Printer Friendly

Aberrant DNA Methylation of P16 MGMT and hMLH1 Genes in Combination with MTHFR C677T Genetic Polymorphism in gastric cancer.

Byline: Binbin Song Jiang Ai Xianghong Kong Dexin Liu and Jun Li

Abstract

Objective: We aimed to explore the association of P16 MGMT and HMLH1 with gastric cancer and their relation with Methylenetetrahydrofolate reductase (MTHFR).

Methods: 322 gastric patients who were confirmed with pathological diagnosis were included in our study. Aberrant DNA methylation of P16 MGMT and HMLH1 and polymorphisms of MTHFR C677T and A1298C were detected using PCR-RFLP.

Results: The proportions of DNA hypermethylation in P16 MGMT and hMLH1 genes in gastric cancer tissues were 75.2% (242/322) 27.6% (89/322) and 5.3% (17/322) respectively. In the remote normal-appearing tissues 29.5% (95/322) and 16.1%(52/322) showed hypermethylation in P16 and MGMT genes respectively. We found a significantly higher proportion of DNA hypermethylation of P16 in patients with N1 TNM stage in cancer tissues and remote normal-appearing tissues (Pless than 0.05). Similarly we found DNA hypermethylation of MGMT had significantly higher proportion in N1 and M1 TNM stage (Pless than 0.05). Individuals with homozygotes (TT) of MTHFR C677T had significant risk of DNA hypermethylation of MGMT in cancer tissues [OR (95% CI)=4.27(1.76-7.84)] and a significant risk was also found in those carrying MTHFR 677CT/TT genotype [OR (95% CI)= 3.27(1.21-4.77)].

Conclusion: We found the aberrant hypermethylation of cancer-related genes such as P16 MGMT and HMLH1 could be predictive biomarkers for detection of gastric cancer.

KEY WORDS: Aberrant DNA Methylation P16 MGMT hMLH1 Gastric cancer.

INTRODUCTION

Gastric cancer is one of the most common cancers worldwide and it ranks the second leading cause of cancer-related deaths after lung cancer.1 Almost two-thirds of gastric cancer cases and deaths occur in less developed regions.1 In China there were almost 0.4 million new cases from gastric cancer and rank the third most common cancer.1 Infection with H.pylori is a well-established cause of gastric cancer but variants in various genetic factors also influence the susceptibility of gastric cancer.2

It is reported that dietary factors either deficiencies or excesses of nutrients during the process of one-carbon metabolism pathway have been associated with increased risk of gastric

cancer.3 The one-carbon cycle plays an important role in cellular proliferation and epigenetic modification and folate is a important component of this pathway.3 Folate functions as a critical source of carbon moieties in the synthesis of nucleotides DNA repair and replication. These effects of foalte may affect the susceptibility of gastric cancer.45 Methylenetetrahydrofolate reductase (MTHFR) is a critical enzyme in folate metabolism is responsible for the circulation form of folate and 5-methyltetrahydrofolate which is involved in DNA synthesis and methylation.6 The activity of MTHFR is controlled mainly by the genetic polymorphisms and shows variation between different individuals.78 MTHFR C677T (rs1801133) and MTHFR A1298C (rs1801131) polymorphisms are associated with a reduced activity of MTHFR.

DNA methylation is an important epigenetic feature of DNA which has an important role in eukaryotes gene regulation cellular differentiation mechanisms X chromosome inactivation aging and carcinogenesis.9 Alteration of DNA methylation in genome can be found in various cancers and induce the over-expression of oncogenes and silencing of tumor suppressor genes in the process of carcinogenesis. P16 MGMT and HMLH1 are important tumor suppressor and DNA repair genes and have involved in the carcinogenic process. Inactivation of P16 MGMT and HMLH1 plays a role in the progression of various cancers and the inactivation of them is induced by aberrant hypermethylation. However the related information for gastric cancer are still limited.10

Therefore we aimed to explore the association of P16 MGMT and HMLH1 with gastric cancer and their relation with MTHFR.

METHODS

This study recruited gastric cancer patients who were confirmed with pathological diagnosis in Huizhou Municipal Central Hospital of Guangdong between March 2009 and December 2011. Patients who had cardiac adenocarcinoma secondary or recurrent tumors a history of other malignant neoplasms and previous eradication therapy for H.pylori were excluded. Our study was approved by Ethnic committee of Hongqi Hospital and all the patients signed the consent form.

All the patients underwent surgery cancer lesion and remote normal-appearing tissues were excised and stored at -70C in Liquid Nitrogen refrigerator immediately until use. Twenty normal gastric

tissue samples were obtained under surgery and also stored. H.pylori genotyping.

All the patients were required to provide 5ml peripheral bloods before surgery and the bloods were stored at -20C. Enzyme linked

immunoabsorbent assay (ELISA) was used for qualitative determination of IgG antibodies (HpIgG ELISA) to Helicobacter pylori in serum. The process

of experiment and determination of results were according to manufacturer's instructions of the commercially available kit (Genesis Diagnostics Cambridgeshire UK).

DNA extraction and quantification: 5 ml venous blood was drawn from each cases and controls. The blood was kept in -20 C and EDTA with

1.5~2.2mg/ml was used for anticoagulant. Total DNA was extracted from the buffy-coat layer us- ing a TIANamp blood DNA kit (Tiangen Biotech Beijing China) with centrifuging for 3 minutes at

13.400 x g (12.000 rpm). The methylation of P16 MGMT and hMLH1 was determined by the method of methylation-specific PCR after sodium bisulfate modification of DNA (Wang et al. 2008; Herman et al. 19961). The pairs of primers were designed using Assay Design 3.1 software (Sequenom San Diego CA USA; Table-I).11 The 1.5 to 2.0 ug of genomic DNA was dissolved in H2O and incubated into 5.5uL NaOH for 10 minutes at 37C and then treated by hydroquinone and NaHSO3.After these procedures the unmethylated cytosine would be converted to uracil and determined as thymine by Taq polymerase during the PCR process according to the instruction.

Genotyping of MTHFR C677T and MTHFR A1298C polymorphism was determined using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) according to previous report.12 Each PCR reaction mix comprised

50 ng genomic DNA 200 M dNTP 2.5 U Taq DNA polymerase (Promega Madison WI USA) and 200 M primers in a total volume of 20 l. The cycling programme involved preliminary denaturation at 94C for two minutes followed by 35 cycles of denaturation at 94C for 30 s and annealing at 64C for 30 s with a final extension at 72C for

10 minutes. PCR products were verified by 1.0% agarose gel electrophoresis and the PCR products were visualized using ethidium bromide staining.

Statistical analysis: All statistical analyses were performed using SPSS(R) version 11.0 (SPSS Inc. Chicago IL USA) for Windows(R). Continuous variables were presented as meanSD and analysed

using independent sample t-test. Categorical variables were presented as n of subjects (%) and analysed using 2-test. Odds ratios (OR) and their corresponding 95% confidence intervals (CI) were used to assess the influence of MTHFR on the. All comparisons were two-sided and P less than 0.05 was regarded as statistically significant.

RESULTS

A total of 348 gastric cancer patients were included in our study and 322 patients were involved in the final analysis (participation rate: 92.5%; 173 males and 149 females). The average age of 322 patients were 54.58.5 years old. The DNA hypermethylation of P16 MGMT and hMLH1 in cancer tissue and paracancerous normal tissue was shown in Table- II. The proportions of DNA hypermethylation in P16 MGMT and hMLH1 genes in gastric cancer tissues were 75.2% (242/322) 27.6% (89/322) and 5.3% (17/322) respectively. In the remote normal-appearing tissues 29.5% (95/322) and

16.1%(52/322) showed hypermethylation in P16 and MGMT genes respectively. The proportion of DNA hypermethylation in P16 MGMT and hMLH1 in cancer tissues were significantly higher than remote normal-appearing tissues. We did not find significant association of DNA hypermethylation with sex and tumor sites either in gastric cancer tissues or remote normal-appearing tissues.

The hypermethylation of P16 and MGMT showed significant correlation with the different clinical characteristics (Table-II). We found a significantly higher proportion of DNA hypermethylation of P16 in patients with N1 TNM stage in cancer tissues and remote normal-appearing tissues (Pless than 0.05). Simi- larly we found DNA hypermethylation of MGMT had significantly higher proportion in N1 and M1

TNM stage (Pless than 0.05).

The association of DNA hypermethylation with MTHFR C677T and C1298A polymorphisms is shown in Table-III. Our finding showed that

individuals with homozygotes (TT) of MTHFR C677T had significant risk of DNA hypermethylation of MGMT in cancer tissues [OR (95% CI)=4.27(1.76-

7.84)] and a significant risk was also found in those carrying MTHFR 677CT/TT genotype [OR (95% CI)= 3.27(1.21-4.77)]. However we did not find

association between polymorphisms in MTHFR A1298C and risk of DNA hypermethylation of P16 MGMT and hMLH1 gene.

DISCUSSION

Varied activity of folate metabolic enzyme which induced by genetic polymorphisms may have impact on the methylation status and carcinogenesis.1314 The relationship between DNA methylation of P16 MGMT and hMLH1 genes and MTHFR polymorphisms with the cancer risk has

Table-I: Primers in the PCR process.

###Gene###Primer###Sequence(5'3')

###P16###M###F###TTATTAGAGGGTGGGGCGGATCGC

###B###GACCCCGAACCGCGACCGTAA

###U###F###TTATTCGCGGGTGGGGTGGATTGT

###B###CAACCCCAAACCACAACCATAA

###MGMT###M###F###TTTCGATTCGTAGGTTCGCCGC

###B###GCACTCTTCCGAAAACGAAACG

###U###F###GTGTTTTGATGTTTGTAGGTTTTTGT

###B###TCCACACTCTTCCAAAAACAAAACA

###hMLH1###M###F###ACGTAGACGTTTTATTAGCGC

###B###CCTCATCGTAACTACCCGCGC

###U###F###TTTTGATGTAGATGTTTTAGG

###B###ACCACCTCATCATAACATCCC

###MTHFR C677T###F###CGTGGCTCCTGCGTTTCC

###B###GAGCCGGCCACAGGCAT

###MTHFR A1298C###F###AAATGATCTGGGAGCTGAGT

###B###CAGAGTATATGGCAGTACAG

Table-II: Association of DNA hypermethylation with demographic and clinical characteristics of gastric cancer.

Variables###N=322###Cancer tissue###Remote normal-appearing tissues

###P16% MGMT% hMLH1%###P16%MGMT%hMLH1%

Mean age (years)54.58.5

Sex

Male###173###125 72.3 49###28.3 9###5.2 50###28.9 28###16.2 0###0

Female###149###117 78.5 40###26.8 8###4.6 45###26.0 24###16.1 0###0

P value###0.91 0.77 0.95 0.810.991.0

Site

Upper###60###44###73.5 17###28.4 3###1.7 17###9.8 10###16.7 0###0

Middle###153###114 74.5 41###26.8 9###5.2 44###25.4 24###15.7 0###0

Low###109###84###77.0 31###28.4 5###2.9 34###19.7 18###16.5 0###0

P value###0.84 0.95 0.89 0.890.981.0

TNM stage

T

T1###44###30###68.5 10###22.8 2###1.2 12###6.9 6###13.7 0###0

T2###95###69###72.4 25###26.3 4###2.3 24###13.9 12###12.6 0###0

T3###99###74###74.9 25###25.3 5###2.9 26###15.0 13###13.2 0###0

T4###84###69###82.4 29###34.4 6###3.5 33###19.1 21###24.9 0###0

P value###0.3 0.41 0.84 0.150.091.0

N

N0###180###125 69.4 41###22.8 8###4.6 51###29.5 28###15.6 0###0

N1###142###117 82.4 48###33.8 9###5.2 44###25.4 24###16.9 0###0

P value###0.008###0.007###0.45###0.001###0.03###1.0

M

M0###294###221 75.2 74###25.2 15 8.7 84###48.6 45###15.3 0###0

M1###28###21###75.0 15###53.5 2###1.2 11###6.4 7###25.0 0###0

P value###0.98###0.001###0.64###0.24###0.18###1.0

een pointed in several studies.1315-17 However the evidences of DNA methylation with gastric cancer risk and relation to MTHFR are still lacking. The findings from the present study indicated that a higher hypermethylation of P16 MGMT and hMLH1 gene in gastric cancer tissues than remote-normal- appearing gastric tissues. Hypermethylation of P16

and MGMT genes was related with TNM stage in gastric cancer tissues. The DNA hypermethylation of MGMT genes present a significantly interaction with polymorphisms of MTHFR C677T.

Aberrant methylation global hypomethylation in genomic DNA and hypermethylation in specific gene promoters usually occurs in cancers.18

Table-III: Association of DNA hypermethylation with MTHFR polymorphisms.

Variables###OR (95% CI)1

###Cancer tissue###Remote normal-appearing tissues

###P16###MGMT hMLH1 P16###MGMThMLH1

MTHFR C677T

CC###1.0(Ref.)1.0(Ref.)###1.0(Ref.)1.0(Ref.) 1.0(Ref.)###-

CT###1.03(0.65-2.86)1.41(0.75-2.89)###1.20(0.30-9.7) 0.98(0.34-7.87) 1.63(0.34-9.14)###-

TT###1.68(0.87-5.54)4.27(1.76-7.84)###1.72(0.45-15.7)1.55(0.57-7.14) 2.43(0.89-10.46)###-

CT/TT###1.450.82-2.32) 3.27(1.21-4.77)###1.45(0.34-13.1)1.32(0.57-6.98) 2.10(0.77-7.31)###-

MTHFR A1298C

AA###1.0(Ref.)1.0(Ref.)###1.0(Ref.)1.0(Ref.) 1.0(Ref.)###-

AC###1.12(0.53-3.32)1.23(0.64-2.34)###1.05(0.21-11.4)1.04(0.36-4.70) 1.35(0.35-4.54)###-

CC###1.32(0.68-3.73)2.41(0.93-4.72)###1.30(0.32-12.7)1.41(0.44-6.78) 2.17(0.45-9.33)###-

AC/CC###1.25(0.70-3.15)1.84(0.85-3.79)###1.18(0.30-12.1)1.21(0.53-5.58) 1.76(0.51-6.40)###-

Lack of global DNA methylation may cause the instability of gene and thus promote the process of cancer development.19 However promoter hypermethylation may induce the inactivity of transcriptional gene.19 Published data indicated that the DNA methylation primarily influences the cytosine of symmetrical dinucleotide CpG in human20 and the subsequent pattern of DNA methylation is transmitted through mitosis and maintained after DNA replication21 and thereby aberrant CpG island methylation could promote the carcinogenesis. It has been previously reported that P16 COX2 MGMT hMSH2 and hMLH1 gene could be more frequently found in cancer tissues than in remote normal-appearing tissues and hypermethylation could not be found in normal tissues.131422 The present study has shown that individuals with methylation of MGMT and hMLH1 may influence the susceptibility of gastric cancer which proved DNA methylation may play a role in the development of gastric cancer.

Our study showed that hypermethylation of P16 and MGMT genes was related with TNM stage in gastric cancer tissues. Previous study indicated that aberrant methylation of the MGMT gene was significantly correlated with the extent of tumor lymph node metastasis and TNM stage and this study has shown a trend toward large maximal tumor size in methylation tumors.23 Our study was in line with this report. Further studies are still needed to clarify their association.

In the present study we found polymorphisms in MTHFR C677T may influence the DNA methylation status. The main reason might be the activity of folate metabolic enzyme which participates into the methylation process of DNA. Previous studies reported that individuals carrying variant genotypes CT or TT had a higher risk of methylation of MGMT in cancer tissues.1322 Only one study conducted in China indicated that MTHFR 677 T allele increased the risk of methylation of MGMT in gastric cancer tissues. Our results are in line with previous study. Taken together these data suggest that MTHFR C677T polymorphism plays an important role in DNA methylation and carcinogensis process.

In conclusion we found the aberrant hypermethylation of cancer-related genes such as P16 MGMT and HMLH1 could be predictive biomarkers for detecting of gastric cancer. The aberrant hypermethylation of P16 and MGMT gene was associated with regional lymph node metastasis and the polymorphism of MTHFR C677T could influence the methylation of MGMT.

Further large-scale studies are required to elucidate the association between P16 MGMT and HMLH1 and risk of gastric cancer.

REFERENCES

1. Wang YC Wei LJ Liu JT Li SX Wang QS. Comparison of Cancer Incidence between China and the USA. Cancer Biol Med. 2012;9(2):128-132.

2. IARC working group on the evaluation of carcinogenic risks to humans schistosomes liver flukes Helicobacter pylori. IARC monographs on the evaluation of carcinogenic risks to humans Vol 61. International Agency for Research on Cancer Lyon. 1994: 1-241.

3. Galvan-Portillo MV Cantoral A OAate-OcaAa LF Chen J Herrera-Goepfert R Torres-Sanchez L et al. Gastric cancer in relation to the intake of nutrients involved in one-carbon metabolism among MTHFR 677 TT carriers. Eur J Nutr.

2009;48(5):269-276.

4. Miao X Xing D Tan W Qi J Lu W Lin D. Susceptibility to

astric cardia adenocarcinoma and genetic polymorphism

in methylenetetrahydrofolate reductase in an at-risk

Chinese population. Cancer Epidemiol Biomarkers Prev.

2002;11(11):1454-1458.

5. Gotze T Rocken C Rohl FW Wex T Hoffmann J

Westphal S et al. Gene polymorphisms of folate

metabolizing enzymes and the risk of gastric cancer.

Cancer Lett. 2007;251(2):228-236.

6. Hasoun LZ Bailey SW Outlaw KK Ayling JE. Effect of serum

folate status on total folate and 5-methyltetrahydrofolate in

human skin. Am J Clin Nutr. 2013;98(1):42-48.

7. Frosst P Blom HJ Milos R Goyette P Sheppard CA

Matthews RG et al. A candidate genetic risk factor for vascular

disease: a common mutation in methylenetetrahydrofolate

reductase. Nat Genet. 1995;10(1):111-113.

8. Bagley PJ Selhub J. A common mutation in the

methylenetetrahydrofolate reductase gene is

associated with an accumulation of formylated

tetrahydrofolates in red blood cells. Proc Natl Acad Sci

USA. 1998;95(22):13217-132220.

9. Jones PA Baylin SB. The epigenomics of cancer. Cell.

2007;128(4):683-692.

10. Sato F Meltzer SJ. CpG island hypermethylation in

progression of esophageal and gastric cancer. Cancer.

2006;106:483-493.

11. Wang J Sasco AJ Fu C Xue H Guo G Hua Z et al. Aberrant

DNA methylation of P16 MGMT and hMLH1 genes in

combination with MTHFR C677T genetic polymorphism

in esophageal squamous cell carcinoma. Cancer Epidemiol

Biomarkers Prev. 2008;17(1):118-125.

12. Li H Xu WL Shen HL Chen QY Hui LL Long LL et

al. Methylenetetrahydrofolate reductase genotypes and

haplotypes associated with susceptibility to colorectal

cancer in an eastern Chinese Han population. Genet Mol

Res. 2011;10(4):3738-3746.

13. Chen J Huang ZJ Duan YQ Xiao XR Jiang JQ Zhang

R. Aberrant DNA methylation of P16 MGMT and

hMLH1 genes in combination with MTHFR C677T

enetic polymorphism and folate intake in esophageal

squamous cell carcinoma. Asian Pac J Cancer Prev.

2012;13(10):5303-5306.

14. Gao S Ding LH Wang JW Li CB Wang ZY. Diet

folate DNA methylation and polymorphisms in

methylenetetrahydrofolate reductase in association with

the susceptibility to gastric cancer. Asian Pac J Cancer Prev.

2013;14(1):299-302.

15. Gomes MV Toffoli LV Arruda DW Soldera LM Pelosi GG Neves-Souza RD et al. Age-related changes in the global DNA methylation profile of leukocytes are linked to nutrition but are not associated with the MTHFR C677T genotype or to functional capacities. PLoS One.

2012;7(12):e52570.

16. Cheng H Lu M Mao LJ Wang JQ Li W Wen RM et al.

Relationships among MTHFR a1298c gene polymorphisms

and methylation status of Dact1 gene in transitional cell

carcinomas. Asian Pac J Cancer Prev. 2012;13(10):5069-5074.

17. de Cassia Carvalho Barbosa R da Costa DM Cordeiro DE

Vieira AP Rabenhorst SH. Interaction of MTHFR C677T and

A1298C and MTR A2756G gene polymorphisms in breast

cancer risk in a population in Northeast Brazil. Anticancer

Res. 2012;32(11):4805-4811.

18. Momparler RL Bovenzi V. DNA methylation and cancer. J

Cell Physiol. 2000;183:145-154.

19. Sato F Meltzer SJ. CpG island hypermethylation in

progression of esophageal and gastric cancer. Cancer.

2006;106:483-493.

20. Issa JP Garcia-Manero G Giles FJ Mannari R Thomas D Faderl S et al. Phase 1 study of low-dose prolonged exposure schedules of the hypomethylating agent 5-aza-2'- deoxycytidine (decitabine) in hematopoietic malignancies. Blood. 2004;103(5):1635-1640.

21. Gius D Bradbury CM Sun L Awwad RT Huang L Smart DD et al. The epigenome as a molecular marker and target. Cancer. 2005;104(9):1789-1793.

22. Wang J Sasco AJ Fu C Xue H Guo G Hua Z et al. Aberrant DNA Methylation of P16 MGMT and hMLH1 Genes in Combination with MTHFR C677T Genetic Polymorphism in Esophageal Squamous Cell Carcinoma. Cancer Epidemiol Biomarkers Prev. 2008;17(1):118-125.

23. Hibi K Sakata M Yokomizo K Kitamura YH Sakuraba K Shirahata A et al. Methylation of the MGMT gene is frequently detected in advanced gastric carcinoma. Anticancer Res. 2009;29(12):5053-5055.
COPYRIGHT 2013 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Pakistan Journal of Medical Sciences
Date:Dec 31, 2013
Words:3402
Previous Article:Surgical treatment of an endobronchial lipoma obstructing the right upper bronchus: Imaging features with pathological correlation.
Next Article:Preservation of myocardial contractile function by aminoguanidine a nitric oxide synthase inhibitors in a rat model of hemorrhagic shock.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters