Printer Friendly

AMELIORATE MANEUVER FOR TRANSFORMATION OF LACTOBACILLUS STRAINS BY ELECTROPORATION WITH IBDV-VP2 CHEMICALLY ENGINEERED EXPRESSION VECTOR.

Byline: M. Iram, X. Wang, H. Y. Zhao, B. S. Mohsin, A. M. Nadeem, K. Saima, L. J. Tang and L. Y. Jing

ABSTRACT

Lactobacillus competent cells are considered important vehicles for electro-transform process and express exogenous DNA. Previously several complex protocols were used for electro-transformation of lactobacillus strains. In the preset study, we evaluated an ameliorate maneuver for the preparation of efficient competent cells of lactobacillus. The parameters like (i) washing buffers (ii) optical density 600nm (O.D 0.4-0.5) (iii) plasmid concentration i.e. 2u l-6u l (100ng/u l) (iv) Voltage 2.3-2.4 kv/cm were mainly focused. The high transformation efficiency was recorded in Lactobacillus casie393 (9.9x102 and 2.4x102), Lactobacillus pentosus (1.1x103and 3.1x102), Lactobacillus plantarum (1.2x103 and 3.7x102), with chemically engineered IBDV-vp2 expression plasmids viz., (i) pPG612-HCE-PgsA-vp2-rrnBT1T2, (ii) pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2 by electroporation. Further confirmation of electro-transformation was analyzed by isolation, digestion and PCR.

Hence this method proved simpler and efficient among previously employed methods in the preparation of lactobacillus competent cells. Consequently this procedure makes lactobacillus strains an excellent candidate for electro-transformation, more over could be used for electro-transform of other lactobacillus delivery vectors.

Key words: competent cell; IBDV-vp2; electroporation; lactobacillus; transformation; ameliorate maneuver

INTRODUCTION

Since last few years, bacteria (e.g. gram-positive and gram-negative) are considered as an important carrier agent in the effective delivery of both DNA vaccine construct and vaccine antigens (Liljeqvist et al., 1999; Gentschev et al., 2001). Hence this technique makes it possible to administrate DNA vaccine through mucosal surface; in addition it helps to inject plasmid DNA directly into the professional antigen cells. Many authors reported both humoral and cellular responses against pathogens like HIV (Larisa et al., 2004), and IBDV (Li et al., 2006).

In molecular cloning, Plasmid transformation into the bacterial competent cells by using electroporation has been found an efficient technique (Ryu and Hartin, 1990). Later McCormac (1998) devised relatively a simpler procedure to produce competent cells viz., Agrobacterium tunrefaciers and Agrobacterium rhizobium. Whereas, previously used conventional methods to produce electro-competent cells were found time-consuming and laborious, furthermore these had least transformation efficiency (Enderle and Farwell, 1998; Zhiming et al., 2005). Irrespective of these methods, Berthier et al., (1996) reported electroporation technique for the transfer of plasmid DNA into lactic acid bacteria is considered more reliable, cost effective and efficient method (Berthier et al., 1996).

However Electro-transformation is considered the most reliable and efficient tool for plasmid DNA uptake. It is the trendiest method for introducing exogenous plasmid DNA into lactic acid bacteria. Hence it seems to be an efficient technique for transferring plasmid DNA into lactic acid bacteria (LAB) (Berthier et al., 1996). Since then, several electroporation methods have been developed to increase the transformation efficiency by the use of intact cells or combination of different cell wall weakening agents. These protocols mainly differ in the composition of washing agents, electroporation buffers and change in the electrical pulse according to the nature of DNA use for transformation (Ohse et al., 1995; Xue et al., 1999; Ito and Nagane, 2001).

Electroporation is a mu lti-step process with several distinct phases (Weaver et al., 1996). It mainly increases the permeability of cellular membranes, which allow the passage of larger and highly charged molecules like DNA (Neumann et al., 1982). However, transformation efficiency is strain-dependent and optimization requires improving transformation efficiency for a particular strain (Serror et al., 2002). Whereas, the successful introduction of heterologous plasmid DNA into LAB depends on the strains and application of plasmid vector (Bringel and Hubert, 1990; Thompson et al., 1996). After the first successful application of electroporation in streptococci (Harlander and McKay, 1984), has initiated interest in the possibility of bacterial electro-transformation in LAB. Since then, a number of successful electrotransformation in lactobacilli, lactococci and other LAB have been documented (Scheirlinck et al., 1989; Mercenier et al., 1990; Gory et al., 2001).

The procedures and conditions of electrotransformation were found to fluctuate among the species and strains of LAB. Therefore, it is critical to standardize individual protocol for transformation efficiency improvement on this strain.

Previously a lot of literature is available on the preparation of E. coli competent cells with high transformation efficiency, however there is dearth of knowledge on simple, reliable and more efficient method to prepare high efficiency competent cell of lactobacillus. Moreover commercially prepared competent cells even much expensive and there is dire need for unconventional methods for the preparation of lactobacillus competent cells and electrotransformation. Therefore keeping in mind, the present study was designed to evaluate improved method of competent cell preparation of lactobacillus strains, focusing on the parameters, which standardize electro-transformation protocol for in vitro modified expression vector, ultimately enhance efficiency.

MATERIALS AND METHODS

Bacterial species and plasmid: In the present study three lactobacillus strains i.e. Lactobacillus plantarum, Lactobacillus pentoses, Lactobacillus casei 393 were used to make them competent. These expression systems were successfully electrotransformed with genetically engineered IBDV expression vectors viz., (i) pPG612-HCE-PgsA-vp2-rrnBT1T2 (ii) pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2 containing VP2 gene, HCE promoter, T7g10 enhancer, PgsA anchor and cm resistant. These expression vectors were synthesized in preventive veterinary medicine laboratory, northeast agriculture university Harbin china.

Reagents and solutions for improved method

Washing buffer A: Washing buffer A was prepared in my laboratory by dilution of 1: 1000 EPB into the water, set the pH at 7.4, autoclaved at 100c. EPB is the mixture of Monosodium Phosphate NaH2PO4.2H2 (.018g) and magnesium chloride MgCl2.6H2O (0.04g) in 200ml H2O. Further autoclaved and filtered.

Washing buffer B: Washing buffer B was prepared by 20% sucrose H2O.

Extending MRS: Prepare Sterile 2% glycine MRS as an extending MRS for bacterial cu lture.

Recovery MRS: Sterile 20% sucrose MRS was used as recovery MRS.

Engineering of expression vector: IBDV vp2 gene was obtained from Veterinary Medicine College northeast agriculture university Harbin china.it was amplified by using polymerase chain reaction (PCR) with the specified pair of forward and reverse primer synthesized by 'BoShi Sheng Wu' Company. These forward (5'GAGCTCATGACGAACCTGCAAGAT3') and reverse (5'GTTAACCACCTCCATGAAGTACTCGCG 3') primers contained SacI and HpaI restriction sites respectively. Gene amplification was performed according to procedure documented by (Gang and Jing, 2007) with little modification in PCR system like: 95c for 5 min, 20 cycles of 94c for 1 min; 55c for 1 min; 72c for 90 s and 72c for 10 min for final extension.. Vp2 was purified by digesting with restriction enzymes SacI and HpaI. It was ligated with pMD-18-Tsimple vector and transformed into TG1 and check for nucleotide sequence comparison of vp2 (Gene bank) with the public database by using program BLAST. The BLAST result was 99% of identity of vp2.

This vp2 was purified and digested again with specified restriction enzymes and inserted into expression vector pPG612-HCE-PgsA-rrnBT1T2 (4954bp) to get pPG612-HCE-PgsA-vp2-rrnBT1T2 expression vector and also ligated T7g10 enhancer to pPG612-HCE-PgsA-vp2-rrnBT1T2 to get pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2 expression vector. As a result got two expression vectors one with T7g10 enhancer and vp2 gene and other without T7g10 enhancer but with vp2 gene i.e. (i) pPG612-HCE-PgsA-vp2-rrnBT1T2 (ii) pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2.

Preparation of competent cells and bacterial electroporation:

Improved EPB (Electroporation Phosphate Buffer) method: Pick a single colony (2-3mm in diameter) from the growing plate that had been incubated for 16-20 hours at 37c. The colony was transferred into 5ml MRS broth for 16-20 hours at 30c without shaking in anaerobic condition. Starter culture (2ml) was used to incubate 100ml MRS extending medium for 2-3 hrs at 37c until mid exponential phase (O.D600 reach 0.5-0.6), transferred the culture flask on ice for 30 minutes. These cells were pelleted by centrifugation at 3500 rpm for 10 min at 4c, then gently resuspend cells in one half volume (20ml) with ice-cooled washing buffer A (repeat this step for two times), later resuspend these cells with ice-cooled washing buffer B (20ml) at 4c for 10 min (repeat this step for three times). Use 1ml washing buffer B to yield final competent cells suspension. Competent cells can be stored at -140c for future use.

Sucrose magnesium chloride method: Lactobacillus Competent cells preparation were performed as described previously (Ho, et al. 2005; Liu et al. 2012). A 2ml starter solution from 16-20 h Lactobacillus culture was inoculated into 100 ml MRS broth and incubated at 37c without shaking. The cells were pelleted at OD 0.5-0.6 by centrifugation at 3000 g for 10 min at 4c and washed twice with one half volumes (20ml), volume of ice-cold sucrose magnesium chloride electroporation buffer (SMEB) (250 mM sucrose, 1mM MgCl, 5mM sodium phosphate, pH 7.4). The cells were concentrated 100fold of original culture volume in ice-cold SMEB buffer.

Electroporation protocol use for this experiment: Electrotransformation of these competent cells were performed as described previously by Liu et al., (2012) with some modification. Briefly, Took 200u l competent cells and add 6u l plasmid DNA (100ng/u l) and Incubate on ice for 20 min. Transferred to a pre-chilled cuvette (inter-electrode distance 1mm). The cuvette was connected parallel to 200 resistor (pulse controller; Bio-Rad) generating peak field strength of 2.5kvcm-1, time constant: 4-5ms. Immediately following the discharge, the suspension was diluted with 1ml recovery MRS, transfer into 15ml pre-chilled tube, add 2ml more recovery MRS to 3ml final volume. Incubate on ice for 5 minutes at 37c for 2-3 hrs without shaking in anaerobic condition. Spread 300-500u l on the pre-warm antibiotic resistant MRS plate. Incubate plated at 37c for 24-48 hrs in anaerobic condition.

RESULTS

Construction of expression vector: The 1287bp vp2 gene was successfully amplified by polymerase chain reaction (Fig. 3). Further it was cloned into a pMD-18-T simple vector, confirmed by sequence analysis. This vp2 gene ligated with an expression vector to generate pPG612-HCE-PgsA-vp2-rrnBT1T2 (Fig. 1) and also add enhancer to get pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2 (Fig. 2), transformed into TG1 by the heat shock method. These plasmids were screened by PCR and single double digestion using restriction enzyme SacI and HpaI resulted in one vector fragment (pPG612-HCE-PgsA-vp2-rrnBT1T2, pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2) and two bands (vp2 band and vector band) (fig. 4.) PCR and restriction enzyme digestion analysis showed that recombinant expression plasmids pPG612-HCE-PgsA-vp2-rrnBT1T2 and pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2 could be successfully constructed and transformed into TG1.

Electrotransformation of recombinant expression vector into Lactobacillus strains: Competent cells were prepared by using the method described in materials and methods. The electro transformed L.casie, L.pentoses, L.plantarum were used in vitro modified vectors i.e. pPG612-HCE-PgsA-vp2-rrnBT1T2, pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2 isolated from TG1. We observed colonies on specific antibody resistant MRS plates. The respective lactobacillus transformant containing pPG612-HCE-PgsA-vp2-rrnBT1T2 and pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2 plasmid DNA were extracted and subjected to restriction enzyme for digestion, PCR and sequencing was carried out for identification and confirmation of electro transformation. Moreover in both methods it was found that modification in following factors influenced electroporation i.e. washing buffer, O.D of bacterial growth, conc. of plasmid use for transfer and electric pulse.

Comparison of old and improved method: In the current study, three lactobaccilus strains were treated with both methods. high efficiency transformation of L.casie strains (9.9x102 to 2.2x102 and 2.4x102 to 3.0x101), L.pentosus (1.1x103 to 2.6x102 and 3.1x102 to 7.0x101), L.plantarum (1.2x103 to 4.9 x103 and 3.7x102 to 1.2x102) (table 1) were achieved by improved and old method with chemically engineered IBDV-vp2 expression plasmids: i) pPG612-HCE-PgsA-vp2-rrnBT1T2 (ii) pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2 by electroporation respectively. We found that transformation efficiency by using improved method was high and sufficient for cloning needs. (Graph 1) Further analyses were carried out by plasmid isolation from these transformants strains and confirmed by PCR and digestion.

Table 1. Transformation efficiency of plasmid DNA to different lactic acid strains.

plasmid###strain###transformation efficiency

###Improved method###Old method

pPG612-HCE-PgsA-vp2-rrnBT1T2###L.plantarum###1.2x10 3###4.9x10 2

pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2###L.plantarum###3.7x10 2###1.2x10 2

pPG612-HCE-PgsA-vp2-rrnBT1T2###L.pentosus###1.1x10 3###2.6x10 2

pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2###L.pentosus###3.1x10 2###7.0x10 1

pPG612-HCE-PgsA-vp2-rrnBT1T2###L.casei###9.9x10 2###2.2x10 2

pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2###L.casei###2.4x10 2###3.0x10 1

DISCUSSION

In recent years, many lactic acid bacterial (LAB) vectors have been constructed and used to express and deliver heterologous pathogen antigens (Maassen et al., 1999; Scheppler et al., 2002; Oliveira et al., 2003; Ho et al., 2005). Which are helpful to explore live bacterial vehicle vaccines for the prevention of infectious diseases especially IBDV. Bacteria that are capable to take up DNA are called "competent". In the present study, competent cells of lactobacillus strains viz., L. casei, L. plantarum and L. pentoses were successfully prepared by using simple and precise methods, which might be useful to prepare vaccines, moreover this method can also be used for other LAB strains. We made numerous attempts to electrotransform Lactobacillus strains with in vitro modified plasmid isolated from E.coli strain (JM109) by using previously described methods but no success (Liu et al., 2012). Hence we developed a protocol (given in materials and methods) for electrotransformation.

The designed protocol was found highly successful and we found transformant colonies of lactobacillus casei, L. pentoses, L.plantarum containing recombinant plasmid isolated from E.coli strain (JM109). For the purpose to make cell competent all the salt from the cell suspension must be removed by extensive washing. Although low salts buffer is usually used to remove these salts.

The most significant thing that the bacterial cells must be in their early logarithmic growth period, Ryu and Hartin (1990) has pointed out the significance of the log phase for transformation. The growth curves of three different lactobacillus strains are shown in Figure 4.

Competent cells prepared from O.D600 of bacterial cu ltures reached at 0.4 to 0.5 will have more efficiency and bacterial culture outside this optimal O.D600 range will have low or no transformation capacity. Voltage is another important factor largely influences elctro-competent cells (Bringel et al., 1990). In the present study 2.3-2.4 kv/cm range of voltage was found suitable for transformation process. Further Plasmid concentration also play important role in this process, hence various concentrations of plasmid were evaluated like 1u l plasmid DNA (100ng/u l), 10u l plasmid DNA (100ng/u l), 15u l plasmid DNA (100ng/u l), 20u l plasmid DNA (100ng/u l), however 6u l plasmid DNA (100ng/u l) was recorded most suitable for this process. Moreover we found that, if competent cells used soon after electroporation showed more efficiency than older one.

These competent cells could also be preserved at -70 for up to 20 days, and at -40 for up to 5-7 days later they reduce their transformation efficiency (Zhiming et al., 2005).

Using the protocol describes in materials and methods we prepare our competent cell and continue electroporation. During experiment we investigated that various factors i.e. washing buffer, O.D of bacterial growth, concentration of plasmid use for transfer, electric pulse influence electroporation. Our different attempts of electroporation showed that Voltage (2.3-2.4 kv/cm) were more suitable for the bacterial growth with optical density 600nm (0.4-0.5).In the current study, high efficiency transformation of L.casie (9.9x102 and 2.4x102), L.pentosus (1.1x103and 3.1x102), L. plantarum (1.2x103 and 3.7x102), investigated with chemically engineered IBDV-vp2 expression plasmids; i) pPG612-HCE-PgsA-vp2-rrnBT1T2 (ii) pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2 by electroporation.

Transgenic vectors pPG612-HCE-PgsA-vp2-rrnBT1T2, pPG612-HCE-T7g10-PgsA-vp2-rrnBT1T2 were constructed expressing vp2 protein of IBDV. VP2 protein is a host protective antigen. It induces virus-neutralizing antibodies that protect susceptible chickens from IBDV infection (Fahey et al., 1989; Macreadie et al., 1990). In the current study we used these vectors for electro transformation into lactobacillus strains. Further studied are needed to assess the efficacy of vaccination in chicken with these delivery systems delivering recombinant expression plasmids encoding vp2 against IBDV.

Acknowledgments: This work was supported by Grant No. 31272594 from the National Natural Science Funds of China.

REFERENCES

Alegre, M.T., M.C. Rodriguez, and J.M. Mesas (2004). Transformation of Lactobacillus plantarum by electroporation with in vitro modified plasmid DNA. FEMS Microbiol. Lett. 241: 73-77.

Berthier, F., M. Zagorec, M. Champomier-Verges, S.D. Ehrlich, and F. Morel-Deville (1996). Efficient transformation of Lactobacillus sake by electroporation. Microbiology. 142(5): 1273-1279.

Bringel, F. and J.C. Hubert (1990). Optimized transformation by electroporation of Lactobacillus plantarum strains with plasmid vectors. Appl. Microbiol. Biotechnol. 33: 664-670.

ENDERLE, J.P. and M.A. FARWELL (1998). Electroporation of freshly plated Escherichia coli and Pseudomonas aeruginosa cells. Bio Techniques. 25: 954-958.

Fahey, K.J., K. Emy, and J.A. Crooks (1989). A conformational immunogen on VP2 of infectious bursal disease virus that induces virus neutralizing antibodies that passively protect chickens, J. Gen. Virol. 70: 1473-1481.

Gang, Y.X. and L.Y. Jing (2007). Induction of Immune Responses in Mice after Intragastric Administration of Lactobacillus casei Producing Porcine Parvovirus VP2 Protein. Appl. Environ. Microb. 73: 7041-7047.

Gentschev I., G. Dietrich, S. Spreng, A. Kolb-Maurer, V. Brinkmann, and L. Grode (2001). Recombinant attenuated bacteria for the delivery of subunit vaccines. Vaccine. 19: 2621-2628.

Gory, L., M.C. Montel, and M. Zagorec (2001). Use of green fluorescent protein to monitor Lactobacillus sakei in fermented meat products. FEMS Microbiol. Lett. 194: 127-133.

Harlander, S.K. and L.L. McKay (1984). Transformation of Streptococcus sanguis Challis with Streptococcus lactis plasmid DNA. Appl. Environ. Microbiol. 48: 342-346.

Ho, P.S., J.K. Wang, and Y.K. Lee (2005). Intragastric administration of Lactobacillus casei expressing transmissible gastroentritis coronavirus spike glycoprotein induced specific antibody production. Vaccine. 23(11): 1335-1342

Ito, M. and M. Nagane (2001). Improvement of the electro-transformation efficiency of facu ltatively alkaliphilic Bacillus pseudofirmus OF4 by osmolarity and glycin treatment. Biosci. Biotechnol. Biochem. 65: 2773-2775.

Larisa I.K., A.N. Nadezhda, A.I. Alexander, R.L. Leonid, M.I. George, and P.A. Alaxander (2004). Comparative analysis using a mouse model of the immunogenicity of artificial VLP and attenuated Salmonella strain carrying a DNA-vaccine encoding HIV-1 polyepitope CTL immunogen. Vaccine. 22: 1692-1699.

Li L., W. Fang, J. Li, L. Fang, Y. Huang, and L. Yu (2006). Oral DNA vaccination with polyprotein gene of infectious bursal disease virus (IBDV) delivered by attenuated Salmonella elicits protective immune responses in chickens. Vaccine. 24: 5919-5927.

Liu, M., L.L. Zhao, G.J. Wei, Q.X. Yuan, L.Y. Jing, and L.D. Qui (2012). Immunogenicity of Lactobacillus-expressing VP2 and VP3 of the infectious pancreatic necrosis virus (IPNV) in rainbow trout. Fish Shellfish Immun. 32: 196-203.

Liljeqvist, S. and S. Stahl (1999). Production of recombinant subunit vaccines: protein immunogens, live delivery systems and nucleic acid vaccines. J. Biotechnol. 73(1): 1-33.

Maassen, C.B.M., J.D. Laman, M.J. Heijne den Bak-Glashouwer, M.J.M. Tielen, J.C.P.A. van Holten-Neelen, L. Hoogteijling, C. Heijmans-Antonissen, R.J. Leer, P.H. Pouwels, W.J.A. Boersma (1999). Instruments for oral disease-intervention strategies: recombinant Lactobacillus casei expressing tetanus toxin fragment C for vaccination or myelin proteins for oral tolerance induction in mu ltiple sclerosis. Vaccine. 17(17): 2117-2128.

Macreadie, I.G., P.R. Vaughan, A.J. Chapman, N.M. McKern, M.N. Jagadish, H.G. Heine, C.W. Ward, K.J. Fahey, and A.A. Azad (1990). Passive protection against infectious bursal disease virus by viral VP-2 expressed in yeast. Vaccine. 8(6): 549-552.

Mercenier, A. (1990). Molecu lar genetics of Streptococcus thermophilus. FEMS Microbiol. Rev. 7(1-2): 61-77.

MCCORMAC, A.C., M.C. ELLIOTT, and D.F. CHEN (1998). A simple method for the production of highly competent cells of Agrobacterium for transformation via electroporation. Mol. Biotechnol. 9(2): 155-159.

Neumann, E., M. Schaefer-Ridder, Y. Wang, and P.H. Hofschneider (1982). Gene transfer into mouse lyoma cells by electroporation in high electric fields. The EMBO J. 1(7): 841-845.

Ohse, M., K. Takahashi, Y. Kadowaki, and H. Kusaoke (1995). Effects of plasmid DNA sizes and several other factors on transformation of Bacillus subtilis ISW1214 with plasmid DNA by electroporation. Biosci. Biotechnol. Biochem. 59(8): 1433-1437.

Oliveira, M.L.S., V. Monedero, E.N. Miyaji, L.C.C. Leite, P.L. Ho, and G. Perez-Martinez (2003). Expression of Streptococcus pneumoniae antigens, PsaA (pneumococcal surface antigen A) and PspA (pneumococcal surface protein A) by Lactobacillus casei. FEMS Microbiol. Lett. 227(1): 25-31.

RYU, J. and R.J. HARTIN (1990). Quick transformation in Salmonella typhimurium LT2, Biotechniques. 8(1): 43-44.

Scheirlinck, T., J. Mahillon, H. Joos, P. Dhaese, and F. Michiels (1989). Integration and expression of a-amylase and endoglucanase genes in the Lactobacillus plantarum chromosome. Appl. Environ. Microbiol. 55: 2120-2137.

Scheppler, L., M. Vogel, and A.W. Zuercher (2002). Recombinant Lactobacillus johnsonii as a mucosal vaccine delivery vehicle. Vaccines. 20(23-24): 2913-2920

Serror, P., T. Sasaki, D. Ehrlich, and E. Maguin (2002). Electrotransformation of Lactobacillus delbrueckii subsp. bu lgaricus and L. delbrueckii subsp. Lactis with various plasmids. Appl. Environ. Microb. 68: 46-52.

Thompson, K. and M.A. Collins (1996). Improvement in electroporation efficiency for Lactobacillus plantarum by the inclusion of high concentrations of glycine in the growth medium. J. Microbiol. Methods. 26: 73-79.

Weaver, J. C. and Y.A. Chizmadzhev (1996). Theory of electroporation: A review. Bioelectrochem. Bioenerg. 41 (2): 135-160.

Woo P.C.Y., L.P. Wong, B.J. Zheng, K.Y. Yuen (2001). unique immunogenicity of hepatitis B virus DNA vaccine presented by live attenuated Salmonellatyphimurium. Vaccine. 19: 2945-2954.

Xue, G., J.S. Johnson, and B.P. Dalrumple (1999). High osmolarity improves the electrotransformation efficiency of the gram-positive bacteria Bacillus subtilis and Bacillus licheniformis. J. Microbiol. Methods. 34: 183-191

Zhiming, T., H. Guangyuan, L.X. Kexiu, C.J. Mingjie, C. Junli, C. Lin, Y. Qing, L. Dongping, Y. Huan, S. Jiantao, and W. Xuqian (2005). An improved system for competent cell preparation and high efficiency plasmid transformation using different Escherichia coli strains. Electron. J. Biotechnol. 8(1): 113-120.
COPYRIGHT 2016 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of Animal and Plant Sciences
Date:Jun 30, 2016
Words:3797
Previous Article:PHYSIOLOGICAL CHANGES AGAINST MELOIDOGYNE INCOGNITA IN RHIZOBACTERIAL TREATED EGGPLANT UNDER ORGANIC CONDITIONS.
Next Article:EFFECTS OF 20-HYDROXYECDYSONE AND INSULIN APPLICATION ON REPRODUCTION IN EPHESTIAKUEHNIELLA ZELLER (LEPIDOPTERA: PYRALIDAE).

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |