Printer Friendly

A note on the molecular phylogeny of a small sample of Catantopine grasshoppers.

Abstract

Somewhat surprisingly, the rather speciose subfamily Catantopinae has largely evaded phylogenetic scrutiny. This note describes relationships among a small, but larger than that heretofore studied, subset of members based on an analysis of mitochondrial sequence characters.

Analysis of portions of 4 mitochondrial genes, some sequenced in this laboratory and some obtained from Gen Bank, was applied to 12 specimens of Catantopinae. Also included were representatives of the subfamilies Calliptaminae, Cyrtacanthacridinae, Eyprepocnemidinae, Melanoplinae and Oxyinae. Pyrgornorpha conica served as the outgroup. Sequences were analyzed by weighted and unweighted maximum parsimony and Bayesian methods.

Both weighted parsimony and Bayesian approaches, with some minor exceptions, yielded similar relationships. Although some clusters of catantopines do occur, molecular results appear to confirm earlier suspicions that the subfamily is not monophyletic and therefore should be subdivided. More work clearly needs to be devoted to the Catantopinae in order to determine the nature and extent of the subfamily's inevitable sundering.

Key words

Acrididae, Catantopinae, phylogeny, mitochondrial DNA

Introduction

As with many subfamilies that comprise the Acrididae, the Catantopinae have had a rather inconstant taxonomic past. Questions regarding membership, their nearest relations, and monophyly are far from settled. Some orthopterists (e.g., Bellman & Luquet 1995; Huo et al. 2007; Li et al. 2011) continue to adhere to Dirsh's (1975) system of dumping together and assigning subfamilies Calliptaminae, Catantopinae, Cyrtacanthacridinae, Eyprepocneminae and Oxyinae, among others, to the family "Catantopidae". This construct was adumbrated earlier by Mishchenko (1952) who divided the assemblage into more or less the same subsets, tribes in this case. Many of the latter are now regarded as bona fide subfamilies of Acrididae as documented in the current Orthoptera S, pecies File (OSF--Eades et al. 2013). Various components of Catantopinae's contorted history are described by Vickery and Kevin (1985), Song and Wenzel (2008), and Li et al. (2011). The latter correctly points out that questions of relationship and monophyly cannot suitably be addressed without a proper phylogeny. The only extensive morphology-based phylogeny of Catantopinae appeared just recently (Li et al. 2011), but, as will be discussed later, findings are not entirely clear. Previously, small numbers of Catantopinae had been included in a few morphological studies in which the primary goals focused on the evolution of specific traits rather than on phylogeny (Eades 2000; Song & Wenzel 2008).

Analysis of DNA sequences has not been particularly illuminating either. Given the large number of catantopines worldwide (Otte 1995), there have been surprisingly few molecular phylogenetic studies of the subfamily. Within the past 6 years, about 10 reports have appeared which examine relationships among the aforementioned subfamilies, including Catantopinae. A major shortcoming of these studies is that only 3 or fewer catantopine genera were included. In fact, in some cases (e.g., Zhao et al. 2011), genera labelled as Catantopinae are instead members of the Melanoplinae. Sun et al. (2010) did publish the complete genome of a supposed catantopine, Primnoa, but it too turns out to be a melanopline, according to the OSF.

The aim of this note is to revisit questions of monophyly and relatedness among a somewhat greater sampling of the Catantopinae (sensu OSF) than that previously undertaken. From the outset it should be stated that by no means is this study exhaustive or to be viewed as definitive, given the relatively small number of taxa and tribes sampled. Nevertheless, it does represent one of the first studies that focuses primarily on the phylogenetics of the subfamily itself (sensu OSF).

Materials and methods

Species, along with sources, geographical ranges and subfamilial affiliations (sensu OSF) are listed in Table 1. Of the subfamily's 18 tribes, 3 are represented here; one genus, Apalacris, is unassigned. Three genera are restricted to Australia; the rest are more widely distributed in the Old World. Representatives of Calliptaminae, Cyrtacanthacridinae, Eyprepocneminae, Melanoplinae and Oxyinae are also included. Pyrgomorpha served as the outgroup.

This investigation was based on sequences obtained from specimens sent to this laboratory by colleagues; other sequences (those of the first 6 taxa and Oxya), were obtained from GenBank. DNA samples analyzed in this laboratory were extracted from specimens using a QIAGEN DNeasy tissue kit (Mississauga, Canada). Portions of the mitochondrial genes encoding cytochrome oxidase subunits I (CO1) and II (CO2), cytochrome b (cytb) and NADH dehydrogenase subunit V (ND5) were amplified and sequenced. Primer sequences, PCR gene amplification conditions, as well as DNA sequencing methods, are described elsewhere (Litzenberger & Chapco 2001a, 2001b; Contreras & Chapco 2006).

Sequences were easily aligned by visual inspection, transferred into MacClade (Maddison & Maddison 2004) and analyzed using the software packages PAUP* (version 4.0b8--Swofford 2003) and MrBayes (Version 3.2--Ronquist et al. 2011). Both standard maximum parsimony (MP) and weighted parsimony (wMP), as described by Farris (1969), were conducted. Searches were repeated using all substitutions at the first 2 codon positions but only tranversional substitutions at the third position (methods referred to as MP 123TV and wMP123TV, respectively). All (heuristic) parsimony searches employed the TBR branch-swapping option with 10 random addition replicates. Bayesian analysis applied default settings with respect to prior distributions, number of chains, start trees, etc. Eight Monte Carlo Markov chains, 1 cold and 7 heated, were run simultaneously for 50 million generations when convergence had been attained. Trees were sampled every 500 generations; consensus of the last 10000 trees was calculated. Data were partitioned according to codon position and gene; each partition was allowed to follow its own GTR + G + I evolutionary model. Levels of support for parsimony-derived relationships were estimated through 1000 bootstrap replicates. Maximum likelihood procedures were not performed owing to the excessive run-times that would be required for bootstrapping. For Bayesian analyses, measures of nodal support appeared in the form of posterior probabilities (PP). For all analyses, the 4 sequences were treated as a combined unit, a procedure that, as in our previous studies, always yielded trees with greater resolution and support when compared to those based on single genes.

Results

Sequences analyzed here are devoid of inserts and/or deletions and are indeed believed to be mitochondrial and not nuclear pseudogene inserts. Moreover, the sequences adhere to other criteria set out previously by Zhang and Hewitt (1996) for ensuring that they are mitochondrial.

Of the different parsimony searches, wMP123TV yielded the tree with the greatest resolution, presented as a bootstrap consensus tree in Fig. 1. In general, very similar relationships were uncovered by the Bayesian method (Fig. 2). Members of Catantopinae, singly of in groups, are located in 5 areas of both trees. At the tree's apex, 6 catantopines form a clade, 5 belonging to the tribe Catantopini. In a second location, Pezotettix (tribe Pezotettigini) is tightly linked to a member of the subfamily Eyprepocnemidinae; together they are basal to the above sextet. Another group of catantopines, external to the aforementioned, consists of the Australian trio: Coryphistes, Goniaea, Theomolpus. Although the cluster has excellent support, their inter-associations differ between the 2 trees. The phylogenetic position of Traulia (tribe Trauliini) is unclear. In the parsimony tree, the genus has a moderately strong association with Calliptamus, whereas in the Bayesian tree it is as part of a polytomy at the crown end. Sphenophyma is the first catantopine to diverge, occupying a position at the tree's base. It belongs to the tribe Pezotettigini but is distant from the latter's only other member, Pezotettix.

Among the other subfamilies, members of Oxinae and Melanoplinae are next to diverge after Sphenophyma. The Calliptamus branch follows, but as stated above, it is linked with Traulia in the parsimony tree; in the Bayesian topology it appears alone. With respect to the 2 members of the Cyrtacanthacridinae, parsimony analysis places the pair at the base of the crown sextet plus Platyphyma-Eyprepocnemus and inside the Australian group, albeit with weak support. In the Bayesian tree, the pair is part of a large polytomy as seen in Fig 2.

Discussion

Clearly, the subfamily Catantopinae (and the 2 tribes Catantopini and Pezotettigini for that matter) cannot be regarded as monophyletic. Historically, Catantopinae have been variously labelled as "le groupe artificiel" (Amedegnato 1974), a "heterogeneous group" (Song & Wenzel 2008; see also Dirsh 1975) and--owing to its variability--a subfamily that "should be subdivided" (Vickery 1997). Lack of monophyly had already been inferred by Ma et al. (2006), Wang et al. (2008) and Liu et al. (2008); however, fewer taxa and shorter DNA sequences were analyzed and branch support values on the whole were low. Curiously, Li et al. (2011) in their morphological study claimed that 4 of the 7 subfamilies of Catantopidae are monophyletic, including Catantopinae. Yet this is clearly not the case, which even a cursory examination of their trees should reveal. Catantops, Stenocatantops and Xenocatantops do indeed cluster together as they do here, but other catantopines in their study, such as Pachyacris, Ecphanthacris, Fer and Bannacris, are sprinkled throughout their topologies.

Catantopinae can be added to a seemingly growing list of other subfamilies recently deemed to be non-monophyletic: Acridinae, Gomphocerinae and Oedipodinae (Chapco & Contreras 2011), and perhaps Melanoplinae (Chintauan-Marquier et al. 2011) but not, apparently, Cyrtacanthacridinae (Song & Wenzel 2008) or Proctolabinae (Rowell & Flook 2004). As expressed by Key and Colless (1993) [see also Amedegnato 1993; Rowell 2005], many traits commonly used for taxonomic purposes are particularly subject to evolutionary convergence (e.g., by "tracking" environmental changes) and may, for some reason, be more common in orthopteran insects than previously acknowledged.

It is difficult to compare the present findings with those in the literature owing to the spotty occurrence of catantopines in those works. A few points of interest warrant mention however.

The crown clade.--The linking of Catantops and Xenocatan tops mirrors the morphological results of Li et al. (2011) and molecular findings of Wang et al. (2008). With respect to the tribally unassigned Apalacris, both studies position the genus far from the aforementioned pair (see also Liu et al. 2008), albeit with low bootstrap support. Mishchenko (1952) placed Apalacris within the tribe Coptacrini, which has since been elevated to a subfamily of Acrididae (Coptacridinae). There may indeed be some support for an association with the latter if the morphology-based phylogeny derived by Li et al. (2011) is upheld by comprehensive molecular studies in the future. [It should be noted that the analysis of a short segment of the CO2 gene by Ma and Huang (2006) also suggested an association with the Coptacridinae]. It will, therefore, be interesting to see if including Coptacridinae sequences will alter the current placement of Apalacris.

Traulia.--The obvious lack of affinity between Traulia and other members of the Catantopinae, appears to agree with the findings of Eades (2005) and Liu et al. (2008) who, respectively, examined orthopteran phallic anatomy and mitochondrial fibosomal sequences. The genitalic anatomy of Traulia is shown to be quite different from that of other catantopines; instead, structures appear to resemble those of the Oedipodinae to which Eades contemplates making a possible taxonomic shift. Liu et al. (2008) also distanced Traulia from other catantopines, but unlike Eades, discovered that it was far removed from the oedipodines (see also supporting molecular evidence by Zhao et al. 2011). In any case, it is presently uncertain where Traulia belongs.

Pezotettix and Sphenophgma.--Both belong to the tribe Pezotettigini, which evidently is not monophyletic. There is very little mention of these genera in the molecular literature apart from the use of the Pezotettix as an outgroup in 2 studies (Hochkirch & Gorzig 2009; Chintauan-Marquier et al. 2011).

Sphenophyma is currently geographically restricted to Asia Minor (Fishelson 1985) and is the first genus to diverge from the common ancestor of the entire body of taxa studied. This region may have been the place of origin for these subfamilies whose antecedents dispersed from there. Another plausible scenario is that the common ancestor was widespread and some elements evolved into the present day, range-limited, Sphenophyma. Other ancestors gave rise to, in turn, Oxynae, Melanoplinae, and so on (see Figs for branching sequences).

The Australian genera.--It is interesting that the 3 Australian genera analyzed here do forma clade, but given this miniscule sample it is impossible, although tempting, to make any inferences about their biogeographical origins.

Relationship among the "spine-throats".--After the divergence of Sphenophyma, the temporal sequence of branching of the other subfamilies (some scattered among the catantopines) appears to be: Oxyinae, Melanoplinae, Calliptaminae, Cyrtacanthacridinae and Eyprepocnemidinae. This sequence is somewhat similar to the branching order discovered by Liu et al. (2008) and Zhao et al. (2011) who, respectively, analyzed sequences of 12S+16S rDNA and those of the mitochondrial control region (see also Rowell & Flook 1998 who also included 18S sequences). In all investigations, Catantopinae is shown to be more closely related to the Cyrtacanthacridinae than either is to Melanoplinae or Oxyinae. With respect to the position of Calliptaminae, present results agree with those of Rowell and Flook (1998) but not with the findings of Zhao et al. (2011). Of the 3 papers, only Rowell and Flook include Eyprepocnemidinae and here it occupies an unresolved position relative to the other subfamilies.

Based on this admittedly limited study, it can be stated that Vickery's (1989) suggestion that Catantopinae should be subdivided rings true. Clearly much more work needs to be done to discover what those dividing lines should be.

Appendix 1. The following sequence, owing to Genbank's limitations regarding sequence length, is reproduced here.

Theomolpus pulcher COII gene (translation starts at base 1):

GATACTTACATAACAACAGAAAAAGAATTAAATAATAATTGAATTCCGATTACTTGATGTFCATAATCGAACAATCTTACCCATAAATACAGAAGTACGAGTATTAACTAGAGCATCTG ATGTACITCATTCATGAGCAGTTCCCGCACTGGGAGTAAAAATTGATGCTACACCAGGACGACTCAAT

Acknowledgements

The technical assistance of D. Contreras is warmly acknowledged. Gratitude is expressed to J.-P. Camacho (University of Granada, Spain), M. Cigliano (Museo de La Plata, Argentina), B. Giplak (Akdeniz University, Turkey) and D. Rentz (CSIRO, Australia) for kindly providing, of helping to collect, grasshopper specimens. E. Chapco is thanked for helpful comments on the manuscript. This work was funded by a grant from the Natural Sciences and Engineering Research Council of Ganada.

References

Amedegnato C. 1974. Les genres d'acridiens neotropicaux, leur classification par familles, sous-familles et tribus. Acrida 3: 113-204.

Amedegnato C. 1993. African-American relationships in the acridians (Insecta, Orthoptera), pp. 59-75. In: George W., Lavocat R. (Eds). The Africa-South America Connection. Clarendon Press, Oxford.

Bellmann H., Luquet G.C. 1995. Guide des Sauterelles, Grillons et Criquets d'Europe Occidentale. Delachaux et Niestle. Paris, France.

Chapco W., Contreras D. 2011. Subfamilies Acridinae, Gomphocerinae and Oedipodinae are "fuzzy sets": A proposal for a common African origin. Journal of Orthoptera Research 20: 1-18.

Chintauan-Marquier I.C., Jordan S., Berthier P., Amedegnato C., Pompanon F. 2011. Evolutionary history and taxonomy of a short-horned grasshopper subfamily: The Melanoplinae (Orthoptera: Acrididae). Molecular Phylogenetics and Evolution 58: 22-32.

Contreras D., Chapco W. 2006. Molecular phylogenetic evidence for multiple dispersal events in gomphocerines grasshoppers. Journal of Orthoptera Research 15: 91-98.

Dirsh V.M. 1975. Classification of the acridomorphoid insects. E.W. Classey. Faringdon, UK.

Eades D.C. 2000. Evolutionary relationships of phallic structures of Acridomorpha (Orthoptera). Journal of Orthoptera Research 9:181-210.

Eades D.C., Otte D., Cigliano M.M., Braun H. 2013. Orthoptera Species File Online Version 2.0/4.0. http://OSF.orthoptera.org.

Fartis J.S. 1969. A successive approximations approach to character weighting. Systematic Zoology 18: 374-385.

Fishelson L. 1985. Fauna Palaestina. Insecta III. Orthoptera: Acridoidea. The Israel Academy of Sciences and Humanities. Jerusalem.

Hochkirch A., Gorzig Y. 2009. Colonization and speciation on volcanic islands: phylogeography of the flightless grasshopper genus Arminda (Orthoptera, Acrididae) on the Canary Islands. Systematic Entomology 34: 188-197.

Huo G., Jiang G., Sun Z., Liu D., Zhang Y., Lu L. 2007. Phylogenetic reconstruction of the family Acrypteridae (Orthoptera: Acridoidea) based on mitochondrial cytochrome b gene. Journal of Genetics and Genomics 34: 294-306.

Key K.H.L., Colless D.H. 1993. A higher classification of the Australian Acridoidea (Orthoptera). II. Subfamily Catantopinae. Invertebrate Taxonomy 7: 89-111.

Li B., Liu Z., Zheng Z.-M. 2011. Phylogeny and classification of the Catantopidae at the tribal level (Orthoptera, Acridoidea). ZooKeys 148: 209-255.

Litzenberger G., Chapco W. 200la. Molecular phylogeny of selected Eurasian podismine grasshoppers (Orthoptera: Acrididae). Annals of the Entomological Society of America 94: 505-551.

Litzenberger G., Chapco W. 2001b. A molecular phylogeographic perspective on a fifty-year-old taxonomic issue in grasshopper systematics. Heredity 86: 54-59.

Liu D.-F., Dong Z.-M., Zhang D.-Y., Gu Y.-Z., Guo P.-J., Han R.-H., Jiang G.-F. 2008. Molecular phylogeny of the higher category of Acrididae (Orthoptera: Acridoidea). Zoological Research 29: 585-591.

Ma L., Huang Y. 2006. Molecular phylogeny of some subfamilies of Catantopidae (Orthoptera: Caelifera: Acridoidea) in China based on partial sequence of mitochondrial CO II gene. Acta Entomologica Sinica 49: 982-990.

Maddison W.P., Maddison D.R. 2004. MacClade: Analysis of phylogeny and character evolution. Version 4.05. Sinauer, Sunderland, MA.

Mishchenko L.L. 1952. Insects--Orthoptera IV. No. 2. Acrididae (Catantopinae). (In Russian.). English translation (1965). Israel Program for Scientific Translations, Jerusalem.

Otte D. 1995. Orthoptera Species File 4. Orthopterists' Society and Academy of Natural Sciences of Philadelphia. Philadelphia, PA.

Ronquist F., Huelsenbeck J.P., Teslenko M. 2011. MRBAYES: Version 3.2. http://mrbayes.sourceforge.net/index.php

Rowell C.H.F. 2005. A new Ugandan species of Pterotiltus (Orthoptera, Acrididae, Oxyinae) with epiphyllic oviposition. Journal of Orthoptera Research 14: 33-44.

Rowell C.H.F., Flook P.K. 1998. Phylogeny of the Caelifera and the Orthoptera as derived from ribosomal gene sequences. Journal of Orthoptera Research 7: 147-156.

Rowell C.H.F., Flook P.K. 2004. A dated molecular phylogeny of the Proctolabinae (Orthoptera: Acrididae), especially the Lithoscirtae, and the evolution of their adaptive traits and present biogeography. Journal of Orthoptera Research 13: 35-56.

Song H., Wenzel J.W. 2008. Phylogeny of bird-grasshopper subfamily Cyrtacanthacridinae (Orthoptera: Acrididae) and the evolution of locust phase polyphenism. Cladistics 24: 515-542.

Sun H., Zheng Z., Huang Y. 2010. Sequence and phylogenetic analysis of complete mitochondrial DNA genomes of two grasshopper species Gomphocerus rufus (Linnaeus, 1758) and Primnoa arctica (Zhang & Jin, 1985) (Orthoptera: Acridoidea). Mitochondrial DNA 21: 115-131.

Swofford D. L. 2003. PAUP*: Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4.0b10. Sinauer, Sunderland, MA.

Vickery V. R. 1997. Classification of Orthoptera (sensu stricto) or Caelifera, pp. 5-40. In: Gangwere S.K., Muralirangan M.C., Muraliranga M. (Eds). The Bionomics of Grasshoppers, Katydids and their Kin. CAB International, New York. NY.

Vickery V.R., Kevan D.K. McE. 1985. The grasshoppers, crickets and related insects of Canada and adjacent regions. Ulonata: Dermaptera, Cheleutoptera, Notoptera, Dictuoptera, Grylloptera and Orthoptera, The Insects and Arachnids of Canada. Part 14. Research Branch, Agriculture Canada Publications, 1777. Ottawa, ON.

Wang N.-X., Feng X., Jiang G.-F., Fang N., Xuan W.-J. 2008. Molecular phylogenetic analysis of five subfamilies of the Acrididae (Orthoptera: Acridoidea) based on the mitochondrial cytochrome b and cytochrome c oxidase subunit I gene sequences. Acta Entomologica Sinica 51: 1187-1195.

Zhang D.X., Hewitt G.M. 1996. Nuclear integrations: Challenges for mitochondrial DNA markers. Trends in Ecology and Evolution 11: 247-251.

Zhao L., Zheng Z.-M., Huang Y., Zhou Z., Wang L. 2011. Comparative analysis of the mitochondrial control region in Orthoptera. Zoological Studies 50: 385-393.

WILLIAM CHAPCO

Department of Biology, University of Regina, Regina, SK, Canada, S4S 6X1. Email: chapco@uregina.ca

Table 1. Species analyzed, locations and
GenBank Accession numbers of mtDNA sequences.

Subfamily/Tribe        Species

Catantopinae
/Unassigned            Apalacris varicornis
/ Catantopini          Ecphanthacris mirabilis
                       Xenocatantops humilis
                       Catantops sp.
                       Diabolocatantops pinguis
                       Stenocatantops spendens
                       Coryphistes ruricola
                       Goniaea vocans
                       Theornolpus pulcher

/ Pezotettigini        Pezotettix giornae
                       Sphenophyma rugulosa

/ Trauliini            Traulia minuta

Calliptaminae
/Calliptamini

Cyrtacanthacridinae
/ Cyrtacanthacridini   Anacridium aegyptium
                       Schistocerca gregaria

Eyprepocnemidinae
/ Eyprepocnemidini

Melanoplinae
/Melanoplini           Melanopus sanguinipes
/Podismini             Mirantella alpina
/DichroUlini           Scotussa lemniscata

Oxyinae
/Oxyini                Oxya chinensis

Outgroup               Pyragomorpha conica

Subfamily/Tribe        Source

Catantopinae
/Unassigned            Loc?, China (CE)
/ Catantopini          Loc?, China (C)
                       Loc?, China (CDEF)
                       Loc?, China (DEF)
                       Loc?, China (CDE)
                       Loc?, China (CEF)
                       Savannah, QLD, AU (F)
                       Silver Valley Rd, QLD, AU (F)
                       Moomin, QLD, AU (F)

/ Pezotettigini        Sierra Nevada, Spain (CD)
                       Malatya, Turkey (C)

/ Trauliini            Loc?, China (CE)

Calliptaminae
/Calliptamini          Sierra Nevada, Spain (CD)

Cyrtacanthacridinae
/ Cyrtacanthacridini   Sierra Nevada, Spain (CDE)
                       SFU (ABCD)

Eyprepocnemidinae
/ Eyprepocnemidini     Nerja, Spaim (CDE)

Melanoplinae
/Melanoplini           Regina, SK, Can (A)
/Podismini             Bavaria, Germany (C)
/Dichroplini           Benito Juarez, Argentina (B)

Oxyinae
/Oxyini                Loc?, China (CDEF)

Ougroup                Malatya, Turkey (ABCDE)

Subfamily/Tribe        Accession Numbers
                       CO1, CO2, CYTB, ND5
Catantopinae
/Unassigned            EL13660777, FJ554811, DQ366762, -
/ Catantopini          FJ571157, FJ554819, -,-
                       EU366111, FJ554817, EU366112, -
                       EL1366109, -, EU366082, -
                       FJ571154, FJ554815, -,-
                       FJ571155, FJ554816, -,-
                       --, JX033918, JX033925, JX033937
                       JX033911, JX033919, JX033926, JX033938
                       JX033914, *, JX033929, JX033941

/ Pezotettigini        JX033912, JX033920, JX033927, JX033939
                       JX033913, JX033921, JX033928, JX033940

/ Trauliini            FJ571149, DQ099597, DQ366763, --

Calliptaminae
/Calliptamini          JX033916, JX033923, JX033932, JX033944

Cyrtacanthacridinae
/ Cyrtacanthacridini   JX033915, JX033922, JX033930, JX033942
                       AF260532, M83966, JX033931, JX033943

Eyprepocnemidinae
/ Eyprepocnemidini     JX033917, JX033924, JX033936, JX033947

Melanoplinae
/Melanoplini           AF260533, AF145500, JX033933, JX033945
/Podismini             AF260543, AF227292, JX033935, JX033946
/Dichroplini           DQ389229, DQ389215, JX033934,-

Oxyinae
/Oxyini                EF437157

Ougroup                EL1031776-9

Loc? =location unknown; dashes signify no sequence obtained
or available; *--see Appendix; Biogeographical Regions: A =
Nearctic, B = Neotropics, C = Palaearctic, D = Africa, E =
Oriental, F =Australia; QLD, ALI = Queensland, Australia;
SK, Can = Saskatchewan, Canada; SFU = Simon Fraser
University. The first 6 sequences and that of Oxya were
obtained from GenBank
COPYRIGHT 2013 The Orthopterists' Society
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Chapco, William
Publication:Journal of Orthoptera Research
Article Type:Report
Date:Jan 1, 2013
Words:3464
Previous Article:A new species of the genus Pterodichopetala (Orthoptera: Tettigoniidae: Phaneropterinae) from northeastern Mexico.
Next Article:Remarks on the genus Necroscia (Phasmatodea, Diapheromeridae, Necrosciinae) from China, with two new records, one new synonym, and one new...
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |