Printer Friendly

Activation-induced cytidine deaminase expression in diffuse large B-cell lymphoma with a paracortical growth pattern: a lymphoma of possible interfollicular large B-cell origin.

Diffuse large B-cell lymphoma (DLBCL) is a heterogeneous group of neoplasms, with the mean age of patients at diagnosis in the sixth or seventh decade of life. (1) Many recent studies have used immunophenotypic markers to subclassify diffuse large cell lymphomas into prognostic groups or groups with similar behavior. Coexpression of CD10 and BCL-6 has been used as a marker of presumptive germinal center origin and has also been suggested to have prognostic implications, but this remains controversial. (2-7) Conflicting data exist for [CD10.sup.+] DLBCL, with some authors reporting better survival (4) and others reporting shortened survival, (6) particularly in association with BCL-2 positivity. (7)

More recently, gene expression profiling has been used to distinguish 2 types of DLBCLs with either a germinal center or an activated B-cell phenotype; the former has a better prognosis. (7,8) A third type, with nongerminal center, nonactivated type 3, has been also described. (7,9) In other studies, diffuse large B-cell lymphoma has been stratified into germinal center, postgerminal center, and plasmablastic types. (2)

Activation-induced cytidine deaminase (AID), a protein necessary for somatic hypermutation and class switch recombination, is expressed in the germinal center (10) and in extrafollicular large proliferating B cells. (11) These extrafollicular B cells lack early and late plasma cell markers. (11,12) Some authors (12) have suggested that the extrafollicular or interfollicular large B cells are putative precursors for mature B-cell malignancies.

In this study, we describe DLBCL with an unusual paracortical pattern of lymph node involvement (PCLBCL) that does not fit the germinal center phenotype but may best fit the postgerminal center type of B-cell lymphoma, as described by Colomo et al. (2) We propose that a possible cell origin for these nongerminal center/ postgerminal center lymphomas is AID antigen--positive interfollicular B cells. It is important to study this subtype because it may lead to further understanding of diffuse large B cell lymphoma; its recognition may eliminate underdiagnoses as reactive immunoblastic paracortical hyperplasia.

MATERIALS AND METHODS

Specimens

Cases diagnosed as diffuse large B-cell lymphoma, with a paracortical distribution and atypical paracortical immunoblastic hyperplasias, were identified. Reactive lymph nodes were excluded, such as florid follicular hyperplasia and reactive changes confirmed or clinically suspected from viral etiology, autoimmune disease, dermatopathic origin, and other nonmalignant pathologic diagnoses. All cases with available slides, tissue, and clinical information were retrieved. Limited histories were available for the cases. Institutional guidelines were followed regarding the use of all material and clinical follow-up and institutional review board approval was obtained.

Immunohistochemistry

Five-micron sections from paraffin-embedded tissue blocks were prepared for immunophenotypic analysis according to the standard avidin-biotin complex method of Hsu et al. (13) Sections were incubated at room temperature for 30 minutes with the following antibody panel: CD3, CD20, BCL-2, CD30, CD43, CD10, CD5, CD23, CD27, BCL-6, CD38, PAX5, MUM1, latent membrane protein (LMP-1), AID, and [kappa] and [lambda] light chains (Table 1). Immunoperoxidase staining with CD3, [kappa], and [lambda] required predigestion for 20 minutes at 40[degrees]C to 42[degrees]C with 0.4% pepsin (P-7000, Sigma Chemical Company, St Louis, Missouri) in a buffer solution of 0.1-mol/L hydrochloric acid at pH 2.0.

Double immunostaining of AID/CD20 and AID/PAX5 was performed by using Ventana Benchmark autostainer (Ventana Medical Systems, Inc, Tucson, Arizona) with standard immunohistochemistry protocols suggested by the manufacturer. The detection systems are from Ventana (ultraView Universal Alkaline Phosphatase Red Detection Kit, catalog number 760-501 and ultraView Universal DAB Detection Kit, catalog number 760-500). The dilution of the antibody is 1:200 for AID (LifeSpan Biosciences, Inc, Seattle, Washington) and 1: 800 for CD20; PAX5 is prediluted.

We used modified criteria of Marafioti et al (14) for positive staining with antibodies. Immunoreactivity in most investigated interfollicular cells (80%) was necessary for positive staining. We defined "focal" immunohistochemical staining as staining present in limited areas of the malignant cells but meeting the criteria for positive staining in the area, whereas "weak" staining met the cutoff criteria of 80% but staining was lighter.

Four reactive cases were examined for immunoreactivity with AID. They included human immunodeficiency virus--related florid follicular hyperplasia; florid follicular hyperplasia, not otherwise specified; atypical paracortical immunoblastic hyperplasia, documented post-vaccinally; and paracortical immunoblastic hyperplasia, not otherwise specified.

In Situ Studies.--In situ hybridization for the presence of Epstein-Barr virus encoded RNA (EBER) was performed on sections of paraffin-embedded tissue with the in situ INFORM EBER probe (Ventana, catalog number 780-2842). The test is performed on the Benchmark autostainer (Ventana). The manufacturer's instructions were used with no modifications.

T-Cell Receptor [beta] and Immunoglobulin Heavy-Chain Gene Rearrangement

Molecular diagnostic studies were performed by polymerase chain reaction (PCR) from available formalin fixed, paraffin-embedded tissue in 6 of 7 cases. Studies included evaluation for immunoglobulin heavy-chain (IgH) rearrangement, T-cell receptor (TCR) [beta] rearrangement, and t(14;18) chromosomal translocation to detect the major breakpoint region and the minor cluster region.

Immunoglobulin H gene rearrangement was detected by a published PCR method with consensus primers FR3A (IgH V [variable] region) and CFW1 (IgH J [joining] region). (15) T-cell receptor b rearrangement was detected by a published PCR method by using 4 sets of primer pairs (VJ1, VJ2, D1J2, and D2J2), as previously described. (15) T-cell receptor [beta] gene rearrangement has been described in a small percentage of B-cell lymphomas; the assay may increase the sensitivity of clonality detection by PCR in B-cell lymphomas. (16) T-cell receptor [gamma] assay (1 case) was performed as previously described. (15) Assays for t(14;18) were performed in 6 of 7 cases. The major breakpoint region of t(14;18) was detected by primers CH18-515 and CFW1 and probes pMBR, which have been previously described. (17) Minor cluster region (MCR) rearrangements were detected by PCR, as follows. Polymerase chain reaction primers were MC11 (CATAACATAGGCAAGAGCCC) and MCR2 (TCCAGAGCAGACCTTGT), both from the MCR region of chromosome 18, and CFWIV (ACCTGAGGAGACGGTGACC) from the IgH J region of chromosome 14. Polymerase chain reaction thermocycling parameters were 95[degrees]C for 10 minutes (1 cycle); 94[degrees]C for 1 minute/60[degrees]C for 1 minute/72[degrees]C for 1 minute (40 cycles)/ 72[degrees]C for 7 minutes (1 cycle). Polymerase chain reaction products were analyzed by Southern blot after agarose gel electrophoresis by using probes MC7 (TCAGTCTCTGGGGAGGAGTGGA) and MC-P3 (CATTGAGTTATTTGTCTTTTGAT). Probes were labeled with digoxigenin, and blots were developed by using the alkaline phosphatase--labeled anti-digoxigenin antibodies and the CDP-Star reagent (Roche, Germany) to generate a chemiluminescent signal. All PCR assays included negative controls to rule out contamination and amplification controls to ensure that adequate quality DNA was extracted from the paraffin-embedded tissue specimens.

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

[FIGURE 3 OMITTED]

RESULTS

Specimens and Clinical Findings

Seven cases of PCLBCL were studied (Table 2) that included 3 males and 4 females ranging in age from 11 to 59 years (mean, 39 years). In 3 of 5 cases, initially called "atypical paracortical hyperplasia," the patients were 25 years or less. The anatomic site of disease in all cases was a lymph node (4 in the groin; 2 in the neck; and 1 in the axilla).

Histologic Findings

Cases 1, 2, 5, 6, and 7 showed preservation of the lymph node architecture. Residual reactive germinal centers and an expanded paracortical proliferation of immunoblastic large cells with prominent nucleoli, singly and in small clusters, and small background lymphocytes were present. Two of 7 cases showed partial effacement of the lymph node architecture, with some reactive germinal centers and a paracortical proliferation composed of sheets of immunoblastic large cells and small lymphocytes (Figures 1 and 2). One case was notable for increased eosinophils in the background cells. No marginal zone hyperplasia was identified in any of the cases.

Immunohistochemistry Findings

Immunohistochemical findings are listed in Table 3. All cases were positive for CD20 (Figure 3, A). Activation-induced cytidine deaminase was coexpressed in 4 of 4 cases tested (Figure 3, B). Double labeling with AID (AEC-red) and CD20 (DAB-brown) is shown in Figure 3, C. Activation-induced cytidine deaminase in the interfollicular large B cells showed intense cytoplasmic staining. The residual germinal centers showed weaker cytoplasmic staining in the dark zone, with scattered centroblasts in the germinal center and mantle zone that showed a similar intense staining pattern as the interfollicular B cells. The interfollicular B cells were negative for CD5 and CD10. CD3 was immunoreactive in small T cells. Staining for CD30, CD43, and BCL-2 was variable (Figure 4). In 1 of 6 cases, BCL-6 was immunoreactive--defined as greater than 10% nuclear staining--in a low percentage of cells (20%). One of 6 cases was immunoreactive for CD23 and 1 of 6 was immunoreactive for CD38. Immunoglobulin light-chain restriction was noted in 4 of 7 cases (Figure 5, A and B). Results with latent membrane protein-1 for Epstein-Barr virus were negative in 6 of 7 cases and equivocal in 1 case (EBER could not be performed in this case). MUM1 was focally immunoreactive in 4 of 4 cases tested. CD27 was focally and weakly positive in 4 of 5 cases tested. Epstein-Barr virus encoded RNA in situ hybridization showed negative results in 4 of 4 cases tested.

Reactive cases are seen in Figures 6 and 7. Paracortical immunoblastic hyperplasia (Figure 6, A) is shown with CD20 for reference (Figure 6, B). Activation-induced cytidine deaminase shows staining in the centroblasts of the germinal center, with scattered large cells in the paracortex (Figure 6, C). CD20 stains similar large cells in the paracortex. Double staining shows that many of the [CD20.sup.+] cells also stain with AID. Florid follicular hyperplasia, not otherwise specified (Figure 7, A) shows more intense staining of the dark zone, with AID and scattered large cells showing intense staining outside the follicle (Figure 7, B and C). Human immunodeficiency virus--related florid follicular hyperplasia is similar to other florid follicular hyperplasias; AID shows more intense staining in the dark zone of the germinal center, with intensely stained, rare, scattered large cells outside the follicle. Atypical paracortical hyperplasia documented post-vaccinally, (not shown in the figures) also yielded similar findings, although germinal centers were difficult to demonstrate, with numerous T immunoblasts and rare scattered B immunoblasts. Double staining showed rare AID/CD20 staining.

[FIGURE 4 OMITTED]

Molecular Studies

Molecular studies are listed in Table 4. Five of 6 cases showed IgH gene rearrangement, 1 in conjunction with a TCRb gene rearrangement. All cases showed either immunoglobulin light-chain restriction, IgH gene rearrangement, or both. No case demonstrated t(14;18).

COMMENT

We describe a variant of DLBCL with distinct localization of the malignant cells to the paracortical region, with at least partial preservation of the lymph node architecture, with light-chain restriction and/or gene rearrangement studies supporting the diagnosis. This variant is distinct from other subtypes in the World Health Organization classification with respect to the morphologic pattern of the malignant cells and the preservation of the lymph node architecture. Of interest was 1 case with increased eosinophils, an uncommon, but well-described finding in B-cell malignant lymphomas. (18,19) In our 7 cases, patients at presentation are younger than typically seen in DLBCL. The large B cells were consistently reactive for CD20, with partial expression of BCL-2. Only 1 case each was reactive for CD23, CD38, or BCL-6. The morphologic and phenotypic features were not typical of germinal center cells, naive/mantle zone cells, or memory B cells. The large B cells in our PCLBCL cases resemble and have a immunophenotype similar to that of the large interfollicular B cells, recently described in reactive lymph nodes, (14) and shown to be immunoreactive for CD20, with negative staining for CD5, CD23, CD10, BCL-6, and CD38. (14) In a similar study, interfollicular B cells showed AID expression. (12) A study of diffuse large B-cell lymphoma with an interfollicular pattern shows similarity to our cases (20) and is further evidence of the interfollicular B cells as the possible origin of these lymphomas. There was some variability in the immunophenotype observed in our cases and that reported in studies of interfollicular B cells, (14,20) but a general morphologic appearance and immunophenotype is present. Examples of immunophenotypic variability have been observed when previous studies attempted to subclassify DLBCLs, (2,9) a fact highlighting the need to study similar morphologic cases to determine if there is a consistent immunophenotype.

[FIGURE 5 OMITTED]

Three common morphologic variants are recognized in the most recent World Health Organization classification. (1) The clinical relevance of the morphologic variants has been investigated, with the distinction between immunoblastic and centroblastic lymphomas reported to be a significant prognostic risk factor in at least some studies. (21,22) Several studies have shown that T-cell/histiocyterich B-cell lymphoma is a unique clinicopathologic entity (23-27) and is now considered a unique subtype of DLBCL. [CD30.sup.+] anaplastic B-cell lymphomas also have distinct features among DLBCLs. (26)

Immunohistochemical and molecular genetic studies are now being used to distinguish not only morphologic characteristics but also phenotypic and genotypic differences that may be distinctive and of prognostic significance in DLBCL. (1) Recently published studies (2,28-30) have used immunohistochemical markers to propose the stage of B-cell differentiation or the type of B cell in a variety of clinical lymphoma entities, both Hodgkin and nonHodgkin type. BCL-6 is a transcription factor highly expressed in germinal center B cells but not in pregerminal B-cells, postgerminal memory cells, or plasma cells. (31,32) However, BCL-6 staining may not be entirely specific for follicular center cell origin. (3) CD138/syndecan-1 protein positivity has been used as a marker for postgerminal center cell origin with MUM1 representing a transition between BCL-6-positive germinal cells and [CD138.sup.+] plasma cells and immunoblasts. (33) CD27 is also used as a marker of memory B cells and a differentiating marker from monocytoid B cells. (14)

[FIGURE 6 OMITTED]

[FIGURE 7 OMITTED]

CD10 expression alone or CD10 with BCL-6 expression has been used as a marker of germinal center cells (9) and is often associated with t(14;18) chromosomal translocations. (34,35) In 1 study, DLBCL with t(14;18) most frequently expressed BCL-2 and BCL-6. However, in cases negative for t(14;18), no inverse relationship was observed between BCL-2 and BCL-6, thus suggesting the existence of mechanisms other than gene rearrangements for the expression of BCL-2 and BCL-6. (36) It has been suggested that a diffusely dense or uniform pattern of BCL-6 positivity should be distinguished from a nonuniform or a sporadic pattern because the former may be associated with germinal center origin, whereas the latter has more likely a nongerminal center origin. (23,34,37-39) Expression of BCL-2 does not correlate with CD10/BCL-6 coexpression. (34,38)

DNA microarrays have also been used to further divide DLBCL into distinct molecular groups. (8) Recently, immunohistochemistry has been shown to correlate with the germinal center B-cell-like, activated B-cell-like, and type 3 B-cell groups. (9) CD10 and t(14;18) are frequently present in the germinal center group, with no difference in BCL-2 or BCL-6 expression in the germinal center or activated B-cell group. (34) Colomo et al (2) divide diffuse large B-cell lymphomas into germinal center, postgerminal center, and plasmablastic groups with patterns of immunohisto chemistry including CD10, bcl-6, MUM1, and CD138.

Activation-induced cytidine deaminase is necessary for somatic hypermutation and class switch recombination. It is expressed in the germinal center and in extrafollicular proliferating large B cells. These extrafollicular B cells lack early and late plasma cell markers. (11) The pattern of immunoreactivity can be both cytoplasmic and nuclear.11 The pattern of staining in our cases of PCLBCL was similar to that demonstrated in normal lymphoid tissue in previous reports. (11,40) The malignant interfollicular large B cells and scattered centroblasts in the germinal center and mantle zones were intensely immunoreactive in a cytoplasmic pattern. The germinal center B cells were positive in a cytoplasmic pattern in the dark zone. Staining results in the light zone were negative. Activation-induced cytidine deaminase is present in nodular lymphocytepredominant and classical Hodgkin lymphoma. (40) Activation-induced cytidine deaminase has been also demonstrated in activated B-cell-like diffuse large B-cell lymphoma and germinal center lymphoma that has transformed to DLCBL. This finding may show dissociation between AID expression and other germinal center genes. (41) Activation-induced cytidine deaminase has not been reported in diffuse large B-cell lymphoma with an interfollicular or paracortical pattern.

We report similar morphologic findings to those of Yamauchi et al, (20) who described an interfollicular pattern in diffuse large B-cell lymphoma. Six of 7 cases in our report are postgerminal center (2) or nongerminal center groups, (9) similar to those of Yamauchi et al. These authors (20) suggested that DLCBL with an interfollicular pattern may be a neoplasm of interfollicular large B-cells. Moldenhauer et al (12) described AID expression in interfollicular large B cells. We show that AID is expressed in the large B cells of the PCLBCL we have reported and speculate that these interfollicular large B cells may be putative precursors for this PCLBCL. Because analysis of AID expression has had limited use in paraffin-embedded tissue due to limited antibody availability, the examination of extensive subtypes of diffuse large B-cell lymphomas has not been accomplished, although it may be useful. Specifically, diffuse large B-cell lymphomas that have a similar appearance and immunophenotype, such as DLBCL, leg type, should be examined. (42)

The aforementioned DLBCLs illustrate the heterogeneity of this group of lymphomas; the attempt to define subgroups, and the origin of the B cells that compose them, is an important step in understanding B-cell lymphoma and its development. We report 7 cases of diffuse large cell lymphoma with distinct paracortical localization, with malignancy confirmed by light-chain restriction and/or gene rearrangement studies as well as AID expression. The cell of origin may be a large interfollicular B cell but this is uncertain. More study is necessary to determine the behavior of these tumors.

References

(1.) Swerdlow SH, Campo E, Harris NL, et al, eds. Tumours of Haematopoietic and Lymphoid Tissues. Lyon, France: IARC Press;2008. World Health Organization Classification of Tumours; vol 3.

(2.) Colomo L, Lopez-Guillermo A, Perales M, et al. Clinical impact of the differentiation profile assessed by immunophenotyping in patients with diffuse large B-cell lymphoma. Blood. 2003;101:78-84.

(3.) King BE, Chen C, Locker J, et al. Immunophenotypic and genotypic markers of follicular center cell neoplasia in diffuse large B-cell lymphomas. Mod Pathol. 2000;13:1219-1231.

(4.) Ohshima K, Kawasaki C, Muta K, et al. CD10 and Bcl10 expression in diffuse large B-cell lymphoma: CD10 is a marker of improved prognosis. Histopathology. 2001;39:156-162.

(5.) Pileri SA, Dirnhofer S, Went P, et al. Diffuse large B-cell lymphoma: one or more entities--present controversies and possible tools for it subclassification. Histopathology. 2002;41:482-509.

(6.) Uherova P, Ross CW, Schnitzer B, Singleton TP, Finn WG. The clinical significance of CD10 antigen expression in diffuse large B-cell lymphoma. Am J Clin Pathol. 2001;115:582-588.

(7.) Xu Y, McKenna RW, Molberg KH, Kroft SH. Clinicopathologic analysis of CD10+ adn CD10- diffuse large B-cell lymphoma: idenitification of high risk subset with coexpression of CD10 and bcl-2. Am J Clin Pathol. 2001;116:183-190.

(8.) Aliadeh AA, Eisen MB, Davis RE, et al. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature. 2000;403:503- 511.

(9.) Hans CP, Weisenburger DD, Greiner TC, et al. Confirmation of molecular classification of diffuse large B-cell lymphoma by immunohistochemistry using a tissue microarray. Blood. 2004;103:275-282.

(10.) Pasqualucci L, Guglielmino R, Houldsworth J, et al. Expression of the AID protein in normal and neoplastic B cells. Blood. 2004;104:3318-3325.

(11.) Cattoretti G, Buttner M, Shaknovich R, Kremmer E, Alobeid B, Niedobitek G. Nuclear and cytplasmic AID in extrafollicular and germinal center B cells. Blood. 2006;107:3967-3975.

(12.) Moldenhauer G, Popov SW, Wotschke B, et al. AID expression identifies interfollicular large B cells as putative precursors ofmature B-cell malignancies. Blood. 2006;107:2470-2473.

(13.) Hsu SM, Raine L, Fanger H. Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: a comparison between ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem. 1981;29:577- 580.

(14.) Marafioti T, Jones M, Facchetti F, et al. Phenotype and genotype of interfollicular large B cells, a subpopulation of lymphocytes often with dendritic morphology. Blood. 2003;102:2868-2876.

(15.) Abruzzo LV, Griffith LM, Nandedkar M, et al. Histologically discordant lymphomas with B-cell and T-cell components. Am J Clin Pathol. 1997;108:316 323.

(16.) Krafft AE, Taubenberger JK, Sheng Z-M, et al. Enhanced sensitivity with a novel TCR gamma PCR assay for clonality studies in 569 formalin-fixed, paraffin embedded (FFPE) cases. Mol Diagn. 1999;4:119-133.

(17.) Abbondanzo SL, Rush W, Bijwaard KE, Koss MN. Nodular lymphoid hyperplasia of the lung: a clinicopathologic study of 14 cases. Am J Surg Pathol. 2000;24:587-597.

(18.) Navarro-Roman L, Mederios LJ, Kingma DW, et al. Malignant lymphomas of B-cell lineage with marked tissue eosinophilia: a report of five cases. Am J Surg Pathol. 1994;18:347-356.

(19.) Watanabe K, Shinbo T, Kojima M, Naito M, Tanahashi N, Nara M. B- cell lymphoma associated with eosinophilia. Cancer. 1989;64:1682-1685.

(20.) Yamauchi A, Ikeda J, Nakamichi I, et al. Diffuse large B-cell lymphoma showing an interfollicular pattern of proliferation: a study of the Osaka Lymphoma Study Group. Histopathology. 2008;52:731-737.

(21.) Baars JW, de Jong D, Willemse EM, et al. Diffuse large B-cell non-Hodgkin lymphomas: the clinical relevance of histologic subclassification. Br J Cancer. 1999;79:1770-1776.

(22.) Englehard M, Brittinger G, Huhn D, et al. Subclassification of diffuse large B-cell lymphomas according to theKeil Classification: distinction of centroblastic and immunoblastic lymphomas is a significant prognostic risk factor. Blood. 1997;89:2291-2297.

(23.) Achten R, Verhoef G, Vanuytsel L, De Wolf-Peeters. Histiocyte- rich, T-cell-rich B-cell lymphoma: a distinct diffuse large B-cell lymphoma subtype showing characteristic morphologic and immunophenotypic features. Histopathology. 2002;40:31-45.

(24.) Haralambieva E, Pulford KAF, Lamant L, et al. Anaplastic large- cell lymphomas of B-cell phenotype are anaplastic lymphoma kinase (ALK) negative and belong to the spectrum of diffuse large B-cell lymphoma. Br J Haematol. 2000;109:584-591.

(25.) Lim MS, Beaty M, Sorbara L, et al. T-cell/histiocyte-rich large B-cell lymphoma: a heterogeneous entity with derivation from germinal center B cells. Am J Surg Pathol. 2002;26:1458-1466.

(26.) MaesB, Anastasopoulou A, Kluin-Nelemans JC, et al. Among diffuse large B-cell lymphomas, T-cell-rich/histiocyte-rich BCL and CD30+anaplastic large B-cell subtypes exhibit distinct clinical features. Ann Oncol. 2001;12:853- 858.

(27.) Tsirigotis P, Economopoulos T, Rontogianni D, et al. T-cell-rich B-cell lymphoma: analysis of clinical features, response to treatment, survival and comparison with diffuse large B-cell lymphoma. Oncology. 2001;61:257- 264.

(28.) Carbone A, Gloghini A, Gaidano G, et al. Expression status of bcl-6 and syndecan-1 identifies distinct histogenetic subtypes of Hodgkin disease. Blood. 1998;92:2220-2228.

(29.) Carbone A, Gloghini A, Libra M, et al. A spindle cell variant of diffuse large B-cell lymphoma possesses genotype and phenotype markers characteristic of a germinal center B-cell origin. Mod Pathol. 2006;19:299-306.

(30.) YoshidaS, Nakamura N, Sasaki Y, et al. Primary breast diffuse large B-cell lymphoma shows a non-germinal center B-cell phenotype. Mod Pathol. 2005;18: 398-405.

(31.) Dogan A, Bagdi E, Munson P, Isaacson PG. CD10 and BCL-6 expression in paraffin sections of normal lymphoid tissue and B-cell lymphomas. Am J Surg Pathol. 2000;24:846-852.

(32.) Niu H. The proto-oncogene bcl-6 in normal and malignant B cell development. Hematol Oncol. 2002;20:155-166.

(33.) Gaidano G, Carbone A. MUM1: a step ahead toward the understanding of lymphoma histogenesis. Leukemia. 2000;14:563-566.

(34.) Huang JZ, Sanger WG, Greiner TC, et al. The t(14;18) defines a unique subset of diffuse large B-cell lymphoma with a germinal center B-cell gene expression profile. Blood. 2002;99:2285-2290.

(35.) McCluggage WG, Catherwood M, Alexander HD, McBride HA, Smith MEF, Morris TCM. Immunohistochemical expression of CD10 and t(14;18) chromosomal translocation may be indicators of follicle centre cell origin in nodal diffuse large B-cell lymphoma. Histopathology. 2002;41:414-420.

(36.) Skinnider BF, Horsman DE, Dupuis B, Gascoyne RD. Bcl-6 and bcl-2 protein expression in diffuse large B-cell lymphoma and follicular lymphoma: correlation with 3q27 and 18q21 chromosomal abnormalities. Hum Pathol. 1999;30:803-808.

(37.) Kwon MS, Go JH, Choi JS, et al. Critical evaluation of bcl-6 protein expression in diffuse large B-cell lymphoma of the stomach and small intestine. Am J Surg Pathol. 2003;27:790-798.

(38.) Ree HJ, Yang WI, Kim CW, et al. Coexpression of bcl-6 and CD10 in diffuse large B-cell lymphoma: significance of bcl-6 expression patterns in identifying germinal center B-cell lymhoma. Hum Pathol. 2001;32:954 962.

(39.) Ree HJ, Ohsima K, Aozasa K, et al. Detection of germinal center B-cell lymphoma in archival specimens: critical evaluation of bcl-6 protein expression in diffuse large B-cell lymphoma of the tonsil. Hum Pathol. 2003;34:610 616.

(40.) Greiner A, Tobollik S, Buettner M, et al. Differential expression of activation-induced cytidine deaminase (AID) in nodular lymphocyte- predominant and classical Hodgkin lymphoma. J Pathol. 2005;205:541-547.

(41.) Lossos IS, Levy R, Alizadeh AA. AID is expressed in germinal center B-cell like and activated B-cell-like diffuse large cell lymphomas and is not correlated with intraclonal heterogeneity. Leukemia. 2004;18:1775-1779.

(42.) Willemze R, Jaffe ES, Burg G, et al. WHO-EORTC classification for cutaneous lymphomas. Blood. 2005;105:3768-3785.

Nadine S. Aguilera, MD; Aaron Auerbach, MD, MPH; Carol L. Barekman, MD; Jack Lichy, MD, PhD; Susan L. Abbondanzo, MD

Accepted for publication May 20, 2009.

From the Departments of Hematopathology (Drs Aguilera, Auerbach, Barekman, and Abbondanzo) and Cellular Pathology (Dr Lichy), Armed Forces Institute of Pathology, Washington, DC. Dr Barekman is now with the Department of Hematopathology, Ameripath, Palm Beach Gardens, Florida. Dr Lichy is now with the Department of Pathology and Laboratory Medicine, Veterans Administration Hospital, Washington, District of Columbia. Dr Abbondanzo is now at Hematology/CBER, US Federal Drug Administration, Rockville, Maryland.

The authors have no relevant financial interest in the products or companies described in this article.

Reprints: Nadine S. Aguilera, MD, Department of Hematopathology, Armed Forces Institute of Pathology, 6825 16th St, NW, Bldg 54, Room 2051, Washington DC, 20306-6000 (e-mail: aguilera@afip.osd.mil).
Table 1. Technical Data for Antibodies

Antibody (Clone)   Type   Treatment       Company          Dilution

CD43 (MT-1)        MM     MAR         Biotest           1:800
                                        Diagnostics
                                        Corp;
                                        Denville, New
                                        Jersey
CD30 (BerH2)       MM     PD, MAR     Dako;             1:300
                                        Carpinteria,
                                        California
CD20 (L26)         MM     MAR         Dako              1:800
CD3                RP     PD, MAR     Dako              1:20
LMP-1 (CS1-4)      MM     PD, MAR     Dako              1:500
CD79a              MM     MAR         Dako              1:500
BCL-2              MM     MAR         Dako              1:500
CD10 (56C6)        MM     MAR         Vector            1:100
                                        Laboratories,
                                        Inc
                                        (Novocastra);
                                        Burlingame,
                                        California
CD5                MM     MAR         Vector            1:500
                                        Laboratories,
                                        Inc
                                        (Novocastra)
CD23               MM     PD          Binding Site;     1:200
                                        San Diego,
                                        California
BCL-6              MM     MAR         Dako              1:50
CD38               MM     MAR         Dako              1:500
CD27 (137B4)       MM     MAR         Novocastra        1:50
                                        (Vision
                                        BioSystems,
                                        Inc);
                                        Norwell,
                                        Massachusetts
MUM1               MM     MAR         Abcam, Inc;       1:100
                                        Cambridge,
                                        Massachusetts
[kappa]            RP     PD          Dako              1:200 000
[lambda]           RP     PD          Dako              1:100 000
AID (AICDA/AID)    RP     MAR         LifeSpan          1:200
                                        Biosciences;
                                        Seattle,
                                        Washington
PAX5               MM     MAR         Cell Marque       Prediluted by
                                        Corp; Austin,     manufacturer
                                        Texas

Abbreviations: LMP-1, latent membrane protein for Epstein-Barr
virus; MAR, microwave antigen retrieval; MM, mouse monoclonal
antibody; PD, required predigestion for 20 minutes with 0.4%
pepsin; RP, rabbit polyclonal antibody.

Table 2. Clinical Findings

Case   Age,
No.    y/Sex            Site

1      44/M    Left axillary lymph node
2      21/M    Left neck mass
3      59/F    Right mastoid lymph node
4      58/F    Left groin lymph node
5      25/F    Right femoral lymph node
6      57/F    Left inguinal lymph node
7      11/M    Right groin lymph node

Case
No.                   History                        Follow-up

1      Flow cytometry; [lambda] restriction       Alive at 130 mo
       2-wk history of enlarged lymph nodes;
         no symptoms
2      Incidental; no symptoms                    Alive at 144 mo
3      No systemic symptoms                       Alive at 119 mo
4      6-y history of enlarged lymph node;        Dead at 105 mo
         no symptoms
5      Incidental finding during hernia repair;   Alive at 96 mo
         no symptoms
6      Enlarged lymph node; incidental            Alive at 142 mo
       No other physical findings; no symptoms;
         normal laboratory results
7      No history                                 Alive at 146 mo

Table 3. Immunophenotypic Findings

Case
No.    CD20    CD3   BCL-2   CD30   CD43   CD10   CD5   CD23   BCL-6

1      +        -      +      -      +      -      -     +       -
2      +        -      +     +/-     +      -      -     -       -
3      +        -      +     +/-     NP     -     NP     NP     NP
4      +        -      +      -      -      -      -     -     + (a)
5      +        -      -     +/-     -      -      -     -       -
6      +        -      -      +      -      -      -     -       -
7      + (b)    -      -      -     +/-     -      -     -       -

Case
No.    CD38    CD27      MUM1     K/L   AID   PAX5   EBER/LMP-1

1       -     +/- (F)      +       L     +     +        - /-
2       -     +/- (F)      +      NR     +     +        - /-
3       NP      NP        NP       K    NP     NP      NP/eq
4       -     +/- (F)      +       L     +     +        - /-
5       -       NP        NP      NR    NP     NP       NP/-
6       -        -         -      NR     +     +        - /-
7       +     +/- (F)   +/- (F)    K    NP     NP       NP/-

Abbreviations: AID, Activation-induced cytidine deaminase; EBER,
Epstein-Barr virus encoded RNA;eq, equivocal; F, focalc; K,
kappa;L, lambda; LMP-1, latent membrane protein 1; NP, not
performed; NR, not restricted; +, positive; -, negative; +/-,
weak (d).

(a) Twenty percent of cells are malignant.

(b) CD79a immunoreactivity, rare CD20 positivity.

(c) Focal immunohistochemical staining is found in limited areas of
the malignant cells but meets the criteria for positive staining in
the area.

(d) Weak staining meets the cutoff criteria of 80% but staining
is lighter.

Table 4. Molecular Findings

Case No.   IgH   TCR[beta]   TCR[gamma]   t(14;18)

1           M        M           NP          -
2           M        -           NP          -
3          NP       NP           NP          NP
4           -        -           NP          -
5           M        -           -           -
6           M        -           NP          -
7           M        -           NP          -

Abbreviations: IgH, immunoglobulin heavy chain;M, monoclonal;
NP, not performed;TCR, T-cell receptor; t(14;18), translocation
involving chromosomes 14 and 18; -, negative.
COPYRIGHT 2010 College of American Pathologists
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Aguilera, Nadine S.; Auerbach, Aaron; Barekman, Carol L.; Lichy, Jack; Abbondanzo, Susan L.
Publication:Archives of Pathology & Laboratory Medicine
Article Type:Report
Geographic Code:1USA
Date:Mar 1, 2010
Words:4910
Previous Article:Quantitative real-time polymerase chain reaction detection of BK virus using labeled primers.
Next Article:Asbestos fiber content of lungs with diffuse interstitial fibrosis: an analytical scanning electron microscopic analysis of 249 cases.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters