC       17.9       0.0001
                    CCATTCCAGAAAAGCCACAGTTTT

Gen                 Forward/Reverse Primer *       Micromatrices

                    5'.......3'                Fold change   valor p

CCL2                GCCTCCAGCATGAAAGTCTC          +8.34      0.0001
                    CAGATCTCCTTGGCCACAAT
Cistatina B         AGTCATTCAAGAGCCAGGTG          +6.58      0.0045
                    AGCTCATCATGCTTGGCTTT
Granzima B          GGGGGACCCAGAGATTAAAA          +9.6       0.0015
                    GTGGCGTTTCATGGTTTTCT
Interleuquina 8     GTGCAGTTTTGCCAAGGAGT         +11.69      0.0001
                    CTCTGCACCCAGTTTTCCTT
Metalotioneina 1H   CTTGCAATGGACCCCAACT          +36.17      0.0000
                    CAGCAGCTGCACTTCTCTGA
Granulisina         CCAGGTCTGGTCTTCTCTCG          +6.94      0.0041
                    TGGGCTTATCCACCATCTTC
CCL4                GCTTCCTCGCAACTTTGTGGTAG       +10.0      0.0045
                    GGTCATACACGTACTCCTGGAC
CCL5                CCTGCTGCTTTGCCTACATTGC        +5.7       0.0015
                    ACACACTTGGCGGTTCTTTCGG
Interleuquina 6     AGACAGCCACTCACCTCTTCAG        +8.8       0.0001
                    TTCTGCCAGTGCCTCTTTGCTG
CCL20               AAGTTGTCTGTGTGCGCAAATCC       +8.9       0.0015
                    CCATTCCAGAAAAGCCACAGTTTT

* Los cebadores fueron disenados con el programa Primerblast y
sintetizados por IDT technologies
COPYRIGHT 2015 Facultad de Salud-Universidad de Valle
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Reyes, Niradiz; Bettin, Alfonso; Reyes, Ismael; Geliebter, Jan
Publication:Colombia Medica
Date:Jan 1, 2015
Words:6669
Previous Article:El dengue en un area del Caribe Colombiano, 2003-2010.
Next Article:Practica basada en la evidencia: creencias, actitudes, conocimientos y habilidades entre fisioterapeutas colombianos.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters