Printer Friendly

ANTI-ALLERGIC POTENTIAL OF FISETIN IN A MURINE MODEL OF OVA-INDUCED ALLERGIC RHINITIS VIA INHIBITION OF GATA-3 AND TH2 CYTOKINES.

Byline: ZHAO L., KANDHARE A., MUKHERJEE A. and SUBHASH BODHANKAR S.

Abstract

Background and Objectives: Allergic rhinitis (AR) is an IgE mediated immune-inflammatory disease, characterized by sneezing, rhinorrhea, lacrimation, etc. Fisetin is a plant flavonoid, reported to have anti-allergic potential via inhibition of Th2 response. Objective of this study was to evaluate the antiallergic potential of fisetin against ovalbumin (OVA)-induced experimental allergic rhinitis in BALB/c mice.

Methodology: Mice were sensitization by OVA (500 ul, i.p.) on days 1, 3, 5, 7, 9, 11, 13 and treated with fisetin (10, 20 and 40 mg/kg, p.o.) for 21 days, followed by OVA (5 ul per nostril) challenged on the 21st day.

Results: Administration of fisetin (20 and 40 mg/kg) significantly attenuated (p< 0.05) OVA-induced nasal rubbing, sneezing and discharge, histamine-induced rubbing and sneezing, and hematological parameters as compared to AR control mice. OVA-induced elevated levels of serum histamine, [beta]-hexosaminidase, IgE and IgG1 as well as Th2 cytokines (IL-4, IL-5, IL-13, and IL-17) in nasal lavage fluid was significantly (p < 0.05) attenuated by fisetin. It also significantly inhibit (p < 0.05) up-regulated mRNA expressions of GATA3, IL-4, IL-5 and IL-13 in spleen tissue. Fisetin administration significantly reduced (p < 0.05) histological aberrations induced by OVA in nasal mucosa, spleen, and lungs.

Conclusion: The findings of the present study showed that fisetin exerts its anti-allergic potential via modulation of GATA3 pathway to inhibit the release of Th2 cytokines (IL-4, IL-5, IL-13) and IgE, thus reducing OVA-induced nasal rubbing and sneezing during allergic rhinitis.

Keywords: Allergic rhinitis, Fisetin, GATA3, lgE, Interleukins, Ovalbumin, TNF-[alpha].

INTRODUCTION

Allergic rhinitis (AR) is a chronic immune-inflammatory disorder which is increasing, significantly, worldwide resulting in important social and medical problems.1 Rhinitis is associated with widespread morbidity, significant treatment costs, impaired work productivity and quality of life. The characteristic features of AR include nasal congestion, sneezing, rhinorrhea, and pruritus of nosea long with eyes. Additionally, it is also associated with various complications including headache, fatigue, sinusitis, sleep disturbance, eustachian tube dysfunction, and cognitive impairment.2

According to a report by European Community Respiratory Health Survey (ECRHS), the prevalence of AR is 5-22%. While, more than 35% of the European and Australian population suffer from AR, about 26% of Indians are affected with it.3

Researchers have well documented that exposure to an array of mediators such as indoor allergens (such as dust mites and stuffed furniture), outdoor allergens (like molds and pollen of grains, grass, trees, weeds, etc.), chemical irritants, tobacco smoke, air pollution, and food cause hypersensitive response which results in Allergic rhinitis.4Cumulative data obtained from animal studies have suggested that imbalance in T-helper type 1 (Th1) and T-helper type 2 (Th2) responses cause inflammation and remodelling in nasal mucosa that result in the progress of AR.5,6 Th2 responses are up-regulated due to elevated production of cytokines including tumour necrosis factor-alpha (TNF-[alpha]), interleukins (IL's) (IL-1[beta], IL-4, IL-5 and IL-6), release of nitric oxide from macrophages, production of reactive oxygen species (ROS), immunoglobulin (IgE), and mast cell.5,6

These vicious molecules are responsible for synthesis of IgE and its cross-linking with high-affinity IgE receptors (FcIuR) present on mast cell surface. It leads to mast cell degranulation and release of various inflammatory mediators including histamine, cytokines, and leukotrienes.7,8 The inflammatory influx in the nasal mucosa results in structural aberrations that contribute to congestion, post nasal drip, concurrent sneezing, and nasal discharge leading to development of AR.9

Current treatment of AR includes antihistamines, cromolyn sodium, nasal decongestants, glucocorticoids that provide symptomatic relief. However, these medications are associated with side effects such as nausea, vomiting, headache, hypertension, immune system suppression and growth retardation.1,10 Hence, there is an urgent need to develop strategies for the management of AR using safer and more effective treatment methods of natural origin. Numerous evidences suggest that natural compounds also provide promising effects for asthma treatment.11,12

Many herbal medicines have been traditionally known for either their symptomatic relief property or halting disease progression in the treatment of AR. However, the extent of their effectivity and presence of active components lack systematic study and hence scientific evidence. Thus, various animal models including pollen extract, house mite allergen, ovalbumin (OVA), and bee venom have been employed for the development of various therapeutic moieties against AR.13 Amongst all, murine model of OVA-induced AR is well established, widely used and a reproducible immunological tool that mimics clinicopathological features of AR.13,14 OVA-induced AR exhibits various characteristics including congestion, redness, sneezing, post-nasal drip, etc. which are the symptomatic hallmarks found in an AR patient.15 The inflammatory responses include release of lymphocytes, eosinophils, neutrophils, and mast cell with elevated mucus secretion into nasal mucosa.

It subsequently results in elevated Th2 response along with an increased level of IL-4, IL-5, IL-13, and IgE that eventually cause the development of persistent nasal mucosal inflammation, remodelling, and AR.

Fisetin (3, 3', 4', 7-tetrahydroxyflavone, Supplementary Figure 1) is a naturally occurring plant flavonoid which is widely present in apples, grape seeds, onions, strawberries, cucumbers, and persimmons. Fisetin has been documented to have antioxidant, anticarcinogenic, antiulcer, anticonvulsant, anti-hyperlipidemic, antiarthritic, antidiabetic, antimicrobial, antiviral, cardioprotective, and neuroprotective properties.16-22 Recently, researchers have also reported the antiasthmatic potential of fisetin against OVA-induced airway hyperresponsiveness via inhibition of lgG, lgE, iNOS, TNF-[alpha], IL-4, IL-5, IL-13, and NF-kB.19,23 As immune-inflammatory reactions like AR and asthma are two closely related disorders of airway disease, almost 88% of asthma patients have suffered from the symptoms of AR as well.24 Moreover, the animal models of both the allergic inflammation diseases are produced similarly.24

But, although the anti-asthmatic potential of fisetin has been well reported, its effect against allergic rhinitis is not yet evaluated. Hence, the aim of the present investigation was to evaluate the anti-allergic potential of fisetin against ovalbumin (OVA)-induced experimental allergic rhinitis in BA- LB/c mice.

MATERIALS AND METHODS Drugs and Chemicals

Ovalbumin (Grade V), aluminum hydroxide and histamine dihydrochloride were purchased from Sigma Chemical Co. (St Louis, MO, USA). Sodium sulfate, acetone, alcohol, sulphanilic acid, sodium nitrite, trisodium phosphate was purchased from S.D. Fine Chemicals, Mumbai, India. Sulphanilamides, naphthalaminediamine HCl, phosphoric acid was obtained from Loba Chemie Pvt. Ltd., Mumbai, India. Montelukast (MontecipA(r), Cipla Limited, India). Mouse OVA-specific IgE, total IgE, total IgG1, [beta]-hexosaminidase, IL-4, IL-5, IL-13, IL-17 and Interferon-gamma (IFN-I3) enzyme-linked immunosorbent assay (ELISA) Kit were obtained from Bethyl Laboratories Inc. (Montgomery, TX, USA). Total RNA Extraction kit and One-step Reverse transcription-polymerase chain reaction (RTPCR) kit was purchased from MP Biomedicals India Private Limited, India.

Animals

Adult male BALB/c mice (18-22 g) were purchased from National Toxicology Centre, Punae and kept in quarantine for a week at the institute animal house. Groups of ten animals per cage were kept under standard laboratory conditions at a temperature of 24AdegC +- 1AdegC, relative humidity of 45-55% and 12:12 h dark and light cycle. The experiments were carried out between 10:00 am and 5:00 pm. Animals had free access to food (Standard chaw pellet, Pranav Agro-industries Ltd., Sangli, India) and water ad libitum. Experimental protocols and procedures were approved by the Institutional Animal Ethics Committee of Poona College of Pharmacy, Pune and performed in accordance with the guidelines on animal experimentation recommended by Committee for Control and Supervision of Experimentation on Animals (CPCSEA), Government of India.25 Animals were brought to the testing laboratory 1 h before the experiments for adaptation purpose.

Induction of AR

Sensitization of BALB/c mice was done on days 1, 3, 5, 7, 9, 11, 13 by i.p. injection containing 500 ul of sensitization solution (50 mg of OVA and 1000 mg of aluminum hydroxide dissolved in 500 ml of saline).14,26

On day 14, mice were randomly divided into 6 treatment groups (n = 12 mice/group) and treated for the next 7 days (day-14 today-21) as follows:

Group I: Normal: Non-sensitized and received a suspension of aluminum hydroxide in saline followed by distilled water (10 mg/kg, p.o.)

Group II: AR Control: OVA-sensitized and received distilled water (10 mg/kg, p.o.)

Group III: Montelukast (10): [MLT (10)]: OVA-sensitized and received standard drug treatment i.e. montelukast (10 mg/kg, p.o.)

Group IV: Fisetin (10): [F (10)]: OVA-sensitized and received fisetin (10 mg/kg, p.o.)

Group V: Fisetin (20): [F (20)]: OVA-sensitized and received fisetin (20 mg/kg, p.o.)

Group VI: Fisetin (40): [F (40)]: OVA-sensitized and received fisetin (40 mg/kg, p.o.)

On day 21, one hour after the last dose of treatment, mice were challenged with intranasal (i.n.) administration of OVA (5%, 5 ul per nostril) and observations were recorded. During the acute toxicity study, animals did not show any signs and symptoms such as restlessness, respiratory distress, diarrhoea, convulsions and/or coma with graded doses up to 5000 mg/kg body weight.27 The three different dosages of fisetin, i.e., 10, 20 and 40 mg/kg were selected on the basis of previous studies carried out in our laboratory.20 The solutions of fisetin were freshly prepared daily by dissolving in distilled water at 1 mg/ml and administered orally for biological evaluations.

Nasal Symptoms in OVA-Induced AR Mice

After OVA challenge, nasal symptoms were evaluated within 10 min period.26,28 The number of sneezes and nasal itching motions (nasal rubbing) were recorded. Nasal discharge was scored as 0 = no discharge, 1 = the discharge reaches the anterior nasal aperture, 2 = the discharge overshoots the anterior nasal aperture, 3 = the discharge flows out.

Nasal Symptoms during Histamine-Induced Hypersensitivity in OVA-Induced AR Mice

To evaluate effects on histamine-induced hypersensitivity after interruption of the drugs, mice were challenged with histamine dihydrochloride (10 ul per nostril of a solution of 1 umol/ml in physiological saline) on day 24 of study, and the number of instances of nasal rubbing and sneezing was counted during 10 min period after challenge.14,26

Blood Sample Collection from OVA-Induced AR Mice

On day 21, 2 h after OVA challenge, blood specimens were collected from the retro-orbital plexus and serum was obtained by centrifugation at 8350 xg for 10 min at 4AdegC. Samples were stored at -20AdegC until biochemical and hematological measurements.

Hematological Measurements in OVA-Induced AR Mice

Hematological parameters were measured in blood samples using an automated hematologicalanalyzer (BC2800, Golden Harvest Ltd.) with software specific to mice. Parameters such as total leukocyte count (TLC), polymorphonuclear leukocytes (PMN) and platelet count (PLT) were analyzed.

Biochemical Measurement in Serum of OVAInduced AR Mice

OVA-specific IgE, total IgE, total IgG1 and [beta]-hexosa-minidase in serum, whereasIL-4, IL-5, IL-13, IL-17, and IFN-I3 in nasal lavage fluid (NLF) were evaluated using respective mouse ELISA quantitation kit (Bethyl Laboratories Inc., Montgomery, TX, USA) as per manufacturer's instructions. Results were evaluated by the P/N value. The test was done in duplicate to avoid false-negative, and false-positive results and the average value was taken for final calculation.29-31

Determination of Histamine Level in Serum of OVA-Induced AR Mice

The histamine content of the serumwas measured by the ophthaldialdehyde (OPA) spectrofluorometric procedure. The fluorescent intensity was measured at 460 nm (excitation at 355 nm) using a spectrofluorometer and histamine content was calculated.32

Reverse Transcriptase PCR

The levels of mRNA were analyzed in spleen tissue (n = 4) using reverse transcription (RT)-PCR approach as described elsewhere.33-35 Briefly, single-stranded cDNA was synthesized from 5 ug of total cellular RNA using reverse transcriptase (MP Biomedicals India Private Limited, India) as described elsewhere.33,36,37 The primer sequences along with its length (no. base pairs) for GATA3, IL-4, IL-5, IL-13, and [beta]-actin are presented in Table 1. Amplification of [beta]-actin served as a control for sample loading and integrity. PCR products were detected by electrophoresis on a 1.5 % agarose gel containing ethidium bromide. The size of amplicons was confirmed using a 100-bp ladder (0.5 ug/uL) as a standard size marker. The amplicons were visualized, and images were captured using a gel documentation system (Alpha Innotech Inc., San Leandro, CA, USA).

Gene expression was assessed by generating densitometry data for band intensities in different sets of experiments, by analyzing the gel images on Image J program (Version 1.33, Wayne Rasb and, National Institutes of Health, Bethesda, MD, USA) semi-quantitatively. The band intensities were compared with constitutively expressed [beta]-actin. The intensity of mRNAs was standardized against that of the [beta]-actin mRNA from each sample, and the results were expressed as the PCR-product/[beta]-actin mRNA ratio.

Histological Examination

On day 21, after blood withdrawal, 3 mice from each group were sacrificed. Nasal mucosa, spleen and lung tissues were dissected and stored for 24 h in 10% formalin for histological examination. The specimens were dehydrated and placed in xylene for 1 h (3 times) and later in ethyl alcohol (70, 90 and 100%) for 2h each. The infiltration and impregnation were carried out by treating with paraffin wax twice, each time for one hour. For tissue slide preparation, specimens were cut into sections of 3-5 um thickness and were stained with Hematoxylin and eosin (HandE). The specimens were then mounted on individual slides by use of Distrene Phthalate Xylene (DPX). Sections were examined under light microscope to obtain a general impression of the histopathology features of specimen and infiltration of cells in epithelium and sub-epithelium.

The intensity of histological aberrations in the nasal, spleen and lung tissue was graded as Grade 0 (not present or very slight); Grade 1 (mild); Grade 2 (moderate); and Grade 3 (severe) as described in the literature.38

Statistical Analysis

Data were expressed as mean +- SEM (standard error of means), and analysis was performed using Graph Pad Prism 5.0 software (Graph Pad, San Diego, USA). Statistical comparisons were made between drug-treated groups and AR control animals. Data of biochemical parameters were analyzed using one-way ANOVA, Dunnett's multiple range test was applied for post hoc analysis. A score of nasal redness and nasal discharge was analyzed by nonparametric Kruskal-Wallis ANOVA. A value of p < 0.05 was considered to be statistically significant.

SUPPLEMENTARY FILE

Supplementary figure 1: Structure of fisetin (3, 3', 4', 7-tetrahydroxyflavone).

RESULTS

Effect of Fisetin Treatment on OVA-Albumin Induced Alteration in Body Weight, Spleen Weight, and Lung Weight

OVA-Sensitization resulted in significant increase (p < 0.05) in relative spleen and lung weights in AR control mice as compared to normal mice. However, OVA-control mice did not show any significant alterations in body weight as compared to normal mice. Mice treated with fisetin (20 and 40 mg/kg) significantly inhibited (p < 0.05) OVA-induced increase in relative spleen and lung weights as compared to AR control animals. Montelukast (10 mg/kg) treatment also significantly decreased (p < 0.05) relative spleen and lung weights as compared to AR control mice. However, attenuation in OVA-induced increase in the relative spleen, and lung weights were more significant (p < 0.05) in montelukast (10 mg/kg) than fisetin treatment (Table 2).

Effect of Fisetin Treatment on OVA-Induced and Histamine-Induced Alterations in Nasal Symptoms

On day 21, the number of nasal rubs, sneezing, and discharge significantly increased (p < 0.05) after OVA challenge in OVA-sensitized mice as compared to normal mice. Treatment with fisetin (20 and 40 mg/ kg) and montelukast significantly (p < 0.05) reduced OVA-induced nasal rubbing, sneezing and discharge as compared to AR control mice. On day 24, histamine challenge in AR control mice caused significant increase (p < 0.05) in nasal rubbing and sneezing as compared to normal mice. Fisetin (20 and 40 mg/kg) treatment significantly inhibited (p < 0.05) histamine-induced nasal rubbing and sneezing as compared to AR control mice. Montelukast (10 mg/kg) treatment also showed significant attenuation (p < 0.05) in nasal rubbing and sneezing induced by histamine challenge as compared to AR control mice. Additionally, montelukast (10 mg/kg) showed more significant inhibition (p < 0.05) in OVA-induced as well as histamine-induced alterations in nasal symptoms as compared to fisetin treatment (Table 2).

Table 1: Primer sequences for GATA3, IL-4, IL-5, IL-13, and [beta]-actin.

###Base Pair

Sr.###Primer Sequence

###Gene###(bp) Length

No.

###Forward Primer###Reverse Primer

###1.###GATA3###ACAGAAGGCAGGGAGTGTGT###GGTAGAGTCCGCAGGCATT###437

###2.###IL-4###ACCTTGCTGTCACCCTGTTCTGC###GTTGTGAGCGTGGACTCATTCACG###352

###3.###IL-5###GCTTCTGCATTTGAGTTTGCTAGCT###TGGCCGTCAATGTATTTCTTTATTAAG###276

###4.###IL-13###TCTCGCTTGCCTTGGTGG###CATTCAATATCCTCTGGGTCCTGT###236

###5.###[beta]-actin###GTCACCCACACTGTGCCCATCT###ACAGAGTACTTGCGCTCAGGAG###764

Table 2: Effect of fisetin treatment on OVA-induced alterations in body weight, relative spleen and lung weight, nasal rubbing, sneezing, and nasal discharge as well as histamine challenge induced nasal rubbing and sneezing in AR mice.

###Treatment

Parameters

###Normal###AR Control###MLT (10)###F (10)###F (20)###F (40)

Body weight (gm)###30.07 +- 0.51###28.20 +- 0.61###29.55 +- 0.81###28.53 +- 0.78###29.60 +- 0.71###28.95 +- 0.62

Spleen wt / Body wt

###3.58 +- 0.15###5.82 +- 0.25####3.94 +- 0.26*,$###5.39 +- 0.32###4.80 +- 0.27*,$###4.32 +- 0.26*,$

(mg/gm) (X10-3)

Lung wt / Body wt

###7.87 +- 1.15###17.13 +- 1.31####9.24 +- 1.24*,$###14.12 +- 0.89###14.06 +- 0.90*,$###9.62 +- 0.49*,$

(mg/gm) (X10-3)

OVA challenge

Rubbing (number)###17.67 +- 1.12###66.33 +- 1.41####25.67 +- 0.56*,$###59.33 +- 1.71###47.33 +- 1.05*,$###32.83 +- 1.20*,$

Sneezing (number)###10.83 +- 0.48###41.17 +- 0.48####15.50 +- 0.56*,$###37.50 +- 0.22###28.83 +- 0.70*,$###20.83 +- 0.31*,$

Discharge (score)###0.83 +- 0.17###2.67 +- 0.21####1.33 +- 0.21*,$###2.50 +- 0.22###1.17 +- 0.17*,$###1.50 +- 0.22*,$

Histamine challenge

Rubbing (number)###16.50 +- 0.99###72.83 +- 0.54####33.17 +- 1.30*,$###66.50 +- 1.69###49.00 +- 1.29*,$###38.17 +- 1.42*,$

Sneezing (number)###9.17 +- 0.70###52.67 +- 1.02####21.83 +- 0.65*,$###47.33 +- 1.05###38.33 +- 0.80*,$###23.50 +- 1.18*,$

Effect of Fisetin Treatment on OVA-Albumin Induced Alteration in Hematological Parameters

The intranasal challenge of OVA resulted in significant increase (p < 0.05) in total cell count, polymorphonuclear leukocytes, differential cell count and platelet count in AR control mice as compared to normal mice. However, when compared to AR control mice, there was significant decrease (p < 0.05) in elevated levels of total cell count, polymorphonuclear leukocytes, differential cell count (lymphocytes, eosinophils and monocytes) and platelet count in fisetin (20 and 40 mg/kg) and montelukast (10 mg/kg) treated group. However, mice treated with montelukast (10 mg/kg) showed more significant attenuation (p < 0.05) of increased hematological parameters as compared to fisetin treated mice (Table 3).

Table 3: Effect of fisetin treatment on OVA-induced alterations in hematological parameters in AR mice.

###Treatment

Parameter

###Normal###AR Control###MLT (10)###F (10)###F (20)###F (40)

TLC (X 103/mm3)###2.31 +- 0.29###4.40 +- 0.16####2.46 +- 0.18*,$###4.07 +- 0.24###3.19 +- 0.13*,$###2.75 +- 0.15*,$

PMN (%)###44.00 +- 1.18###58.33 +- 1.91####44.50 +- 1.77*,$###56.00 +- 1.65###50.83 +- 1.78*,$###46.33 +- 1.67*,$

Lymphocytes (%)###40.00 +- 1.32###50.00 +- 1.88####41.00 +- 1.71*,$###48.33 +- 1.69###46.50 +- 1.67*,$###42.17 +- 1.60*,$

Eosinophils (%)###2.50 +- 0.22###5.00 +- 0.00####2.17 +- 0.17*,$###4.33 +- 0.33###2.83 +- 0.31*,$###2.33 +- 0.21*,$

Monocytes (%)###1.5 +- 0.22###3.33 +- 0.21####1.33 +- 0.21*,$###3.33 +- 0.21###1.50 +- 0.22*,$###1.83 +- 0.17*,$

PLT (X 105/mm3)###2.30 +- 0.18###4.34 +- 0.20####2.40 +- 0.16*,$###4.20 +- 0.17###2.87 +- 0.22*,$###2.53 +- 0.15*,$

Table 4: Effect of fisetin treatment on OVA-induced alterations in serum histamine, OVA-specific IgE, total IgE and IgG1, [beta]-hexosaminidase, as well as NLF IL-4, IL-5, IL-13, IL-17, and IFN-I3 levels in AR mice

###Treatment

Parameters

###Normal###AR Control###MLT (10)###F (10)###F (20)###F (40)

Serum Histamine###66.53 +- 3.05###360.80 +- 3.16####96.51 +- 3.22*,$###320.30 +- 2.94###263.10 +- 2.72*,$###114.90 +- 1.52*,$

(ug/ml)

Serum OVA-specific###12.57 +- 1.46###59.11 +- 1.61####23.37 +- 1.07*,$###52.47 +- 0.61###38.17 +- 1.11*,$###28.72 +- 1.34*,$

IgE (ng/ml)

Serum Total IgE###103.10 +- 4.65 494.20 +- 4.67####133.90 +- 2.48*,$###396.90 +- 3.81###235.50 +- 4.28*,$###155.20 +- 2.73*,$

(ng/ml)

Serum Total IgG1###0.23 +- 0.02###0.79 +- 0.02####0.48 +- 0.02*,$###0.69 +- 0.02###0.50 +- 0.02*,$###0.47 +- 0.02*,$

level (ng/ml)

Serum -hexo-###13.25 +- 0.47###47.89 +- 1.14####17.63 +- 1.49*,$###39.25 +- 1.07###30.97 +- 1.45*,$###24.57 +- 1.71*,$

saminidase (ng/ml)

NLF IL-4 (pg/ml)###61.88 +- 3.18###141.20 +- 4.51####76.27 +- 2.21*,$###142.20 +- 3.51###122.60 +- 3.59*,$###96.74 +- 4.03*,$

NLF IL-5 (pg/ml)###49.03 +- 2.85###111.50 +- 4.41####56.54 +- 2.03*,$###107.90 +- 2.72###92.00 +- 2.92*,$###62.96 +- 4.11*,$

NLF IL-13 (pg/ml)###84.72 +- 3.40###201.90 +- 4.04####116.80 +- 3.32*,$###182.00 +- 2.71###158.90 +- 2.96*,$###133.60 +- 3.90*,$

NLF IL-17 (pg/ml)###7.75 +- 1.91###42.02 +- 2.26####15.05 +- 3.30*,$###39.64 +- 2.76###32.82 +- 1.55*,$###18.55 +- 2.87*,$

NLF IFN- (pg/ml)###61.58 +- 0.87###53.43 +- 2.97####57.15 +- 3.19###53.38 +- 3.07###60.34 +- 1.92###62.85 +- 2.86

NLF IL-4/IFN- ratio###1.01 +- 0.05###2.67 +- 0.12####1.36 +- 0.10*,$###2.69 +- 0.10###2.04 +- 0.08*,$###1.56 +- 0.10*,$

Effect of Fisetin Treatment on OVA-Albumin Induced Alteration in Serum Biochemical Parameters

Levels of serum histamine, OVA-specific IgE, total IgE and IgG1, [beta]-hexosaminidase were significantly increased (p < 0.05) in AR control group as compared to normal group. Treatment with fisetin (20 and 40 mg/ kg) significantly attenuated (p < 0.05) these elevated levels of serum histamine, OVA-specific IgE, total IgE and IgG1, [beta]-hexosaminidase when compared with AR control mice. Montelukast (10 mg/kg) treatment also significantly decreased (p < 0.05) these elevated levels of serum histamine, OVA-specific IgE, total IgE and IgG1, [beta]-hexosaminidase as compared to AR control mice (Table 4).

Effect of Fisetin Treatment on OVA-Albumin Induced Alteration in Nasal Lavage Fluid IL-4, IL-5, IL-13, IL-17, and IFN-I3 Levels

OVA-challenged mice showed a significant increase (p < 0.05) in nasal lavage fluid IL-4, IL-5, IL-13, IL-17, and IFN-I3 levels as compared to normal mice. Treatment with fisetin (20 and 40 mg/kg) as well as montelukast (10 mg/kg) attenuated these elevated levels of IL-4, IL-5, IL-13, and IL-17 in nasal lavage fluid significantly (p <0.05) as compared to AR control mice. However, attenuation in these elevated levels of IL-4, IL-5, IL-13, and IL-17 in nasal lavage fluid was more significant (p < 0.05) in montelukast (10 mg/kg) treatment as compared to fisetin treatment. Treatment with fisetin (10, 20 and 40 mg/kg) as well as montelukast (10 mg/kg) did not show any significant inhibition in the elevated IFN-I3 nasal lavage fluid levels as compared to AR control mice (Table 4).

Effect of Fisetin Treatment on OVA-Albumin Induced Alteration in Splenic GATA3, IL-4, IL-5, and IL-13 mRNA Expression Levels

There was significant (p <0.05) up-regulation in the splenic GATA3, IL-4, IL-5, and IL-13 mRNA expression in AR control mice after the intranasal challenge of OVA as compared to normal mice. Mice treated with fisetin (20 and 40 mg/kg) showed significant (p < 0.05) attenuation in these elevated splenic GATA3, IL-4, IL-5, and IL-13 mRNA expressions as compared to AR control mice. Treatment with montelukast (10 mg/ kg) also showed significant (p < 0.05) down-regulation in splenic GATA3, IL-4, IL-5, and IL-13 mRNA expression when compared with AR control mice. However, treatment with montelukast (10 mg/kg) showed more significant (p < 0.05) down-regulation of splenic GATA3, IL-4, and IL-5 mRNA expression as compared to fisetin treatment.

Error! Reference source not found.)

Effect of Fisetin Treatment on OVA-Albumin Induced Alteration in Nasal Mucosa Histopathology

Ovalbumin challenge produced marked disruption of mucosal epithelium in AR control mice. Histopathological evaluation of nasal mucosa after intranasal instillation of OVA showed significant (p <0.05) increase in eosinophil infiltration into the nasal mucosa in AR control mice (Fig. 2B) as compared to normal mice. There was no evidence of eosinophils infiltration in nasal mucosa of normal control mice. It showed normal architecture of mucosal epithelium with mild oedema (Fig. 2A). Mice treated with montelukast (10 mg/kg) significantly (p <0.05) decreased eosinophils infiltration and mucosal cell hyperplasia as compared to AR control mice (Fig. 2C). Fig. 2D depicts a predominant number of inflammatory cells in the nasal mucosa of mice treated with fisetin (10 mg/kg). Also, treatment with fisetin (20 and 40 mg/kg) significantly (p <0.05) reduced OVA-induced eosinophils infiltration into nasal mucosa as compared to AR control mice (Fig. 2E and Fig. 2F) (Fig. 2G).

Effect of Fisetin Treatment on OVA-Albumin Induced Alteration in Spleen Histopathology

Massive enlargement of the spleen reflected the induction of allergic rhinitis by intranasal challenge with OVA in mice. Spleen section from AR control mice showed significantly (p < 0.05) increased macrophages with hemosiderin and hyperplasic lymphoid cell as compared to normal mice (Fig. 3A). Staining of spleen with HandE showed the presence of a mixed population of pale-stained lymphoid cells. In normal mice, the number of macrophages with hemosiderin and hyperplasic lymphoid cells were lesser (Fig. 3B). Treatment with fisetin (10 mg/kg) did not produce any significant decrease in the number of mature lymphocytes and macrophages as compared to AR control mice (Fig. 3D).

However, mice treated with fisetin (20 and 40 mg/kg) as well as montelukast (10 mg/kg) significantly (p < 0.05) decreased these elevated numbers of mature lymphocytes as compared to AR control mice (Fig. 3E, Fig. 3F, and Fig. 3C, respectively) (Fig. 3G).

Effect of Fisetin Treatment on OVA-Albumin Induced Alteration in Lung Histopathology

Lung tissue from the AR control mice demonstrated marked histopathologic abnormalities characterized by significant (p < 0.05) increase in peribronchial and perivascular inflammatory infiltration in alveoli and bronchial region (Fig. 4A) as compared to normal mice (Fig. 4B). Montelukast (10 mg/kg) treatment showed significant (p < 0.05) decrease in peribronchial and perivascular inflammatory infiltration as compared to AR control mice (Fig. 4C). However, mice treated with fisetin (10 mg/kg) failed to produce any attenuation in thenumber of inflammatory infiltration as compared to AR control mice (Fig. 4D). Treatment with Fisetin (20 and 40 mg/kg) showed significant (p < 0.05) attenuation in OVA-induced elevated inflammatory infiltration in alveoli and the bronchial region as compared to AR control mice (Fig. 4E and Fig. 4F, Fig. 4G).

DISCUSSION

Allergic rhinitis is an IgE mediated immune-inflammatory disease of nasal mucosa mainly characterized by sneezing, rhinorrhea, and lacrimation which are exhibited due to the early phase response to an array of allergens. Amongst the various animal models, ovalbumin (OVA) induced AR is widely usedand well-established model which mimics all clinicopathological characteristics and mechanisms behind experimental and clinical immunomodulation.13,14 Hence, in the present investigation, we have evaluated the potential of fisetin, a plant flavonoid, against OVA-induced AR. The findings of the present study showed that fisetin exerts its anti-allergic potential via modulation of the GATA3 pathway to inhibit the release of Th2 cytokines (IL-4, IL-5, IL-13) and IgE thus reducing OVA-induced nasal rubbing and sneezing during AR.

Accumulating reports have indicated that Th-lymphocytes play a vital role in initiation and progression of immune-inflammatory reactions (such as allergic rhinitis, asthma) via the release of various cytokines including IL-4, IL-5, and IL-13.39 The release of these Th2 cytokines are associated with inflammatory infiltration including activation eosinophil, neutrophil, and leukocyte.40,41 In the present study, we found that, compared to normal mice, OVA-challenged mice showed elevated levels of inflammatory cells (eosinophil, neutrophil, and leukocyte). Whereas, mice that received the fisetin treatment had significantly reduced levels of inflammatory cells and platelet count which may be attributed to its anti-allergic potential. The result of the present investigation is in accordance with findings of a previous investigator where fisetin significantly attenuated inflammatory infiltration which in turn decreased the levels of Th2 cytokines (IL-4, IL-5, IL-13).23

Numerous evidences have suggested that histamine released from activated mast cells causes infiltration of inflammatory cells into nasal mucosa.14,42 This leads to increase in OVA-specific IgE levels in serum. Clinically, it has also been reported that in asthmatic patients, the released IgE are cross-linked with a FcIuR receptor on mast cell surface which resulted in its degranulation.43 This mast cell degranulation was further associated with the release of pro-inflammatory cytokines including tumor necrosis factor-[alpha] (TNF-[alpha]), IL-4 and IL-6.44-46 Furthermore, IgG1 was reported to form a complex with an inhaled allergen which further aggravated Th2 response.47

Outcomes of our methodology coincides with these alterations after OVA challenge, indicating induction of allergic rhinitis in BALB/c mice. However, administration of fisetin caused significant inhibition in elevated levels of OVA-specific IgE, total IgE and IgG1 levels in serum reflecting its antiallergic potential. The result of the present investigation is in accordance with findings of a previous investigator demonstrating its inhibitory potential against IgE and IgG1.23

It has been reported that elevated levels of Th2 cytokines are involved in the synthesis of IgE whereas Th1 cytokines (interferon gamma (IFN-I3)) are responsible for inhibition of IgE synthesis. Thus, an imbalance in Th1 and Th2 response is important in allergic conditions.48 IL-4 is involved in the synthesis of OVA-specific IgE whereas IL-5 selectively associates with differentiation, activation, and survival of eosinophils. Thus, IL-5 is considered as a symptomatic characteristic of AR.49 Furthermore, researchers have showed that IL-13 is another imperative cytokine which played a vital role during the late phase response. Thus, its inhibition is important for providing nasal blockage relief during allergic rhinitis.50

In the present investigation, administration of fisetin significantly inhibited OVA-induced elevated expressions of IL-4, IL-5, and IL-13 in both nasal lavage fluid and spleen, which in turn decreased the OVA-induced nasal symptoms such as nasal rubbing, sneezing, and discharge. Additionally, this notion was further confirmed with histology of nasal mucosal tissue evaluated by HandE stain, where fisetin treated mice showed significantly decreased eosinophil infiltration due to its IL-5 inhibitory potential.

GATA-3 (GATA binding protein), a transcription factor, is a member of the GATA family particularly expressed in Th2 cells. Studies have reported that expression of GATA-3 was significantly up-regulated during the Th-cells differentiation whereas decreased during the Th1 pathway.51,52 In the present study, OVA-challenge resulted in significantly up-regulated GATA-3mRNA expression in spleen tissue followed by elevated Th2 response reflected by increased IL-4, IL-5, and IL-13 mRNA expressions. Interestingly, fisetin treatment decreased the GATA-3 expression followed by down-regulation in Th2 cytokine response. Similar finding was reported by a previous investigator where fisetin reduced Th2 response via inhibition of predominant transcription factor GATA-3, thus exerting its anti-allergic effect.53

In the present study, AR was induced in BALB/c mice via intranasal instillation of antigen which is a simple, inexpensive and non-invasive method of inducing IgE-mediated allergic disease. Nakaya et al. (2006) has reported that, during the challenge of mice with intranasal instillation of OVA, some of the allergens was undoubtedly delivered to the respiratory tract resulting in lung lesions with chronic inflammation.54

Infiltration by lymphocytes, plasma cells, eosinophils as well as mast cells in the bronchial mucosa along with epithelium hyperplasia in the bronchialregion were the characteristic features of this chronic inflammation of lungs.55,56 Histological studies of lungs from AR control mice showed the presence of cells with inflammatory infiltration and epithelium hyperplasia in alveoli. However, treatment with fisetin attenuated these histological aberrations induced by OVA. The result of present investigation is in accordance with the findings of previous researchers where treatment with fisetin corrected histological abnormalities produced after OVA in asthmatic mice.19,23,53

It is concluded that the results obtained, demonstrated the anti-allergic potential of fisetin against ovalbumin-induced allergic rhinitis. Fisetin exerts its anti-allergic effect via inhibition of GATA3 pathway to modulate the Th2 response (IL-4, IL-5and IL-13) and decreases the IgE level which inhibits the OVA-induced nasal symptoms during AR. The present study strongly supports the protective role of fisetin in OVA-induced AR, suggesting that it can be considered as a potential therapeutic alternative for clinical development.

Disclosure of Interest

The authors report no conflict of interest.

Authors' Contribution

LZ: Concept and design, analysis, drafting and final approval of article. AK: Acquisition of data, drafting, critical revision, final approval of article. AM: Acquisition of data, analysis and interpretation. SB: Concept and design, analysis, interpretation, drafting, critical revision and final approval.

ACKNOWLEDGMENTS

The authors would like to acknowledge Dr. K. R. Mahadik, Principal, Poona College of Pharmacy, Bharati Vidyapeeth Deemed University, Pune, India, for providing necessary facilities for the project. This project was funded by Shaanxi Provincial Education Department, 2012 Scientific Research Project (No.12JK0733).

REFERENCES

1. Naclerio RM. Allergic rhinitis. N Engl J Med. 1991; 325 (12): 860-869.

2. Wallace DV, Dykewicz MS, Bernstein DI, Blessing-Moore J, Cox L, Khan DA, et al. The diagnosis and management of rhinitis: an updated practice parameter. J Allergy Clin Immunol. 2008; 122 (2 Suppl): S1-84.

3. Smith JM. Epidemiology and natural history of asthma, allergic rhinitis, and atopic dermatitis (eczema). Allergy, 1988; 2: 891-929.

4. Bousquet J, Bullinger M, Fayol C, Marquis P, Valentin B and Burtin B. Assessment of quality of life in patients with perennial allergic rhinitis with the French version of the SF-36 Health Status Questionnaire. J Allergy Clin Immunol. 1994; 94 (2 Pt 1): 182-188.

5. Peterson JD, Herzenberg LA, Vasquez K and Waltenbaugh C. Glutathione levels in antigen-presenting cells modulate Th1 versus Th2 response patterns. Proc Natl Acad Sci USA, 1998; 95 (6): 3071-3076.

6. Robinson DS. The Th1 and Th2 concept in atopic allergic disease. Chem Immunol. 2000; 78: 50-61.

7. Galli SJ, Grimbaldeston M and Tsai M. Immunomodulatory mast cells: negative, as well as positive, regulators of immunity. Nat Rev Immunol. 2008; 8 (6): 478-486.

8. Kandhare AD, Aswar UM, Mohan V and Thakurdesai PA. Ameliorative effects of type-A procyanidins polyphenols from cinnamon bark in compound 48/80-induced mast cell degranulation. Anat Cell Biol. 2017; 50 (4): 275-283.

9. Pawankar R, Mori S, Ozu C and Kimura S. Overview on the pathomechanisms of allergic rhinitis. Asia Pac Allergy, 2011; 1 (3): 157-167.

10. Naclerio RM, Baroody FM and Togias AG. The role of leukotrienes in allergic rhinitis: a review. Am Rev Respir Dis. 1991; 143 (5 Pt 2): S91-95.

11. Urata Y, Yoshida S, Irie Y, Tanigawa T, Amayasu H, Nakabayashi M, et al. Treatment of asthma patients with herbal medicine TJ-96: a randomized controlled trial. Respir Med. 2002; 96 (6): 469-474.

12. Wen MC, Wei CH, Hu ZQ, Srivastava K, Ko J, Xi ST, et al. Efficacy and tolerability of anti-asthma herbal medicine intervention in adult patients with moderatesevere allergic asthma. J Allergy Clin Immunol. 2005; 116 (3): 517-524.

13. Herz U, Renz H and Wiedermann U. Animal models of type I allergy using recombinant allergens. Methods, 2004; 32 (3): 271-280.

14. Aswar UM, Kandhare AD, Mohan V and Thakurdesai PA. Anti-allergic effect of intranasal administration of type-A procyanidin polyphenols based standardized extract of cinnamon bark in ovalbumin sensitized BALB/c mice. Phytother Res. 2015; 29 (3): 423-433.

15. Small P and Kim H. Allergic rhinitis. Allergy Asthma Clin Immunol. 2011; 7 S.uppl 1 (1): S3.

16. Mantena SK and Katiyar SK. Grape seed proanthocyanidins inhibit UV-radiation-induced oxidative stress and activation of MAPK and NF-kappaB signaling in human epidermal keratinocytes. Free Radic Biol Med. 2006; 40 (9): 1603-1614.

17. Prasath GS and Subramanian SP. Antihyperlipidemic effect of fisetin, a bioflavonoid of strawberries, studied in streptozotocin-induced diabetic rats. J Biochem Mol Toxicol. 2014; 28 (10): 442-449.

18. Suh Y, Afaq F, Khan N, Johnson JJ, Khusro FH and Mukhtar H. Fisetin induces autophagic cell death through suppression of mTOR signaling pathway in prostate cancer cells. Carcinogenesis, 2010; 31 (8): 1424-1433.

19. Goh FY, Upton N, Guan S, Cheng C, Shanmugam MK, Sethi G, et al. Fisetin, a bioactive flavonol, attenuates allergic airway inflammation through negative regulation of NF-kappaB. Eur J Pharmacol. 2012; 679 (1-3): 109-116.

20. Kandhare A, Raygude K, Ghosh P and Bodhankar S. The ameliorative effect of fisetin, a bioflavonoid, on ethanolinduced and pylorus ligation-induced gastric ulcer in rats. Inter J Green Pharmacy, 2011; 5 (3): 236-243.

21. Raygude KS, Kandhare AD, Ghosh P and Bodhankar SL. Anticonvulsant effect of fisetin by modulation of endogenous biomarkers. Biomed Prev Nutr. 2012; 2 (3): 215-222.

22. Ma T, Kandhare AD, Mukherjee-Kandhare AA and Bodhankar SL. Fisetin, a plant flavonoid ameliorates doxorubicin-induced cardiotoxicity in experimental rats: the decisive role of caspase-3, COX-II, cTn-I, iNOs and TNF-alpha. Mol Biol Rep. 2018.

23. Huang W, Li ML, Xia MY and Shao JY. Fisetin-treatment alleviates airway inflammation through inhbition of MyD88/NF-kappaB signaling pathway. Int J Mol Med. 2018; 42 (1): 208-218.

24. McCusker C, Chicoine M, Hamid Q and Mazer B. Site-specific sensitization in a murine model of allergic rhinitis: role of the upper airway in lower airways disease. J Allergy Clin Immunol. 2002; 110 (6): 891-898.

25. OECD. Eutrophication of waters: monitoring, assessment and control. Organisation for Economic Co-operation and Development;[Washington, DC: Sold by OECD Publications and Information Center]; 1982.

26. Tsumuro T, Ogawa M, Minami K, Takubo M, Rahman A, Fujii Y, et al. Effects of mometasone furoate on a rat allergic rhinitis model. Eur J Pharmacol. 2005; 524 (1-3): 155-158.

27. Kandhare AD, Raygude KS, Ghosh P and Bodhankar SL. The ameliorative effect of fisetin, a bioflavonoid, on ethanol-induced and pylorus ligation-induced gastric ulcer in rats. Inter J Green Pharmacy, 2011; 5 (3): 236-243.

28. Wang H, Zhang J, Gao C, Zhu Y, Wang C and Zheng W. Topical levamisole hydrochloride therapy attenuates experimental murine allergic rhinitis. Eur J Pharmacol. 2007; 577 (1-3): 162-169.

29. Carlson JR, Bryant ML, Hinrichs SH, Yamamoto JK, Levy NB, Yee J, et al. AIDS serology testing in low- and high-risk groups. JAMA. 1985; 253 (23): 3405-3408.

30. Kandhare AD, Bodhankar SL, Mohan V and Thakur-desai PA. Effect of glycosides based standardized fenugreek seed extract in bleomycin-induced pulmonary fibrosis in rats: Decisive role of Bax, Nrf2, NF-KB, Muc5ac, TNF-[alpha] and IL-1[beta]. Chem Biol Interact. 2015; 237: 151-165.

31. Devkar ST, Kandhare AD, Zanwar AA, Jagtap SD, Katyare SS, Bodhankar SL, et al. Hepatoprotective effect of withanolide-rich fraction in acetaminophen-intoxicated rat: decisive role of TNF-[alpha], IL-1[beta], COX-II and iNOS. Pharm Biol. 2016: 1-10.

32. Oh HA, Kim HM and Jeong HJ. Beneficial effects of chelidonic acid on a model of allergic rhinitis. Int Immunopharmacol. 2011; 11 (1): 39-45.

33. Kandhare AD, Shivakumar V, Rajmane A, Ghosh P and Bodhankar SL. Evaluation of the neuroprotective effect of chrysin via modulation of endogenous biomarkers in a rat model of spinal cord injury. J Nat Med. 2014; 68 (3): 586-603.

34. Adil M, Kandhare AD, Ghosh P, Venkata S, Raygude KS and Bodhankar SL. Ameliorative effect of naringin in acetaminophen-induced hepatic and renal toxicity in laboratory rats: role of FXR and KIM-1. Ren Fail. 2016; 38 (6): 1007-1020.

35. Ghule AE, Kandhare AD, Jadhav SS, Zanwar AA and Bodhankar SL. Omega-3-fatty acid adds to the protective effect of flax lignan concentrate in pressure overload-induced myocardial hypertrophy in rats via modulation of oxidative stress and apoptosis. Int Immunopharmacol. 2015; 28 (1): 751-763.

36. Visnagri A, Kandhare AD, Chakravarty S, Ghosh P and Bodhankar SL. Hesperidin, a flavanoglycone attenuates experimental diabetic neuropathy via modulation of cellular and biochemical marker to improve nerve functions. Pharm Biol. 2014; 52 (7): 814-828.

37. Cui J, Wang G, Kandhare AD, Mukherjee AA and Bodhankar SL. Neuroprotective effect of naringin, a flavone glycoside in quinolinic acid-induced neurotoxicity: Possible role of PPAR-gamma, Bax/Bcl-2, and caspase-3. Food Chem Toxicol. 2018; 121: 95-108.

38. Yamasaki ML, Sasaki K, Mizutani N, Nabe T, Sakura Y, Matsumoto T, et al. Pharmacological characterization of the leukocyte kinetics after intranasal antigen challenge in a guinea pig model of allergic rhinitis. Inflamm Res. 2001; 50 (9): 474-482.

39. Brightling CE, Symon FA, Birring SS, Bradding P, Pavord ID and Wardlaw AJ. TH2 cytokine expression in bronchoalveolar lavage fluid T lymphocytes and bronchial submucosa is a feature of asthma and eosinophilic bronchitis. J Allergy Clin Immunol. 2002; 110 (6): 899-905.

40. Ngoc PL, Gold DR, Tzianabos AO, Weiss ST and Celedon JC. Cytokines, allergy, and asthma. Curr Opin Allergy Clin Immunol. 2005; 5 (2): 161-166.

41. Kandhare AD, Bandyopadhyay D and Thakurdesai PA. Low molecular weight galactomannans-based standardized fenugreek seed extract ameliorates high-fat dietinduced obesity in mice via modulation of FASn, IL-6, leptin, and TRIP-Br2. RSC Adv. 2018; 8 (57): 32401-32416.

42. Mukherjee AA, Kandhare AD, Rojatkar SR and Bodhankar SL. Ameliorative effects of Artemisia pallens in a murine model of ovalbumin-induced allergic asthma via modulation of biochemical perturbations. Biomed Pharmacother. 2017; 94: 880-889.

43. Gomez E, Corrado OJ, Baldwin DL, Swanston AR and Davies RJ. Direct in vivo evidence for mast cell degranulation during allergen-induced reactions in man. J Allergy Clin Immunol. 1986; 78 (4 Pt 1): 637-645.

44. Bradding P, Roberts JA, Britten KM, Montefort S, Djukanovic R, Mueller R, et al. Interleukin-4, -5, and -6 and tumor necrosis factor-alpha in normal and asthmatic airways: evidence for the human mast cell as a source of these cytokines. Am J Respir Cell Mol Biol. 1994; 10 (5): 471-480.

45. Honmore VS, Kandhare Amit D, Kadam PP, Khedkar VM, Natu AD, Rojatkar SR, et al. Diarylheptanoid, a constituent isolated from methanol extract of Alpinia officinarum attenuates TNF-[alpha] level in Freund's complete adjuvant-induced arthritis in rats. J Ethnopharmacol. 2019; 229: 233-245.

46. Adil M, Kandhare AD, Visnagri A and Bodhankar SL. Naringin ameliorates sodium arsenite-induced renal and hepatic toxicity in rats: decisive role of KIM-1, Caspase-3, TGF-b, and TNF-a. Ren Fail. 2015; 37 (8): 1396-1407.

47. Williams JW, Tjota MY and Sperling AI. The contribution of allergen-specific IgG to the development of th2-mediated airway inflammation. J Allergy (Cairo). 2012; 2012: 236075.

48. Nakai Y, Ohashi Y, Kakinoki Y, Tanaka A, Washio Y, Nasako Y, et al. Allergen-Induced mRNA Expression of IL-5, but Not of IL-4 and IFN-I3, in Peripheral Blood Mononuclear Cells Is a Key Feature of Clinical Manifestation of Seasonal Allergic Rhinitis. Arch Otolaryngol Head Neck Surg. 2000; 126 (8): 992-996.

49. Yamaguchi Y. Highly purified murine interleukin 5 (IL-5) stimulates eosinophil function and prolongs in vitro survival. IL-5 as an eosinophil chemotactic factor. J Exp Med. 1988; 167 (5): 1737-1742.

50. Miyahara S, Miyahara N, Matsubara S, Takeda K, Koya T and Gelfand EW. IL-13 is essential to the late-phase response in allergic rhinitis. J Allergy Clin Immunol. 2006; 118 (5): 1110-1116.

51. Li K, Chen Y, Jiang R, Chen D, Wang H, Xiong W, et al. Protective effects of astragaloside IV against ovalbumin-induced allergic rhinitis are mediated by T-box protein expressed in T cells/GATA-3 and forkhead box protein 3/retinoic acid-related orphan nuclear receptor gammat. Mol Med Rep. 2017; 16 (2): 1207-1215.

52. Shao YY, Zhou YM, Hu M, Li JZ, Chen CJ, Wang YJ, et al. The Anti-Allergic Rhinitis Effect of Traditional Chinese Medicine of Shenqi by Regulating Mast Cell Degranulation and Th1/Th2 Cytokine Balance. Molecules, 2017; 22 (3).

53. Wu MY, Hung SK and Fu SL. Immunosuppressive effects of fisetin in ovalbumin-induced asthma through inhibition of NF-kappaB activity. J Agric Food Chem. 2011; 59 (19): 10496-10504.

54. Nakaya M, Dohi M, Okunishi K, Nakagome K, Tanaka R, Imamura M, et al. Noninvasive system for evaluating allergen-induced nasal hypersensitivity in murine allergic rhinitis. Lab Invest. 2006; 86 (9): 917-926.

55. Holgate ST and Broide D. New targets for allergic rhinitis-a disease of civilization. Nat Rev Drug Discov. 2003; 2 (11): 903-915.

56. Wills-Karp M, Luyimbazi J, Xu X, Schofield B, Neben TY, Karp CL, et al. Interleukin-13: central mediator of allergic asthma. Science, 1998; 282 (5397): 2258-2261.
COPYRIGHT 2018 Knowledge Bylanes
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Biomedica
Article Type:Report
Geographic Code:9INDI
Date:Jun 30, 2018
Words:7878
Previous Article:ROLE OF BMI ON HAND GRIP FORCE WITH RESPECT TO GENDER.
Next Article:LIPOPROTEIN LIPASE GENE POLYMORPHISM - CORRELATION WITH SERUM TRIGLYCERIDES LEVELS.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |