Printer Friendly

A new species of damselfish (Pomacentridae) from the Indian Ocean.

Abstract

The pomacentrid fish Chromic dimidiata (Klunzinger, 1871), type locality Red Sea, formerly believed to be wide-ranging into the Indian Ocean, is restricted to the Red Sea. The Indian Ocean population is described as a new species, Chromis fieLdi. It differs in having modally 17 pectoral rays and 17 lateral-line scales, compared to modally 16 pectoral rays and 15 lateral-line scales for C. dimidiata, and the demarcation of the dark brown anterior part of the body from the white posterior part is convex, compared to nearly straight in C. dimidiata, and not as sharply defined dorsally and ventrally. Phylogenetic comparisons based on mitochondrial DNA (mtDNA) cytochrome b sequences support morphological differentiation with evolutionary separation of C. dimidiata sampled in the central Red Sea and C. fieldi sampled in the Indian Ocean (d = 0.019). These two species differ from the related C. iome/as Jordan & Seale, 1906 of the western and central Pacific in having modally 12 dorsal and anal fin soft rays (vs. 13 for C. iome-las), the demarcation of dark brown and white distinctly anterior to the origin of the anal fin, and d = 0.085 to d= 0.087 for cytochrome b.

Zusammenfassung

Der Riffbarsch Chromis dimidiata (Klunzinger, 1871), Typuslokalitat Rotes Meer, von dem man bisher angenommen hat, dass er ein weites Verbreitungsgebiet bis in den Indischen Ozean hat, ist nach neueren Erkenntnissen auf das Rote Meer beschrankt. Der Bestand im Indischen Ozean wird als neue Art Chromic fieldi beschrieben. Ihre Vertreter unterscheiden sich durch 17 Brustflossenstrahlen und 17 Seitenlinienschuppen (Modalwert) im Gegensatz zu 16 Brustflossenstrahlen und 15 SeitenIinienschuppen bei C. dimidiata; augerdem ist die Grenzlinie zwischen dem dunkclbraunen vorderen Teil des Korpers und dem weigen hinteren Teil konvex, wahrend sic bei C. dimidiata nahezu gerade verlauft, und die Abgrenzung ist racken- und bauch-warts weniger scharf gezeichnet. Beim phylogenetischen Vergleich auf der Grundlage der mitochondrialen DNA (mtDNA) in den Cytochrom-b-Sequenzen lasst sich die morphologische Unterscheidung zwischen C. dimidiata am Beispiel von Exemplaren aus dem zentralen Roten Meer und C. fiekli anhand von Proben aus dem Indischen Ozean als stammesgeschichtliche Trennung bestatigen (d = 0,019). Die beiden Arten unterscheiden sich von der nahe ver-wandten Art C. iomelas Jordan & Seale, 1906 vom west-lichen und zentralen Pazifik durch 12 Weichflossenstrahlen in der Rucken- und der Afterflosse (Modalwert) (bei C. iomeks sind es 13), Abgrenzung des dunkelbraunen und des weigen Teils deutlich vor dem Ansatz der Afterflosse sowie den phylogenetischen Unterscheidungswert anhand der Cytochrom-b-Sequenz d = 0,085 im Vergleich zu d = 0,087.

Resume

Le pomacentride Chromic dimidiata (Klunzinger, 1871), localite-type en Mer Rouge, que a cu une large distribution dans l'Ocean Indien pensait-on jadis, se trouve confine en Mer Rouge. La population de l'Ocean Indien est decrite comme nouvelle espece, Chromis fiekli. Elle se caraccerise par 17 rayons pectoraux modalement et 17 ecailles sur la ligne laterale, alors que C. dimidiata a 16 rayons pectoraux modalement et 17 ecailles sur la ligne laterale, et par la demarcation convexe entre la parcie anterieure brun fonce' du corps et la partie posterieure blanche, alors qu'elle est presque droite chez C. dimidiata et moms nettement dessinee et ven-tralement. Des comparaisons phylogenetiques basees sur des sequences de cytochrome b de l'ADN mitochondrial (mtADN) relevent une differenciation morphologique avec divergence evolutive de C. dimidiata collecte au centre de la Mer Rouge et C. fieldi collect e dans l'Ocean Indien (d = 0.019). Ces deux especes se distinguent de C. iomelas Jordan & Seale, 1906 apparente, originaire du Pacifique ouest et central, par 12 rayons mous modalement a la dorsale et a l'anale (pour 13 chez C. iomeLas), par la demarcation entre le brun fonce et le blanc situee clairement avant la naissance de l'anale, et par un cytochrome b de d= 0,085 a d= 0,087.

So mmario

I1 pomacentride Chromis dimidiata (Klunzinger, 1871), localita tipo Mar Rosso, ritenuto ampiamente diffuso nell'Oceano Indiano, e in realta limitato al Mar Rosso. La popolazione dell'Oceano Indiano e descritta come una nuova specie, Chromis fieldi. Si differenzia per avere, come valori modali, 17 raggi pectorali e 17 scaglie in linea laterale anziche 16 raggi pettorali e 15 scaglie in linea laterale come in C. dimidiata e la demarcazione della parte anterio-re marrone scuro del corpo dalla parte bianca posteriore convessa, rispetto a quasi dritta in C. dimidiata e non cosi nettamente definita dorsalmente e ventralmente. Con-front filogenetici basati su sequenze del DNA mitocon-driale (mtDNA) del citocromo b in C. dimidiata campi-onato nel Mar Rosso e C. fieldi campionato nell'Oceano Indian[degrees] sono a favore di una differenziazione morfologica e una separazione evolutiva delle due specie (d = 0.019). Esse differiscono dal relativo C. iomelas Jordan & Seale, 1906 del Pacifico occidentale e centrale per avere come va-lore modale 12 raggi molli nella pinna dorsale e anale (vs. 13 per C. iomelas), la delimitazione dell'area di colore mar-rone scuro da quella bianca distintamente anteriore all'ori-gine della pinna anale e valori d tra 0.085 e 0.087 per il citocromo b.

INTRODUCTION

The damselfish genus Chromis is the largest of the family Pomacentridae. Allen & Erdmann (2009) described two new species from Indonesia, C. albicauda and C. unipa, raising the total species of the genus to 96. Quero et al. (2010) described C. durvillei, the 97th species, from the island of Reunion. We provide here the description of the 98th species.

The species of Chromis feed primarily on zoo-plankton (Fig. 1); they are therefore not restricted to the photic zone of the sea, as are the species of the other large damselfish genera Abudefduf; Poma-centrus, and Stegastes that graze on benthic algae. The ability to colonize deeper habitats may have provided more opportunity for speciation in the genus Chromis. Most species of Chromis described in recent years have been collected from deeper than conventional scuba-diving depths. Pyle et al. (2008), for example, named five new species of Chromis from the western Pacific, four of which were collected from over 85 m, and the fifth from 60 m. These authors used mixed-gas, closed-circuit rebreather gear to make their collections. Allen & Erdmann (2009) reported that species of Chromis are known to penetrate depths as great as 175 m. Chromis durvillei, which was found at the surface after lava from an eruption on Reunion in 2007 flowed into the deep sea, may well have been from a record depth.

The species described here is a common inshore fish of the Indian Ocean that has usually been identified as Chromis dimidiata (Klunzinger, 1871), type locality Red Sea, known by the English common names Half & Half Chromis, Chocolate Dip Chromis, and Two-tone Chromis. Klunzinger's name has been applied to more than one species by authors that followed. Gunther (1909) used the name for a species from the Society Islands with a dark brown body, except for the white caudal peduncle and adjacent median fins, now known to be Chromis margaritifer Fowler, 1946, type locality Ryukyu Islands, first described as a subspecies of C. dimidiata. De Beaufort (1940) placed Barnard's (1927) C. xanthura, now a valid species from the Pacific to the eastern Indian Ocean, in the synonymy of C. dimidiata and listed localities from the Red Sea and coast of Natal to the Hawaiian Islands and Society Islands. In a report on fishes of the Philippines and Indonesia collected by the United States steamer Albatross, Fowler & Bean (1928) listed Chromis bicolor (Macleay, 1882) from New Guinea, C. leucurus Gilbert, 1905 from the Hawaiian Islands, and C. iomelas Jordan & Seale, 1906 from Samoa as synonyms of C. dimidiata. He commented on the extreme variation in the demarcation of the dark brown anterior part of the body and the posterior white.

Smith (1949) illustrated Chromis dimidiata in color, dark brown anteriorly, abruptly pale yellow and white posterior to a demarcation above the base of the second anal spine, and gave the distribution as central tropical Indo-Pacific to the east coast of Africa, south to Zululand. Smith & Smith (1963) used the same illustration in recording the species from the Seychelles. Baissac (1976) listed the species from Mauritius by name only, and Harmelin-Vivien (1976) from Reunion at depths of 6-40 m. Allen in Smith & Heemstra (1986) also used Smith's painting of Chromis dimidiata and gave the distribution as "Tropical Indian Ocean reefs down to at least 30 m; Red Sea to Durban, common." In a review of damselfishes of the world, Allen (1991: 66) illustrated Chromis dimidiata from Eilat, Red Sea and gave the distribution as "Widespread in the Indian Ocean including Kenya, Mauritius, Reunion, Chagos Archipelago, Maldive Islands, Sri Lanka, Andaman Sea, and Christmas Island." Allen also provided a color figure of Chromis iomelas Jordan & Seale, 1906 (also one in Randall et al. 1990) that has long been confused with C. dimidiata. It is easily seen why (compare Fig. 1 through Fig. 9 to Fig. 10 through Fig. 12). Fowler (1928), for example, placed C. iomelas in the synonymy of C. dimidiata and gave the distribution of the latter as Red Sea, East Indies, Polynesia, and Hawail. Allen (1991) gave the correct distribution for C. iomelas: Great Barrier Reef, Coral Sea, New Guinea, Vanuatu, New Caledonia, Fiji, Samoa Islands, and Society Islands. Although Allen did not specifically differentiate C. iomelas from C. dimidiata, as by a key, the counts he gave for the dorsal and anal rays of the two species provide complete separation.

Khalaf & Disi (2007: 135) illustrated Chromis dimidiata in color in their book on the fishes of the Gulf of Aqaba, noting that the species occurs in the Red Sea and the Indian Ocean. Richard and Mary Field also figured Chromis dimidiata in color from an underwater photograph in their guidebook Reef Fishes of the Red Sea (1998). Richard commented to the first author that the demarcation of the dark brown anterior half of fish in the Red Sea is a little posterior to that of individuals in the Indian Ocean. This led to our taking routine counts of fin rays, scales, and gill rakers. With modal differences apparent (Tables the second author made a molecular study that conclusively determined that the Indian Ocean population of C. dimidiata is distinct from that in the Red Sea and represents an undescribed species. We also provide meristic, genetic, and color separation from the similar South Pacific C. iomelas Jordan & Seale.

MATERIAL AND METHODS

Type specimens have been deposited in the Bishop Museum, Honolulu (BPBM); California Academy of Sciences, San Francisco (CAS); Hebrew University, Jerusalem (HUD; Royal Ontario Museum, Toronto (ROM); Senckenberg Museum, Frankfurt (SMF); South African Institute for Aquatic Biodiversity, Grahamstown (SAIAB); and the U. S. National Museum of Natural History, Washington, D.C. (USNM).

Lengths given for specimens are standard length (SL), the straight-line distance from the median anterior point of the upper lip or most anterior teeth (whichever is longest) to the base of the caudal fin (posterior end of hypural plate). Head length is measured from the same anterior point to the posterior end of the opercular membrane, and snout length from the same point to the fleshy edge of the orbit. Body depth is the greatest depth to the base of the dorsal spines; body width is the greatest width measured just posterior to the gill opening. Orbit diameter is the greatest fleshy diameter, and interorbital width the least fleshy width. Caudal-peduncle depth is the least depth; caudal-peduncle length is measured horizontally from the rear base of the anal fin to the ventralmost principal caudal ray. Predorsal, preanal, and prepelvic lengths are from the front of the upper lip (or upper teeth) to the origin of the respective fins. Lengths of fin spines and soft rays are measured from the extreme base of these elements to the tips. Some soft rays of the dorsal, anal, and pelvic of many species of Chromis are long and filamentous; therefore, there is often great variation in recording the maximum length of the rays of these fins. Pectoral-ray counts include the short unbranched upper ray. Gill-raker counts were made on the first gill arch; the raker at the angle is included in the lower-limb count.

Table I gives the proportional measurements of the new species as percentages of the standard length. Proportional measurements in the text are rounded to the nearest 0.05. Data in parentheses in the description refer to paratypes.

Table I. Proportional measurements of type specimens of
Chromis fieldi as percentages of the standard length.

                 Holotype                Paratypes

                     BPBM   BPBM   BPBM       USNM    BPBM   BPBM
                    20241  37663  28436     405570   27275  41105

Standard length      57.0   38.0   40.5       46.5    50.0   52.5
(mm)

Body depth           45.6   45.8   49.2       48.9    47.1   46.6

Body width1         14.01   18.0   19.1       18.6    17.9  15.51

Head length          30.2   30.5   31.6       31.9    30.6   29.8

Snout length          9.5    9.4    9.6       10.3     9.8    9.7

Orbit diameter       10.7   13.2   12.7       12.2    11.1   10.8

Interorbital         11.0   11.1   11.8       11.5    11.2   11.2
width

Upper-jaw            10.3   10.5   10.2       10.8    10.2   10.7
length

Caudal-peduncle      15.9   15.6   16.0       16.6    16.2   15.3
depth

Caudal-peduncle      12.2   13.4   12.6       13.7    13.1   12.4
length

Predorsai            38.7   38.9   40.2       40.5    39.8   39.0
length

Preanal length       62.5   59.7   60.3       59.5    63.1   61.8

Prepelvic            36.8   36.9   37.0       38.0    37.7   37.8
length

Base of dorsal       56.2   54.8   57.0       56.5    51.5   53.8
fin

Hirst dorsal         10.9   10.3   10.7       10.6    10.2   11.0
spine

Twelfth dorsal       21.4   21.2   21.5       21.7    21.3   20.8
spine

Longest dorsal       31.7   29.7   31.9       31.3  broken   32.3
ray

Base of anal         26.5   26.1   26.3       26.2    25.8   26.7
fin

First anal           12.3   13.3   12.2       12.9    13.0   11.5
spine

Second anal          26.4   23.5   24.7       23.9    23.9   27.7
spine

Longest anal         29.8   26.5   30.1       28.2    25.6   22.5
ray

Caudal-fin           53.5   52.5   58.7       61.5    53.9   61.0
length

Shortest caudal      22.1   23.4   23.9       24.8    23.2   23.1
ray

Pectoral-fin         30.0   30.6   32.3       32.0    30.4   29.5
length

Pelvic-spine         19.6   18.0   20.8       19.3    19.7   18.5
length

Pelvic-fin           38.1   33.2   45.0       44.8    36.4   36.2
length


(1.) Holotype and largest paratype once dessicated,
now abnormally thin.


A total of nine tissue samples were included for genetic analysis: four C dimidiata collected from the Red Sea (Thuwal, Kingdom of Saudi Arabia), two C. dimidiata (now C. fieldi) from the Indian Ocean (Republic of Seychelles), and three C. iomelas from Fiji in the Pacific Ocean for comparison. Eight previously published "C'. dimidiata" (Reunion, N = 4: GenBank Accession Numbers JF458039, JF458040, JF458041, and JF458045 [Hubert et al. 2012]; Republic of Madagascar, N = 4: GenBank Accession Numbers JF458042, JF458043, JF458044, and JF458046 [Hubert et al. 2012]) and two C. iomelas (Moorea, French Polynesia, N = 1: GenBank Accession Number JF458049 [Hubert et al. 2012]; New Caledonia, N = 1: GenBank Accession Number AY208531 [Quenouille et al. 2004]) mitochondrial DNA (mtDNA) cytochrome b (cyt b) sequences further supplemented genetic analyses. Despite a relatively slower mutation rate than some other mtDNA genes (i.e., control region; Lee et al. 1995), we here use cyt b because of pre-existing vouchered specimens to increase our Indian Ocean sample, and an approximate molecular clock calibrated in other reef fish (Bowen et al. 2001; Lessios 2008; Reece et al. 2010). Indeed, the cyt b gene is one of the most widely used markers in molecular systematics.

Total genomic DNA was extracted from all tissue samples using the "HotSHOT" protocol (Meeker et al. 2007). A 670 base pair (bp) segment of the mtDNA cyt b gene was amplified using a heavy-strand (5' - GTGACTTGAAAAACCACCGTTG - 3'; Song et al. 1998) and light-strand primer (5' - AATAGGAAGTATCATTCGGGTTTGATG - 3'; Taberlet et al. 1992). Polymerase chain reaction (PCR) mixes contained BioMix Red (Bioline Inc., Springfield, NJ, USA), 0.26 mM of each primer, and 5 to 50 ng template DNA in a 15 ml total volume. PCR cycling parameters were as follows: initial 95 [degrees]C denaturation for 3 min., followed by 35 cycles of 94 [degrees]C for 30 sec., 55 [degrees]C for 45 sec., and 72 [degrees]C for 45 sec., with a final elongation step of 72 [degrees]C for 10 min.

All PCR products were cleaned by incubating with exonuclease I and FastAPTm Thermosensitive Alkaline Phosphatase (ExoFAP; USB, Cleveland, OH, USA) at 37 [degrees]C for 60 minutes, followed by 85 [degrees]C for 15 minutes, sequenced in both the forward and reverse directions with fluorescendy labeled dye terminators following manufacturer's protocols (BigDye, Applied Biosystems Inc., Foster City, CA, USA), and analyzed using an ABI 3130XL Genetic Analyzer (Applied Biosystems). The sequences were aligned, edited, and trimmed to a common length using Geneious Pro vers. 4.8.4 software (Drummond et al. 2009). Representative haplotypes were deposited in GenBank (accession numbers: KC311941 to KC311949). jModelTest vers. 1.0.1 (Posada 2008) was used to determine the best nucleotide substitution model under Akaike information criterion (AK), which selected the HKY model (Hasegawa et al. 1985) and a gamma parameter of 0.071.

Maximum-likelihood (ML) and Bayesian (BA) tree-building methods were applied using PAUP* vers. 4.0 (Swofford 2000) and MRBAYES (Ronquist & Huelsenbeck 2003) Bayesian Markov Chain Monte Carlo (MCMC) coalescent approach implemented in Geneious Pro. The Bayesian MCMC search strategy consisted of the default four heated, 1 million step chains with an initial burn-in of 150,000 steps. A previously published Green Chromis (Chromis viridis) cyt b sequence (Genbank accession number: JF458062) was used to root the tree. Support for the tree topology was evaluated by bootstrapping over 10,000 replicates for ML and posterior probabilities for BA. Sequence divergence (d) between identified groups was then estimated based on the corrected average pairwise nucleotide difference from Arlequin vers. 3.5 software (Excoffier et al. 2005), divided by the total number of base pairs in the sequence.

Chromis fieldi, n. sp.

(Figs 4-8; Table I)

Heliastes xanthurus (non Bleeker) Regan, 1917: 459 (Natal).

Chromis xanthurus (non Bleeker) Barnard, 1927: 732 (Natal coast of South Africa).

Chromis dimidiatus (non Klunzinger) Smith, 1949: 507, pl. 51, fig. 746a (east coast of Africa to Zululand).

Chromis dimidiatus (non Klunzinger) Fourmanoir, 1954: 226 (Comoro Islands).

Chromis dimidiatus (non Klunzinger) Smith, 1955: 888 (Aldabra).

Chromis dimidiatus (non Klunzinger) Smith, 1960: 324, pl. 31, fig. I (Zululand and Inhaca Island, Mozambique, north over all of W Indian Ocean).

Chromis dimidiatus (non Klunzinger) Smith tic Smith, 1963: 34, pl. 71, fig. I (Seychelles).

Chromis dimidiatus (non Klunzinger) Baissac, 1976: 211 (Mauritius).

Chromis dimidiatus (non Klunzinger) Harmelin-Vivien, 1976: 76 (Reunion).

Chromis dimidiata (non Klunzinger) Allen in Smith & Heemstra, 1986: 674, pl. 86, fig. 219.14 (tropical Indian Ocean; Red Sea to Durban).

Chromis dimidiata (non Klunzinger) Allen & Steene, 1987: 92, fig, 257 (Christmas Island).

Chromis dimidiata (non Klunzinger) Winterbottom et al., 1989: 45, fig. 255 (Chagos Archipelago).

Chromis dimidiata (non Klunzinger) Randall, 1992: 102, fig. 213 (Maldive Islands).

Chromis dimidiata (non Klunzinger) Allen & Adrim, 2003: 45 (Indian Ocean to Sumatra and west Java).

Chromis dimidiata (non Klunzinger) Heemstra & Heemstra, 2004: 332, fig. (KwaZulu-Natal, juveniles occasionally to Algoa Bay).

Chromis dimidiatus (non Klunzinger) Satapoomin, 2007: 104, fig. 13 (Andaman Sea).

Chromis dimidiatus (non Klunzinger) Shibukawa in Kimura et at, 2009: 205, middle fig. (Andaman Sea).

Holotype. BPBM 20241, 57 mm, Mauritius, west coast off Medine (north of Flic en Flac), reef in 30 m, quinaldine (anaesthetic), J. E. Randall, 19 Nov 1973.

Paratypes: USNM 275619, 2: 16.5-17 mm, Sri Lanka, Trincomalee, 300 yds S of entrance to Ft. Frederick, 6 m, C. C. Koenig, 6 Apr 1970; BPBM 20066, 2: 31-45 mm, Reunion, off Cap Houssaye, 12 m, rotenone, J. E. Randall, 23 Oct 1973; BPBM 41005, 52.5 mm, same data as holotype, except taken by multiprong spear; BPBM 16391, 17 mm, Tanzania, Mafia Island, Chole Bay, reef, 02 m, rotenone, J. E. Randall, L. Westfield, and A. Klosser, 11 Dec 1973; USNM 364137, 55 mm, Cargados Carajos (St. Brandon's Shoals), 16[degrees]25'S, 59[degrees]36'E, 6-10.5m, rotenone, V.G. Springer et al., 6 Apr 1976; BPBM 21723, 4: 30-36 mm, South Africa, KwaZulu-Natal, Sodwana Bay, reef off north end of bay, 10-12 m, rotenone, J. E. Randall and M. Christensen, 21 Jun 1977; BPBM 28436, 11: 23-49 mm; Chagos Archipelago, Salomon Atoll, 5[degrees]22.07'S, 72[degrees]13.11'E, offshore reef at Send of Isle Boddam, reef top, some sand, hard and soft coral, 8 m, rotenone, R. Winterbottom, A. R. Emery, et al., 15 Mar 1979; CAS 234256, 2: 4148.5 mm; HUJ 20132, 2: 23.5-41 mm; SAIAB 186323, 2: 36-44 mm; SMF 34723, 2: 40.544.0 mm; USNM 405570, 2: 38-48 mm, all with same data as BPBM 28436; ROM 37174, 2: 34-37 mm, Peros Banhos Atoll, Isle du Coin, 5[degrees]25'55"S, 71[degrees]45'46"E, lagoon reef slope of Acropora, 10 m, rotenone, R Winterbottom, A. R. Emery, 1 Apr 1979; BPBM 27275, 8: 35-50 mm, Kenya, Shi-moni, Kitangamwe, reef, 12-14 m, rotenone, J. E. Randall, 22 Mar 1979; USNM 274833, 10: 15-57 mm, Seychelles, Aldabra Atoll, Picard Island, 1-10 m, B. Kensley, et al., 23-26 Mar 1985; BPBM 35567, 3: 15-29 mm, Seychelles, Amirantes, Poivre Atoll, north side, reef, 13 m, rotenone, J. E. Randall, D. P. Boulle, and E. Grandcourt, 31 Dec 1992; BPBM 37663, 38 mm, Indonesia, Mentawai Islands, Siberut Island, off entrance to Sarabua Bay, 1[degrees]30'S, 99[degrees]10'E, reef and coral rubble, 8 m, quinaldine, J. E. Randall, 24 Apr 1997.

Diagnosis: Dorsal rays X11,12 or 13 (modally 12); anal soft rays 11,12-14; pectoral rays 16 or 17 (rarely 16); caudal fin strongly forked; spiniform upper and lower caudal rays 2; second and third, and fourteenth and fifteenth principal caudal rays with filamentous branched tips, especially long in third and fourteenth rays; first soft ray of pelvic fins filamentous; longitudinal scale series 27; lateral-line scales 16 or 17 (rarely 16); gill rakers 7-9 (rarely 9) + 19-21 (rarely 21); body depth 2.2-2.35 in SL; head length 3.15-3.35 in SL; snout short and rounded, 3.1-3.3 in head length; color in preservative dark purplish brown anteriorly to a near-vertical demarcation usually at or slightly posterior to origin of anal fin (but rarely distinctly anterior to anal-fin origin), ending on average at base of ninth dorsal spine, pale beige posteriorly, the median fins colored like adjacent body; a black spot over base and axil of pectoral fins; color in life very dark gray-brown anteriorly, abruptly white posteriorly, usually with wash of pale yellow over the anterior white, especially dorsally.

Description: Dorsal rays XII, 12 (12 or 13, modally 12); anal soft rays II, 13 (12-14); all soft dorsal and anal rays branched, the last to base; principal caudal rays 15, the median 13 branched; second and third, and fourteenth and fifteenth principal caudal rays with filamentous branched tips, especially long in third and fourteenth rays; upper and lower procurrent caudal rays 4, the anterior 2 spiniform; pectoral rays 17 (16 or 17, rarely 16), the uppermost splint-like, the second unbranched; pelvic rays 1,5, all branched, the first soft ray filamentous.

Longitudinal scale series 27; scales above lateral line to base of first dorsal spine 3; scales below lateral to base of first anal spine 8; circumpeduncular scales 16; lateral line interrupted, the dorsoanterior part as tubed scales, 17 (16 or 17, rarely 16), ending beneath midbase of soft portion of dorsal fin; posterior midlateral pored scales in continuous series 6 (613); median predorsal scales about 17 (difficult to count due to interrupting overlapping scales).

Gill rakers long, the longest equal to length of longest gill filaments, nearly half orbit diameter in holotype, (8 + 20 (7-9, rarely 9) + 19-21, rarely 21); branchiostegal rays 6; supraneural (predorsal) bones 3; vertebrae 26. Body moderately deep, the depth 2.2 (2.05-2.15) in SL, and compressed, the width in body depth about 2.6; head length 3.3 (3.15-3.35) in SL; snout length 3.2 (3.1-3.3) in head length; dorsal profile of snout steep, forming an angle of about 60[degrees] to horizontal axis of head and body to above eye, then continuing on nape at progressively less angle; orbit diameter 2.8 (2.52.75) in head length; no fleshy papillae on margin of orbit; interorbital space convex, the least width 2.75 (2.65-2.8) in head length; caudal-peduncle depth 1.9 (1.9-1.95) in head length; caudal-peduncle length 2.5 (2.3-3.5) in head length.

Mouth terminal to slightly inferior and strongly oblique, forming an angle of about 45[degrees] to horizontal axis of body; mouth small, the upper-jaw length 2.9 (2.8-3.1) in head length, the maxilla extending to a vertical slightly posterior to anterior edge of orbit; teeth in jaws conical and recurved, in three irregular rows anteriorly, narrowing to a single row posteriorly; teeth of outer row much the largest, the longest median teeth twice the diameter of aperture of anterior nostril; 38 teeth in outer row of upper jaw, and 42 in lower jaw of holotype; tongue triangular, the tip slightly rounded.

Nostril on side of snout about half distance from margin of orbit to front of snout, nearly round, with a slender rim that is low anteriorly and about four times longer posteriorly, forming a somewhat pointed flap; short zone before nostril scaleless.

The most prominent pores of the cephalic lateralis system are ones directly posterior to nostril, closer to nostril than edge of orbit (another directly dorsal to nostril much smaller), three along margin of snout just above upper jaw, followed by six lesser pores along ventral edge of subopercle; also prominent are four pairs of pores anteriorly on mandible; remaining pores, such as those closely encircling orbit and those on margin of preopercle, small to minute.

No spine on opercle; margin of preopercle irregular, but not serrate; edges of scales slightly overlapping margins of opercle, preopercle, and subopercle. Scales finely ctenoid; tubed lateral-line scales ending below anterior soft portion of dorsal fin, with pored scales continuing to anterior caudal peduncle; midlateral pored scales commencing below end of tubed lateral-line scales and ending on base of caudal fin, but not continuously (always one or more scales in series without pores); about two-thirds of operde covered by six large scales; three curving rows of large scales across widest part of preoperde; no very small scales on head; scales in an oblique row across interorbital of holotype from above middle of orbit to behind posterior nostril of other side 6; scales in a zigzag row between nostrils 6; narrow zone of snout anterior to nostrils largely naked; a broad basal sheath of scales at base of dorsal and anal fins, with a narrowing band of progressively small scales extending out to incised end of each interspinous membrane; scales continuing on soft portion of fin progressively shorter; caudal fin with small scales continuing, progressively smaller, nearly to posterior margin (disregarding filaments); paired fins with a patch of small scales basally; a triangular scaly process of three scales midventrally between bases of pelvic fins; a slender axillary scale above each pelvic fins, about half length of pelvic spine.

Membranes of spinous portion of dorsal and anal fins deeply incised, the first membrane of dorsal fin nearly to base, the last one-third distance to base; membrane of first anal spine incised one-half distance to base. Origin of dorsal fin above base of fourth lateral-line scale, the predorsal length 2.6 (2.45-2.55) in SL; dorsal spines progressively longer, the first 2.75 (2.7-3.05) in head length; twelfth dorsal spine 1.4 (1.45) in head length; fourth dorsal soft ray longest, 3.15 (1.75-3.4) in SL; origin of anal fin below base of ninth dorsal spine, the preanal length 1.6 (1.6-1.7) in SL; first anal spine 2.45 (2.3-2.6) in head length; second anal spine 1.15 (1.1-1.35) in head length; sixth or seventh anal soft rays longest, 3.35 (3.3-4.45) in SL; caudal-fin length (includes filament of longest ray) 1.85 (1.65-1.9) in SL; caudal concavity 3.2 (2.9-4.5); pectoral-fin length 3.3 (3.1-3.4) in SL; pelvic-fin length 2.6 (2.2-3.0) in SL.

Color of holotype in alcohol dark purplish brown anterior to a demarcation that begins ventrally at origin of anal fin and ends at base of about ninth dorsal spine but extends in middle of body posteriorly to a vertical from base of first anal soft ray to base of eleventh dorsal spine; body posterior to demarcation pale beige; median fins colored basally like adjacent body, the rays soon becoming pale gray-brown and the membranes translucent; pectoral fins translucent with pale brown rays and a large black spot over base and axil; pelvic fins dark brown.

Color of holotype when fresh shown in Fig. 4. Note the nebulous margin dorsally and ventrally that separates the dark brown anterior part of the body from the pale yellowish posterior part; also the pale yellowish posterior body grading to pale bluish white on caudal peduncle. Figures 6 and 8 provide the color of other specimens when fresh.

The life color of Chromis fieldi is shown in the underwater photographs of Figs 5, 7 and 9. Note the light blue on the leading edge of the dorsal and anal spines and along the margin of the anterior soft portion of the median fins, the bluish white posterior margin of the black axillary spot, and the faint dark longitudinal banding on the rows of scales of the postorbital head; there is often a faint bluish iridescence on the upper lip and suborbital.

GENETIC RESULTS

The genetic analysis, based on 19 mtDNA cyt b sequences within the Chromic complex, support the outlined morphological differentiation among new and existing species. Both phylogenetic methods show evolutionary separation between C. dimidiata sampled in the central Red Sea and that sampled in the Indian Ocean (including Madagascar, Reunion, and the Seychelles; Fig. 13). We found that d = 0.019 when comparing the Red Sea to Indian Ocean fish, and d= 0.087 or d= 0.085 when comparing each of these groups to the more distantly related C. iomelas in the Pacific Ocean. This is in contrast to d = 0.002 or d = 0.004 within the Red Sea or Indian Ocean groups. Comparable genetic differentiation was obtained from the cytochrome c oxicInse subunit I (COI) barcoding gene (data not shown), but we here focus our discussion on the above outlined cyt b gene and samples.

Etymology: This species is named in honour of Richard Field, who first suspected that the Indian Ocean population of Chromis dimidiata might represent a different species. He also provided 18 underwater photographs of C. dimidiata taken in the Red Sea in the vicinity of Jeddah that gave us the opportunity to note color variation, and collected four specimens of this species from north of Jeddah, Saudi Arabia.

Distribution: Specimens of Chromis fieldi have been examined or records verified from Kenya, Tanzania, Mozambique, KwaZulu-Natal, Seychelles (including Amirantes), Comoro Islands, Reunion, Mauritius, Cargados Carajos Shoals, Chagos Archipelago, Maldive Islands, southern Oman, Socotra in the Gulf of Aden, Sri Lanka, Mentawai Islands (Sumatra), and Christmas Island. In addition, Gerald R. Allen (pers. comm.) provided records for Pulu Weh (off western Sumatra) and western Java, and Tilman J. Alpermann identified uncataloged specimens in the Sencken-berg Museum, Frankfurt that were collected by him and Uwe Zajonz at Socotra Island in the Gulf of Aden, using a copy of this manuscript as a guide.

Remarks: Chromts fieldi is found on coral reefs, both lagoon and outer reefs, but not in areas exposed to heavy wave action, from the depth range of 1 to at least 40 m. It feeds on zooplank-ton, but rarely more than a meter above the shelter of the reef. The larger species of Chromis, Lepidozy-gus tapeinosoma, and the species of Pseudanthias feed much higher in the water column. Winterbot-torn et al. (1989) collected 491 specimens of C. fieldi, 14-51 mm SL, in 37 lots from 0.5-36 m, from reef tops and drop-offs in the Chagos Archipelago. Thirty-one percent of their specimens were from 6-15 m, and 66% in 16-25 m. They added, "It was ubiquitous along the rim of the drop-off, where it formed large associations feeding on plankton in the water column." Richard Winterbottom also collected 23 lots of this species in the Comoro Islands.

This species is differentiated from the closely related Chromis dimidiata in having strongly modal 17 pectoral rays and 17 tubed lateral-line scales vs. modally 15 for C. dimidiata. The two species differ also in the dark brown-white demarcation on the body. It is straighter in C. dimidiata and more sharply defined dorsally and ventrally. The demarcation may be slightly before or posterior to the origin of the anal fin in both species, but because of the convexity of the demarcation in C. fieldi, it is more posterior. The tip of the pectoral fin reaches or extends posterior to the demarcation in 13 of the 14 Bishop Museum specimens of C. dimidiata. Except for juveniles, the pectoral fin rarely reaches the demarcation in C. fieldi. In addi-don, the demarcation in C fieldi remains distinct dorsally, though it may be irregular as it passes through the dorsal fin, whereas it becomes diffuse and curves strongly anteriorly in C. dimidiata.

The genetic analysis indicates evolutionary separation between specimens sampled in the central Red Sea and those sampled in the Indian Ocean. Previous research in Chromis viridis, a genetic out-group we use here, shows a similar distinction between the Red Sea and Indonesian Archipelago using mtDNA control region (Froukh & Kochzius 2008). Such lineages may be explained by isolation between each body of water (Red Sea, Indian Ocean, and Pacific Ocean) and limited exchange during glacial periods when sea levels were much lower (up to 120 m; Voris, 2000; Siddall et al. 2003), though the discovery of cryptic species within ocean basins is not uncommon for Poma-centrids (Chgsiptera arnazae, Allen et al. 2010; Chrysiptera rex, Drew et al. 2010; Pomacentrus maafu, Allen & Drew 2012).

Table II. Fin-ray counts of species of Chromis.

           Dorsal              Anal              Pectoral
             Soft              Soft                  Rays
             Rays              Rays

               11  12  13  14    11  12  13  14        16  17  18

C.              2  15   1         1   9   6   2        16       2
dimidiata

C. fieldi          11   6             4  12   1         1      16

C.                 15   3         1   7   7   3         2      14  2
iomeias

Table III. Lateral-line scale counts of species of Chromis.

                Lateral line Scales

               14    15   16    17
C. dimidiata    2    10    6
C. fieldi                  1    16
C. iomelas      1    13    4

Table IV. Gill-raker counts of species of Chromic.

Upper Limb    Lower Limb

               7  8   9  10  18  19  20  21
C. dimidiata      8   9   1   2   8   6   2
C. fieldi      4 12   1           4  12   1
C. iomelas       15   3       1   7   7   3


Although no exact benchmark is available for species-level divergence among reef fish taxa based on cyt b (but see Johns & Avise 1998), our findings are consistent with the 2% cyt b divergence among recognized Chaetodon species (McMillan & Palumbi 1995) and approached the level of divergence observed among some closely related species of Das-gllus (Bernardi & Crane 1999). Genetic differentiation in this study (d = 0.019) is also comparable to some (d = 0.017; Abudefduf concolor versus A. taurus), but not other (d = 0.099; Chromis atrilobata versus C. multilineata), recognized geminate species of damselfish separated more than three million years ago by the rise of the isthmus of Panama (Lessios 2008). In line with recent studies of Poma-centridae in the Indo-Pacific (Allen et al. 2010; Allen & Drew 2012), we found that intra-specific genetic differentiation was nearly an order of magnitude lower than inter-specific differentiation, despite the slower relative mutation rate of cyt b. Thus, based on reciprocally monophyletic groups and concordant meristic and color differences between the Red Sea and Indian Ocean form, we feel C. fieldi warrants species-level designation.

The similar Chromis iomelas Jordan & Seale (Figs. 10-12), type locality Samoa Islands, is readily separated from both C. fieldi and C. dimidiata by having 13 or 14 dorsal soft rays compared to modally 12 dorsal rays, the demarcation of dark brown anterior and white posterior colors anterior to the origin of the anal fin (the pectoral-fin tips passing distinctly posterior to the demarcation), and the genetic differentiation is distinct at mtDNA (see Fig. 13). It is distributed from the Great Barrier Reef and Coral Sea north to Papua New Guinea, and east to New Caledonia, Vanuatu, Fiji, Samoa Islands, Society Islands, and Tuamotu Archipelago (Randall et al. 1990; Allen 1991). There are no valid records of C. iomelas in the western Pacific north of New Guinea, and none for the islands of Micronesia.

The common names Half-and-Half Chromis, Two-tone Chromis, and Chocolate-dip Chromis have been variously used for this complex of species. We propose that Chocolate-dip Chromis be reserved for the Hawaiian endemic Chromis hanui Randall & Swerdloff, as first used by Randall (1980); Half-and-Half Chromis for Chromis dimidiata, as by Randall (1983) for C. dimidiata in the Red Sea (wrongly illustrated from a photo of C. fieldi from Mauritius); and Two-Tone Chromis for Chromis fieldi, as by Kuiter (1998) and Kimura et al. (2009).

Comparative material: Chromis dimidiata: BPBM 14680, 2: 36-44.5 mm, Red Sea, Gulf of Aqaba, Ras Mukabeila; BPBM 18232, 8: 40-52 mm, Red Sea, Gulf of Aqaba, Sinai east coast north of Coral Island, 15 m; BPBM 27457, 4: 32-39 mm, Sudan, Towartit Reef, 10-13 m; BPBM 38779, 4: 24-41 m, Red Sea, reef north of Jeddah (21[degrees]42'29"N, 39[degrees]5', 11"E).

Chromis iomelas: BPBM 14718, 48 mm, Great Barrier Reef, Pixie Reef (NE of Cairns), 9 m. BPBM 33806, 13: 17-50 mm, Coral Sea, Chesterfield Bank, Ile Longue, 15 m. BPBM 28676, 3: 4243 mm, New Caledonia, 55 m. BPBM 32734, 8: 16-45 mm, Rotuma, 11-17 m. BPBM 14579, 5: 18-45 mm, Fiji, Viti Levu, 15-22 m. BPBM 38160, 7: 26-52 mm, Tonga, Vava'u, 16 m. BPBM 22781, 2: 38-47 mm, American Samoa, Tutuila. BPBM 13690, 31 mm, Austral Islands, Rurutu, 27 m. BPBM 5880, 17: 43-56 mm, Society Islands, Tahiti, 21-27 m; BPBM 8373, 3L 3547 mm. BPBM 39256, 54 mm, Marquesas Islands, Fatu Hiva, 15 m.

ACKNOWLEDGEMENTS

This research was supported by the National Science Foundation grants OCE-0453167 and OCE-0929031 to Dr. Brian W Bowen, as well as NOAA National Marine Sanctuaries Program MOA No. 2005-008/66882. It was also funded in part by a Natural Sciences and Engineering Research Council of Canada (NSERC) postgraduate fellowship and a National Geographic Society Grant (902411) to the second author. We thank foremost Richard Winterbottom, who contributed his photographs of the para.types of Chrornis fieldi of Figures 6 and 8, and whose large collections of this species from the Chagos Archipelago at the Royal Ontario Museum provided paratypes for five other institutions. Thanks are also due Dr. Tilman J. Alpermann of the Senckenberg Museum, David Catania of the California Academy of Science, and Shirleen Smith of the U. S. National Museum of Natural History for loans and/or information on specimens in their care; Anthony Nahacky and Kish Patel of Aquarium Fish Ltd. for genetic material from Fiji; Wouter Holleman for assistance with literature; Drs. Luiz A. Rocha and Matthew T. Craig for genetic material from the Republic of Seychelles; Dr. Michael Berumen at the King Abdullah University of Science and Technology, associated staff from the Coastal and Marine Resources Core Lab at the Red Sea Research Center, and Drs. Brian Bowen and Michelle Gaither for facilitating collections in the Kingdom of Saudi Arabia; the Center for Genomics, Proteomics, and Bioinformatics at the University of Hawaii (Manoa Campus) for assistance with DNA sequencing; and Dr. Gerald R. Allen, Helen A. Randall, and Jean Michel Rose for their review of the manuscript, with valuable suggestions for improvement. This is contribution no. 8806 from the Hawaii Institute of Marine Biology and no. 1533 from the School of Ocean and Earth Science and Technology of the University of Hawaii.

REFERENCES

ALLEN, G. R. 1991. Damselfishes of the World. Mergus, Melle, Germany, 271 pp.

ALLEN, G. R. & ADRIM, M. 2003. Coral reef fishes of Indonesia. Zoological Studies 42 (1): 1-72.

ALLEN, G. R. 8c ERDMANN, M. V. 2009. Two new species of damselfishes (Pomacentridae: Chromis) from Indonesia. aqua, International Journal of Ichthyology 15 (3): 121.134.

ALLEN, G. R. & STEENE, R. C. 1987. Reef Fishes of the Indian Ocean. T.F.H. Publications, Neptune City, NJ, 240 pp.

ALLEN, G. R. & DREW, J. A. 2012. A new species of damselfish (Pomacentrus: Pomacentridae) from Fiji and Tonga. aqua, International Journal of Ichthyology 18 (3): 171-180.

ALLEN, G. R., ERDMANN, M. V. & BARBER, P. H. 2010. A new species of damselfish (Chrysiptera: Pomacentridae) from Papua New Guinea and eastern Indonesia. aqua, International Journal of Ichthyology 16 (2): 61-70.

BAISSAC, J. de B. 1976. Poissons de mer des eaux de !'Ile Maurice. Proceedings of the Royal Society of Arts and Sciences of Mauritius 3 (2): 191-226.

BARNARD, K. H. 1927. A monograph of the marine fishes of South Africa. Annals of the South African Museum 21 (2): vii + 419-1065.

BERNARDI, G. & CRANE, N. L. 1999. Molecular phylogeny of the humbug damselfishes inferred from mtDNA sequences. Journal of Fish Biology 54: 12101217.

BOWEN, B. W, BASS, A. L., Rod-LA, L. A., GRANT, W. S. 8C ROBERTSON, D. R. 2001. Phylogeography of the trumpetfishes (Aulostomus): Ring species complex on a global scale. Evolution 55: 1029-1039.

DE BEAUFORT, L. F. 1940. The Fishes of the Indo-Australian Archipelago, vol. 8, E. J. Brill, Leiden, xv + 508 pp.

DREW, J. A., ALLEN, G. R. & ERDMANN, M. V. 2010. Congruence between mitochondrial genes and color morphs in a coral reef fish: population variability in the Indo-Pacific damselfish Chrysiptera rex (Snyder, 1909). Coral Reefs 29: 439-444.

DRUMMOND, A. J., ASHTON, B., CHEUNG, M., HELED, J., KFARsE, M., MOIR, R., STONES-HAVAS, S., THIERER, T. & WILSON, A. 2009. Geneious v4.8. Available from http://www.geneious.com.

EXCOFFIER, R., L., LAVAL, G. 8c SCHNEIDER, S. 2005. Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evolutionary Biology Online 1: 47-50.

FIELD, R. & FIELD, M. 1998. Reef Fishes of the Red Sea. Regan Paul International, London, 192 pp.

FOURMANOIR, P. 1954. Ichthyologic et Peche aux Comores. Memoires de l'Institut Scientifique de Madagascar, set.. A, 9: 189-238.

FOWLER, H. W. 1928. The Fishes of Oceania. Memoirs of the Bernice. I? Bishop Museum. 10: 1-540.

FOWLER, H. W. 1946. A collection of Fishes obtained in the Riu Kiu Islands by Captain Ernest R. Tinlcham, A.U.S. Proceedings of the Academy of Natural Sciences of Philadelphia 98: 123-218.

FOWLER, H. W. 8c BEAN, B. A. 1928. Contributions to the biology of the Philippine Archipelago and adjacent regions. The fishes of the families Pomacentridae, Labridae, and Callyodontidae, collected by the United States Bureau of Fisheries steamer "Albatross," chiefly in Philippine seas and adjacent waters. Bulletin of the United States National Museum 100, vol. 7: i-viii + 1-525.

FROUKH, T. & KOCHZIUS, M. 2008. Species boundaries and evolutionary lineages in the blue green damselfishes Chromis viridis and Chromis atripectoralis. Journal of Fish Biology 72: 451-457.

GILBERT, C. H. 1905. The deep-sea fishes of the Hawaiian Islands. In: The aquatic resources of the Hawaiian Islands. Bulletin of the U S. Fish Commission. 23 (2): 577-713.

GUNTHER, A. 1873-1910. Andrew Garrett's Fische der Sudsee. Journal de Museum Godeffroy, parts 3, 6, 9, 11, 13, 15, 16, and 17 in vols. 2, 4, and 6. Hamburg.

HARMEUN-VIVIEN, M. 1976. Ichthyofaune de quelques recifs corallines des Iles Maurice et La Reunion. The Mauritius Institute Bulletin 8 (2): 69-104.

HASEGAWA, M., KISHINO, K. & YANO, T. 1985. Dating the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22: 160-174.

HEEMSTRA, P. & HEMMSTRA, E. 2004. Coastal Fishes of Southern Africa. South African Institute for Aquatic Biodiversity and National Inquiry Service Centre, Grahamstown, xxiv + 488 pp.

HUBERT, N., MEYER, C. P., BRUGGEMANN, H. J., GuERIN, F., KomENO, R. J. L., ESPIAU, B., CAUSSE, R., WILLIAMS, J. T. & PLANES, S. 2012. Cryptic diversity in Indo-Pacific coral-reef fishes revealed by DNA-barcoding provides new support to the centre-of-overlap hypothesis. PLoS ONE7 (3): e28987.

JOHNS, G. C. & AVISE, J. C. 1998. A comparative summary of genetic distances in the vertebrates from the mitochondrial cytochrome b gene. Molecular Biology and Evolution 15: 1481-1490.

JORDAN, D. S. & SEALE, A. 1906. The fishes of Samoa. Description of the species found in the archipelago, with a provisional check-list of the fishes of Oceania. Bulletin of the Bureau of Fisheries 25: 173-488.

KIMURA, S., SATAPOOMIN, U. & MATSUURA, K. (eds.). 2009. Fishes of Andaman Sea. National Museum of Nature and Science, Tokyo, vi 346 pp.

KHALAF, M. A. & DISI A. D. 2007. Fishes of the Gulf of Aqaba. Marine Science Station, Jordan, Aqaba, 252 pp.

KLUNZINGER, C. B. 1871. Synopsis der Fische des Rothen Meeres. II. Theil. Verhandlungen der K-K zoologisch-botanischen Gesellschaft in Wien. 21: 441-688.

KUITER, R. H. 1998. Photo Guide to Fishes of the Maldives. Atoll Editions, Apollo Bay, Victoria, 257 pp.

LEE, WI, CONROY, J., HOWELL, W. H. & KOCHER, T D. 1995. Structure and evolution of teleost mitochondrial control regions. Journal of Molecular Evolution 4: 1, 5466.

LESSIOS, H. A. 2008. The Great American Schism: Divergence of marine organisms after the rise of the Central American Isthmus. Annual Review of Ecology, Evolution, and Systematics 39: 63-91.

MACLEAY, W. 1882. Contribution to a knowledge of the fishes of New Guinea.--No. H. Proceedings of the Linnean Society of New South Wales. 7 (3): 351-366.

MCMILLAN, W. 0. & PALUMBI, S. R. 1995. Concordant evolutionary patterns among Indo-West Pacific butterfly-fishes. Proceedings of the Royal Society of London. Series B, Biological Sciences 260: 229-236.

MEEKER, N. D., HUTCHINSON, S. A., Ho, L. & TREDE, N. S. 2007. Method for isolation of PCR-ready genomic DNA from zebrafish tissues. Biotechniques 43: 610-614.

POSADA, D. 2008. jModeltest: Phylogenetic model averaging. Molecular Biology and Evolution 25: 1253-1256. PYLE, R. L., EARLE, J. L. & GREENE, B. D. 2008. Five new species of the damselfish genus Chromic (Perci-formes: Pomacentridae) from deep coral reefs in the tropical western Pacific. Zootaxa 1671: 3-31.

QUENOUILLE, B., BERMINGHAM, E. & PLANES, S. 2004. Molecular systematic of the damselfishes (Teleostei: Pomacentridae): Bayesian phylogenetic analyses mitochondrial and nuclear DNA sequences. Molecular Phylo-genetics and Evolution 31: 66-88.

QUERO, J.-C., SPITZ, J. & VAYNE, J.-J. 2010. Chromic durvillei: une nouvelle espece de Pomacentridae (Acinopterygii: Perciformes) de rile de la Reunion (France, Ocean Indien) et ler signalement four rile de Chromis axillaris. Cybium 33(4): 321-326.

RANDALL, J. E. 1980. Guide to Hawaiian Reef Fishes. Har-rowood Books, Newtown Square, PA., 74 pp.

RANDALL, J. E. 1983. Red Sea Reef Fishes. Immel Publishing, London, 193 pp.

RANDALL, J. E. 1992. Diver's Guide to Fishes of Maldives. Immel Publishing, London, 193 pp.

RANDALL, J. E., ALLEN, G. R. & STEENE, R. C. 1990. Fishes of the Great Barrier Reef and Coral Sea. University of Hawail Press, Honolulu, xx + 557 pp.

REECE, J. S., BOWEN, B. W., SMITH, D. G. 8c LARSON, A. 2010. Molecular phylogenetics of moray eels (Muraenidae) demonstrates multiple origins of a shell-crushing jaw (Gymnomuraerza, Echidna) and multiple colonizations of the Atlantic Ocean. Molecular Phylogenetics and Evolution 57: 829-835.

REGAN, C. T. 1917. Additions to the fish fauna of Natal. Annals of the Durban Museum 1 (5): 458-459.

RONQUIST, F. & HUELSENBECK, J. P. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinfirmatics 19: 1572-1574.

SATAPOOMIN, K. 2007. A Guide to the Reef Fishes of the Andaman Sea, Thailand. Phuket Marine Biological Center, vi 231 pp.

SIDDALL, M., ROHLING, E. J., ALMOGI-LABIN, A., HEM-LEBEN, C., MEISCHNER, D., SCHMELZER, I. 8c SMEED, D. A. 2003. Sea-level fluctuations during the last glacial cycle. Nature 423: 853-858.

SMITH, J. L. B. 1949. The Sea Fishes of Southern Africa. Central News Agency, Cape Town, 550 pp.

SMITH, J. L. B. 1955. The fishes of Aldabra.--Part III. Annals and Magazine of Natural History, ser, 1, 8: 886896.

SMITH, J. L. B. 1960. Coral fishes of the family Pomacentridae from the Western Indian Ocean and the Red Sea. Ichthyological Bulletin No. 19: 317-349.

SMITH, J. L. B. 8c SMITH, M. M. 1963. The Fishes of Seychelles. 215 pp. Department of Ichthyology, Rhodes University, Grahamstown.

SMITH, M. M. & HEEMSTRA, P. C. (eds.). 1986. Smiths' Sea Fishes. Johannesburg: Macmillan South Africa, xx + 1047

SONG, C. B., NEAR, T. J. & PAGE, J. M. 1998. Phylogenetic relations among percid fishes are inferred from mitochondrial cytochrome b DNA sequence data. Molecular Phylogenetics and Evolution 10: 343-353.

SWOFFORD, D. L. 2000. PAUP*: phylogenetic analysis by parsimony, version 4. Sinauer Associates. Massachusetts: Sunderland.

TABERLET, P., MEYER, A. & BOUVE.RT, T, J. 1992. Unusually large mitochondrial variation in populations of the blue tit, Parus caeruleus. Molecular Ecology 1: 27-36.

VORIS, H. K. 2000. Maps of Pleistocene sea levels in Southeast Asia: shorelines, river systems and time durations. Journal of Biogeography 27: 1153-1167.

WINTERBOTTOM, R., EMERY, A. R. & HOLM, E. 1989. An annotated checklist of the fishes of the Chagos Archipelago, Central Indian Ocean. Royal Ontario Museum Life Sciences Contributions 145: 1-226.

John E. Randall (1) and Joseph D. DiBattista (2)

1) Bishop Museum, 1525 Bernice St., Honolulu, HI 96817-2704, USA. E-mail: jackr@hawaiisr.com

2) Red Sea Research Center, King Abdullah University of Science and Technology, Thuwal, 23955-6900, Saudi Arabia. E-mail: Joseph.DiBattista@kaust.edu.sa

Received: 29 July 2012--Accepted: 14 December 2012
COPYRIGHT 2013 Aquapress Publisher
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Randall, John E.; DiBattista, Joseph D.
Publication:aqua: International Journal of Ichthyology
Article Type:Report
Geographic Code:1USA
Date:Jan 1, 2013
Words:8328
Previous Article:A new species of Hemigrammus from the upper rio Negro basin, Brazil, with comments on the presence and arrangement of anal-fin hooks in Hemigrammus...
Next Article:Social structure and reproductive behavior of the callionymid fish Callionymus bairdi (gobiesociformes: Callionymidae): with notes on male...
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters