Printer Friendly

A combined morpho-molecular approach towards identification of Chaetomium species of India.

Many fungi have significant importance to human being. Some of them are harmful and some are beneficial. Harmful fungi generally cause diseases in animals, humans and plants. On the other hand beneficial fungi have many advantages such as; biodegradation, bioremediation, biocontrol activities. Recently Chaetomium and its species have drawn much attention to be used to control several economically important diseases. Some isolates of C. globosum produce antibiotics that can suppress damping-off of sugar beet caused by Pythium ultimum (1). C. cupreum and C. globosum reduce leaf spot disease of corn caused by Curvularia lunata, rice blast caused by Pyricularia oryzae, sheath blight of rice caused by Rhizoctonia oryzae and tomato wilt caused by Fusarium oxysporum f.sp. lycopersici (2,3).

Chaetomium belongs to the division Ascomycota, and family Chaetomiaceae (4) and one of the largest genera of saprophytic fungi. It comprises more than 400 species worldwide (5). This genus is characterized by superficial ascomata usually covered with hairs or setae (6); membranaceous peridium, consisting of several pseudoparenchymatous layers; asci that are clavate or fusiform (with biseriately arranged ascospores) or sometimes cylindrical (with uniseriately arranged ascospores), thin-walled, evanescent and without apical structures; scarce paraphyses that disappear before ascocarps mature (7); ascospores that are brown or gray-brown (never opaque or black), one celled, with one or sometimes two germ pores, and exuding as a dark, black, sticky mass (8).

Species identification based morphological characters alone is difficult to confirm certain closely related species such as C. indicum and C. funicola; C. globosum and C. olivaceum; C. globosum and C. globosporum etc (9). Thus it is necessary to find an alternative method for accurate identification of the species of this genus. The advent of molecular tools for investigations in fungal identification has paved better way for easier and more accurate identification, if it is coupled with traditional methods such as morphological characters. ITS is universal region for fungal identification 51011. Therefore the current research work was carried out by combining the molecular data (ITS based identification) with morphology for authentic identification of Chaetomium species.

MATERIALS AND METHODS

Collection of Chaetomium isolates

Chaetomium isolates were collected from different places and sources (Table 1). Chaetomium genus identified by using basic morphological features. Species identification was done based on key from Ames (1961). The same isolates were used for the molecular confirmation for ITS region amplification.

Optimization of cultural conditions

Single spore cultures were made through serial dilution technique. Growth conditions were standardized using different growth media (Potato dextrose Agar, Malt extract Agar, Oat meal Agar, and Potato carrot Agar) and temperature (20[degrees]C, 25[degrees]C, 30[degrees]C, 35[degrees]C, 40[degrees]C and 45[degrees]C).

Morphological characterization

The cultures of Chaetomium isolates were grown on malt extract agar medium in Petri dish at 35[degrees]C and examined for size, shape and colour of the perithecium, ornamentation of terminal hairs, lateral hairs, rhizoids and size and shape of ascospores. For all photomicrographs Progres 2.7 version (Jenoptik, USA) camera was used. Measurements of perithecium, terminal hairs and ascospores were recorded and compared with type descriptions (12).

Genomic DNA Extraction

Genomic DNA was extracted from frozen mycelium of Chaetomium species based on Cetyl trimethyl ammonium bromide (CTAB) mini extraction method (13). The DNA concentration and purity of the samples was determined with Nano drop spectrophotometer (Thermo Scientific).

Amplification of the ITS region of Chaetomium spp.

DNA from 61 isolates was subjected to PCR amplification of ITS region by using universal primers (ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) (14)). PCR reactions were carried out in 0.2 ml thin walled PCR tubes with a total reaction volume of 25 [micro]l containing 12.5 [micro]l of dream taq (master mix consisting of buffer, dNTP's, Mg[Cl.sub.2], Taq polymerase at appropriate concentrations and pre mix of loading dye), 1 [micro]l of each forward and reverse primers, 1 [micro]l of DNA sample and rest nuclease free water. The PCR amplification conditions were initial denaturation at 94[degrees]C for 5 min followed by 35 cycles of denaturation at 94[degrees]C for 1 min, primer annealing at 55[degrees]C for 1min, primer extension at 72[degrees]C for 2 min, and a final primer extension at 72[degrees]C for 5 min.

DNA sequencing of the amplified fragments

The amplified products were separated on 1.2% agarose gel at 80 volts for 45 minutes using 1 x TAE buffer pH 8.0 containing ethidium bromide (0.5 [micro]g/ml). The amplified fragment of DNA were compared with ladder of 1000 bp and the bands of DNA fragments were shown approximately 550 to 650 bp indicating the amplification of ITS region. The gels were photographed using gel documentation system (Fig.3). Sequencing of all the samples with distinct band were done through outsourcing.

Phylogenetic analysis

Molecular identification of Chaetomium spp. using ITS region sequences was done through NCBI BLAST (http://blast.ncbi.nlm.nih.gov) for the species identification. ITS sequences were aligned using CLUSTALW multiple sequence alignment (15). Phylogenetic analysis was carried out using MEGA 5 program (16) and a maximum parsimony tree was constructed. Confidence values were assessed from 1000 bootstrap replicates of the original data.

RESULTS

Optimization of cultural conditions

From the observations (Fig.1, Table 2 & Table 3) it is inferred that the best medium for the good sporulation of the Chaetomium was found on malt extract agar medium and the optimum temperature is ranged between 35-40[degrees]C. Although the oat meal agar have showed more growth rate than the any other media, the sporulation obtained was meager. Thus malt extract agar media was selected as best media for further studies.

Morphological identification

Morphological observations were made from the cultures grown on malt extract agar at 35-40[degrees]C. Chaetomium species identification was done using following characters viz., size and shape of the perithecium; branching pattern, surface texture, septation and density of terminal hairs; presence of lateral hairs and rhizoids; size, shape and colour of the ascospores. Predominantly the isolates were identified based on the terminal hairs and size and shape of ascospores as these are very distinct from species to species.

Taxonomy description of genus Chaetomium

Pertithecia are opaque, ostiolate, with blunt, narrow or beaked apex and its wall membranous, fragile, brittle with age, distinctly cellular, ornamented with appendages in the form of diversely modified and variously coloured hairs called terminal hairs. Asci gelatinous-walled, delicate, stalked, club shaped, linear, cylindrical, evanescent, deliquescing before the ascospores are mature or sometimes persisting to their maturity before deliquescing, with 8 ascospores. Ascospores single celled, slightly or darkly coloured, most frequently olive-brown, occasionally bright coloured, typically lemon shaped but occurring in a variety of shapes, sizes and colours.

Comparison of morphological traits for species differentiation

1. Terminal hairs dichotomously branched. Ascospores ovoid, apiculate.

i. Terminal hairs uniformly branched with sharp tips, Ascospores size 11-13 x 8.5-9.5 [micro]m...C. elatum

ii. Branched hairs acutely angled, often inflated between septa, combined with long unbranched stiff, sharp-pointed hairs, Ascospores size 5.5-6.5 x 3.75-5 [micro]m. C. funicola

2. Terminal hairs dark brown, branched at right angles or nearly so, Ascospores almondshaped or ellipsoid, 10-12 x 5.5-7.5 [micro]m ...C. atrobrunneum

3. Terminal hairs branched, delicate and terminating into flexuous ends--

i. Ascospores very dark, irregularly spherical 13-16.5 x 12-14 [micro]m...C. megalocarpum

ii. Ascospores dilute brown, pale green when young, 5-6 x 4-5 [micro]m...C. nigricolor

4. Terminal, hairs straight, slightly curved or wavy ; Ascospores smaller to medium, size ranges between 9-13 x 6-9.5 [micro]m, apiculate ...C.globosum

5. Terminal hairs coiled, unbranched but intermingled with other hair types--

i. Terminal hairs with 4-7 close spirals accompanied with a few long, flexuous hairs, forming a relatively compact head, Ascospore size 6-7.5 x 5.5-6.5 [micro]m...C.brasiliense

ii. Terminal hairs kinky-wavy, mildly distorted or loosely coiled, Ascospores fusiform, collapsing with a long furrow, 8-13.5 x 5.6-6 [micro]m ...C.perlucidum

iii. Terminal hairs forming a dense head with stout, spiraled with 3-4 convolutions, Ascospores lemon-shaped, apiculate on both ends, 7-10.5 x 6.5-8.5 [micro]m long ...C. cochliodes

Morphological characters of different species of Chaetomium

Chaetomium atrobrunneum Ames Fig. 2 (1-3)

Synonymy: C. fusisporale/C. rectopillium.

Perithecia dark brown to black, small, ostiolate, globose, subglobose to oval with size of 80-150 x 80-130 [micro]m. Base of perithecia round and firmly attached to the substrate by short, thin, light brown rhizoids. Terminal hair long, dark brown straight, erect, unbranched /branched right angled with smooth to slightly rough tapering to narrow blunt tip. Lateral hairs dark brown colour, straight slightly rough, septate with blunt tips. Asci clup shaped, evanescent, 8 spored. Ascospores darkbrown, ellipsoid to almond shaped 8-13 x 4-7 [micro]m.

Material examined: C-2, C-11, C-12, C-13 and C-58.

Chaetomium brasiliense Batista & Pontual (Ames) Fig. 2 (4-6)

Synonymy: C. fuscum/C. albo-arenulum.

Perithecia brown to black, ostiolate, small, subglobose or ovate, basal oval or pointed 100130 x 90-110 [micro]m, attached to substratum with black rhizoids. Terminal hairs flexed bellow, spirally coiled above with four to several coils, septate, smooth or finely rough with rounded tips. Lateral hairs slender, straight or flexed septate, finely roughened at base. Asci cylindrical linear. Ascospores light olive- brown, broadly ovate, 5-6 x 3-5 [micro]m, sub apiculate at one end rounded at other end.

Material examined: C-4, C-35, C-34 and C-39. Chaetomium cochliodes Palliser Fig. 2 (7-9)

Synonymy: C. globosum/C. kunzeanum /C. olivaceum/C. spirale/C. barbatum/C. subterraneum/C. ochraceum/C.fibripilium/C. molliplium/C. lustanicum/C. subglobosum/C. coarctatum/C. rectum/C. spiculipilum. Perithecia olive green to brown, ostiolate, globose to subglobose 260-360 x 260-320 [micro]m in size anchor to the substrate by rhizoids. Terminal hairs numerous interwoven, forming thick mass with two types of hairs (a) convolution beyond the dense head; (b) slender, twisted undulate with 3-5 coils. Lateral hairs numerous, septate, finely roughened. Asci irregularly club shaped. Ascosproes olivebrown, lemon-shaped, 8-12 x 6-9 [micro]m apiculate at both ends.

Material examined: C-5, C-6, C-18 and C-40. Chaetomium elatum Kunze ex Fr. Fig. 2 (10-12)

Synonymy: C. pannosum/C. tenuissimum/C. virgicephalum/C. ramipilosum.

Perithecia black, ostiolate, large, subglobose or ovate, 360-450 x 270-350 [micro]m attached to substratum by black rhizoids. Terminal hairs olive brown, coarsely roughened with spines, stout, dichotomously branched. Lateral hairs dark olive brown, unbranched, straight or slightly flexed, long slender, roughened. Asci club shaped, 8-spored. Ascospores olive- brown, lemon shaped, 10-15 x 7-9 [micro]m, apiculate at both ends.

Material examined: C-1.

Chaetomium funicola Cooke Fig. 2 (13-15)

Synonymy: C. horrida/C. dolichotrichum.

Perithecia dark brown, globose to sub globose, 90-160 x 90-180 pm, terminal hairs dark olive brown, of two kinds (a) unbranched, long and straight, gradually tapering to blunt tips and (b) shorter, dichototmously branched at acute angles, tips rounded, both hairs coarsely roughened. Lateral hairs dark olive brown with hyaline tips. Asci club shaped, eight- spored. Acsospores olive brown, ovate to ellipsoid 5-8 x 3-5 [micro]m in size.

Material examined: C-8, C-9, C-10, C-36 and C-60.

Chaetomium globosum Kunze ex Fr Fig. 2 (16-18) Synonymy: C. kunzeanum/C. olivaceum/C. spirale/C. barbatum/C. subterraneum/C. ochraceum/C. fibripilium/C. molliplium/C. lustanicum/C. subglobosum/C. coarctatum/C. rectum/C. spiculipilum.

Perithecia black, ostiolate, globose to subglobose or broadly ovate, 170-380 x 180-310 pm, in size. Terminal hairs numerous, slender, straight or slightly flexed, septate, asci club shaped, eight-spored. Ascospores dark olive-brown, shapes varies from broadly ovate to lemon shape 8-12 x 6-9 [micro]m in size with ends apiculate.

Material examined: C-3, C- 5, C-6, C- 7, C- 15, C16, C-17, C-18, C-19, C-20, C-21, C-22, C-23, C24, C-25, C-26, C-27, C-28, C-29, C-30, C-31, C32, C-33, C-38, C-40, C-41, C-42, C-43, C-45, C46, C-47, C-48, C-49, C-51, C-52, C-54, C-56 and C-59.

Chaetomium megalocarpum Bainier Fig. 2 (19-21) Synonymy: C. atrosporum.

Perithecia olive green in colour, subglobose to ovoid, without distinct neck, 300-330 x 240-290 [micro]m in size. Terminal hairs long, slightly tapering to blunt tips, minutely roughened, non septate, occasionally branching at wide angles. Lateral hairs light yellow, long, nonseptate. Asci club shaped, 8-spored. Ascospores globose, subglobose or ovoid, 14-17 x15-16 [micro]m, dark brown, often depressed on one side.

Material examined: C-14, C-37, C-50, C-53 and C-57.

Chaetomium nigricolor Ames Fig. 2 (22-24)

Synonymy: C. abuense/C. vitis/C. verricichaeta /C. psuedoerraticum.

Perithecia brown to black, ostiolate, globose to subglobose, 200-285 x 190-260 [micro]m, attached to the substratum with brown rhizoids, the bushy-haired heads with a ragged appearance. Terminal hairs numerous, black, regularly and thickly covered with little black, projections, appearing at random, undulating or with occasional spiral coils, frequently branching, at base 3-4[micro] in diameter, tapering to faded tips. Ascospores when mature brown almond-shaped, slightly apiculate at both ends, 5-6 x 4-5[micro]m.

Material examined: C-44.

Perithecia is olive- yellow to light brown, globose, 105- 135 x 100-130 [micro]m, with rhizoids at the base, Terminal hairs forming a comparatively unbranched, septate, the lower third is straight, coiled above into a very elongated, somewhat conical spiral 30-45 [micro]m in diameter at the base, with sparse septations. Lateral hairs are straight with septation, with tapering tips. Asci short, clavate, 39-45 x 12 [micro]m, 8-spored. Ascospores spindle--shaped, with blunt, round ends, 12-13.5 x 5.6-6 [micro]m, of a muddy brownish-yellow colour.

Material examined: C-55 and C-61.

Molecular Identification of different Chaetomium species using ITS region

ITS sequences of all the 61 isolates of Chaetomium species were interfaced with the NCBI genebank database using basic alignment search tool to identify as respective species (Table.4). Evolutionary analyses were conducted using the Maximum Parsimony method. The analysis involved 61 ITS1 nucleotide sequences. Tree 1, out of 4 most parsimonious trees (length = 147) is shown. The consistency index is 0.62, the retention index is 0.91, and the composite index is 0.62 (0.57) for all sites and parsimony-informative sites (in parentheses) were calculated. All positions containing gaps and missing data were eliminated. There were a total of 437 positions in the final dataset. It is depicted from the dendrogram (Fig.4) that the different species of Chaetomium clustered into six major groups.

Five isolates of C. funicola (C-8, C-9, C-10, C-36, C-60), four isolates of C. brasiliense (C-4, C-35, C-34, C-39), five isolates of C. atrobrunneum, (C-2, C-11, C-12, C-13, C-58) and five isolates of C. megalocarpum, (C-14, C-37, C-50, C-53, C-57) and were grouped together in Clusters 1, 2, 4 and 5, respectively. C-55, C-61 and C-44 isolates of two species viz., C. perlucidum and C. nigricolor were grouped in Cluster 3 with 74-95 % similarity. Thirty eight isolates of C.globosum were grouped into Cluster 6 along with one isolate of C.elatum (C-1) which has showed similarity index of 77-92%. More than 33 isolates of C.globosum have showed 87-92% similarity index with the C. elatum indicating it could have evolved from the C. globosum. Further, the species identified through the morphology were compared with the data obtained through molecular approach and found very much complemented (Table 4).

DISCUSSION

Chaetomium genus gaining more importance in agriculture as this can be used for bio-control to combat various economically important diseases (17,18,19) More than 400 species have been described in Chaetomium according to the statistics of Index Fungorum. In this perspective it has become mandate for exact species identification. Terminal hairs have formed one of the important character to identify these species of this genus (12,20,21,22,23,24). Other major characters for species differentiation are morphology of asci and ascospores (7,8,25). Present investigation was carried out based on integrated approach of morphological and molecular characters of different species of Chaetomium. Many characters of morphology were considered for species differentiation and all the species were clearly discussed in the area of taxonomy description. Since from the discovery of this fungus by Kunze 1817, only few taxonomists worked on morphology of this fungus (17,26,27,28). In the present study different species of Chaetomium viz., C. globosum, C. atrobrunneum, C. brasiliense, C. elatum, C. cochliodes, C. funicola, C. nigicolor, C. megalocarpum and C. perlucidum were defined based on morphological characters. The morphological data obtained in the study was supplemented earlier studies (7,26,29,30,31,37,33,34), providing an authentic identification of these species. An exception has observed in combined approach through morphology and ITS based identification, a species of Chaetomium was identified as C.cochliodes (C-5, C-6, C-18 and C40) through morphology. But these isolates were identified as C.globosum through ITS based identification. Both the species are reported as synonyms (35) and taxonomical description for C.cochliodes was mentioned to have two different types of terminal hairs, coiled and undulating kind. In our study we got only coiled type of terminal hairs which was very different from C.globosum morphology, the other type of terminal hairs which is similar to C.globosum morphology was not observed. Therefore we have kept C.cochliodes same intact in morphological identification. These observations further inferring that above species are most commonly occurring in India.

Morphological characteristics are alone not enough to define the identity of Chaetomium species as this genus has multiple species-specific characters in several species; therefore, it was decided to define the morphology along with ITS sequence analysis. The maximum parsimony analysis resulted into formation of six clusters showing different species of Chaetomium. The clustering of different species matches with the earlier findings of Asgari and Zare (2011).According to them a combined sequence dataset of the ITS region, partial LSU rDNA, and a-tubulin gene sufficiently resolved five species groups of Chaetomium and the molecular data largely concordant with combined features of morphology of the Chaetomium species. Analysis of the entire fingerprint profile using the unweighted pair-group method with arithmetic averages (UPGMA) clearly differentiated C. globosum isolates from C. perlucidum and C. reflexum (36). Aggarwal et al. (2013) have done the molecular characterization of 18 Chaetomium isolates collected from India based on the ITS region of the rRNA gene sequences. Results indicate that, different isolates of the Chaetomium spp. may have different specialized life strategies in surviving diverse climates (10). Wang et al., 2014 have done multigene phylogenetic analyses with ribosomal ITS, partial ribosomal large subunits (28S rDNA), a-tubulin, the translation elongation factor 1a (TEF1-a), and the largest subunit of RNA polymerase (22) (RPB1) and recognized eight well-supported lineages within the monophyletic C. indicum group (5). All these data sufficiently supplements the resolution of species of Chaetomium by using molecular data.

The present paper describes the typical characters and identification of nine species of Chaetomium based on morphology which was complemented with ITS region sequence analysis. Thus morphological identification supplemented with the molecular data would result in to more accurate identification of the Chaetomium species.

CONCLUSION

From the data it can be suggested that the most commonly occurring species of Chaetomium in India include C. atrobrunneum, C. brasilense, C. cochliodes, C. elatum, C. funicola, C. globosum, C. megalocarpum, C. nigricolor and C. perlucidum. Combined morphological and molecular approach for identification of Chaetomium well fit for species identification. Molecular data can complement the morphological data for better identification.

ACKNOWDEGEMENTS

The authors thank the Head, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi for the help in various aspects of this study.

REFERENCES

(1.) Di Pietro, A., Kung, R., Gutrella, M. and Schwinn, F. J. Parameters influencing the efficacy of Chaetomium globosum in controlling Pythium ultimum damping-off of sugar-beet. Journal of Plant Disease and Protection. 1991; 98: 565573.

(2.) Soytong, K. Biological control of tomato wilt caused by Fusarium oxysporum f.sp. lycopersici using Chaetomium cupreum. Kasetsart Journal (Natural Science). 1992 b; 26: 310-313.

(3.) Soytong, K., Antagonism of Chaetomium cupreum to Pyricularia oryzae. J. of Plant Protection in the Tropics. 1992 a; 9: 17-24.

(4.) Kunze, G. Schmidt, J. C. Chaetomium Myc. Heft. 1817; 1:15.

(5.) Wang, X-Wei., Wang, X-Liang., Liu, F., Zhao, X., Li, J., Cai, L. Phylogenetic assessment of Chaetomium indicum and allied species, with the introduction of three new species and epitypification of C. funicola and C. indicum. Mycol. Progress. 2014; 13: 719-732.

(6.) Hawksworth, D. L., Wells, H. Ornamentation on the terminal hairs in Chaetomium Kunze ex Fr. and some allied genera. Mycol Pap. 1973; 134: 1-24.

(7.) Arx, J. A., Von, Guarro, J., Figueras, M. J., The ascomycete genus Chaetomium. Beih Nova Hedwigia. 1986; 84: 1-162.

(8.) Millner, P. D. Radial growth responses to temperature by 58 Chaetomium species, and some taxonomic relationships. Mycologia. 1977; 69: 492"502.

(9.) Maheswari, C. U., Mathur N., Nallathambi P., Devi P. T. Comparative morphology and taxonomy of the genus Chaetomium Kunze and its species. J Mycol Plant Pathol. 2013; 43(1): 67-71.

(10.) Aggarwal, R., Kharbikar, L. L., Sharma, S., Gupta, S., Yadav, A. Phylogenetic relationships of Chaetomium isolates based on the internal transcribed spacer region of the rRNA gene cluster. African J. of Biotech. 2013; 12(9): 914-920.

(11.) Asgari, B., Zare, R., The genus Chaetomium in Iran, a phylogenetic study including six new species. Mycologia. 2011; 103(4): 863-82.

(12.) Ames, L. M., A monograph of the Chaetomiaceae. The United States Army research and development series. 1961; pp 125.

(13.) Culling, K. W. Design and testing of plant specific PCR primer for ecological evolutionary studies. Mol.Ecol. 1992; 1: 233-240.

(14.) White, T. J., Bruns, T., Lee, S., Taylor J.: Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M. A., Gelfand D. H. , Sninsky J. J., White T. J., (eds) PCR Protocols: A guide to methods and applications. Academic, New York. 1990; pp 315-322.

(15.) Thompson, J. D., Higgins, D. G., Gibson, T. J. CLUSTALW: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl Acids Res. 1994; 22: 4673-4680.

(16.) Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance and maximum parsimony Methods. Mol Biol Evol. 2011; 28: 2731-2739.

(17.) Aggarwal, R., Tiwari, A. K., Srivastava, K. D., Singh, D.V Role of antibiosis in the biological control of spot blotch (Cochliobolus sativus) of wheat by Chaetomium globosum. Mycopathologia. 2004; 157: 369-377.

(18.) Dhingra, O. D., Mizubuti, E. S. G., Santana, F.M. Chaetomium globosum for reducing primary inoculum of Diaporthe phaseolorum f. sp. meridionalis in soil surface soybean stubble in field conditions. Biological Control. 2003; 26: 302-310.

(19.) Soytong, K.., Kanokmedhakul, S., Kukongviriyapa, V., Isobe, M. Application of Chaetomium species (Ketomium[R]) as a new broad spectrum biological fungicide for plant disease control: A review article. Fungal Diversity. 2001; 7: 1-15.

(20.) Chivers, A. H. Preliminary diagnoses of new species of Chaetomium. Proc. Am. Acd. Arts. Sci. 1912; 48: 83-88.

(21.) Mukerji, K. G.: Taxonomy of Chaetomiales in relation to its morphology and cytology in Taxonomy of fungi, C. V Subramanian (ed.) University of Madras. 1978; pp 258-262.

(22.) Roberts, S. Chaetomium. Generated 2005; 1:11-12 http://www.mold-help.org; http:// www. speicies fungorum. org.

(23.) Seth, H. K., A monograph of the genus Chaetomium. Beih Nova Hedwigia. 1970; 37: 1-133.

(24.) Skolko, A. J., Growes, J. W. Notes on seed borne fungi. VII Chaetomium. Can. J. Bot. 1953; 31: 779-839.

(25.) Dreyfuss, M. Taxonomische Untersuchungen inner-halb der Gattung Chaetomium. Sydowia. 1976; 28: 50-133.

(26.) Cooke, J. Morphology of Chaetomium erraticum. Amer J. Bot. 1969 a; 56(3): 335-340.

(27.) Ellis, D. H. Ascocarp morphology and terminal hair ornamentation in thermophilic Chaetomium species. Mycologia. 1981; 73(4): 755-773.

(28.) Figueras, M. J., Guarro, J. A. Scanning electron microscopic study of ascoma development in Chaetomium malaysiense. Mycologia. 1988; 80 (3): 298-306.

(29.) Chapman, E. S., Fergus, C. L. Germination of ascospores of Chaetomium globosum. Mycologia. 1975; 67(5): 1048-105.

(30.) Cooke, J. Morphology of Chaetomium funicolum. Mycologia. 1969 b; 61(6): 1060-1065.

(31.) Hsieh, H. J., Hu, B. Y. Eight species of Chaetomium new for Taiwan. Taiwania. 2002; 47(4): 264-272.

(32.) Pornsuriya, C., Lin, F. C., Kanokmedhakul, S. Soytong. New record of Chaetomium species isolated from soil under pine apple plantation in Thailand. J. of Agric.Tech. 2008; 4(2): 91-103.

(33.) Prokhorov, V P., Linnik, M. A morphological , cultural and biodestructive peculiarities of Chaetomium species. Moscow university biological sciences bulletin. 2011; 66(3): 17-24.

(34.) Rodriguez, K., Stchigel, A., Guarro, J. Three new species of Chaetomium from soil. Mycologia. 2002; 94(1): 116-26.

(35.) Matsushima, T: Microfungi of the Solomon Islands and Papua-New Guinea. 1971; pp 1-78.

(36.) Aggarwal, R., Sharma, V., Kharbikar, L.L., Renu. Molecular characterization of Chaetomium species using URP-PCR. Genetics & Molecular Biology. 2008; 31(4): 943-946.

V Chandra Sekhar, T. Prameeladevi and Deeba Kamil

Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi-110012, India.

(Received: 28 April 2015; accepted: 06 July 2015)

* To whom all correspondence should be addressed. E-mail: vcsekhar123@gmail.com; deebakamil@gmail.com

Table 1. Details of isolates of Chaetomium
species used in present study

Isolate   Source                 Place
No:

C-1       Soil                   New Delhi
C-2       Soil                   New Delhi
C-3       Soil                   New Delhi
C-4       Soil                   New Delhi
C-5       Wheat leaves           New Delhi
C-6       Soil                   New Delhi
C-7       Soil                   Hyderabad
C-8       Soil                   Bhavnagar
C-9       Soil                   New Delhi
C-10      Compost                New Delhi
C-11      Soil                   Vadodara
C-12      Cassia fistula         Vadodara
C-13      Tamarindus indica      Vadodara
C-14      Capsicum annuum seed   Bhavnagar
C-15      Bottle brush tree      New Delhi
C-16      Soil                   Pune
C-17      Soil                   Jaipur
C-18      Cotton                 Nagpur
C-19      Coprophilous           New Delhi
C-20      Wheat grain            New Delhi
C-21      Soil                   Hyderabad
C-22      Capsicum annuum seed   Kamal
C-23      Soil                   New Delhi
C-24      Mushroom compost       Solan
C-25      Soybean seeds          Shillong
C-26      Cotton                 Nagpur
C-27      Compost                Chambaghat
C-28      Soil                   New Delhi
C-29      Wheat                  New Delhi
C-30      Wheat                  Pune
C-31      Wheat                  New Delhi
C-32      Wheat                  Jaipur
C-33      Wheat leaves           New Delhi
C-34      Wheat grain            New Delhi
C-35      Elettaria cardamomum   Dapoli
C-36      Soil                   Hyderabad
C-37      Soil                   New Delhi
C-38      Soil                   New Delhi
C-39      Soil                   Vadodara
C-40      Soil                   New Delhi
C-41      Mushroom compost       Solan
C-42      Neem bark              New Delhi
C-43      Soil                   New Delhi
C-44      Bottle Palm            Junagadh
C-45      Capsicum annuum seed   Karnal
C-46      Soil                   New Delhi
C-47      Decaying basket of     New Delhi
            Mangifera indica
C-48      Wheat grain            New Delhi
C-49      Soil                   Ujjain
C-50      Funnel seed            New Delhi
C-51      Coriander seed         New Delhi
C-52      Black pepper seed      New Delhi
C-53      Sorghum seed           New Delhi
C-54      Sorghum seed           New Delhi
C-55      Ajwain                 New Delhi
C-56      Cardamom               New Delhi
C-57      Funnel seed            New Delhi
C-58      Paper                  New Delhi
C-59      Wood                   New Delhi
C-60      Funnel seed            New Delhi
C-61      Methi seed             New Delhi

Table 2. Growth rate of Chaetomium isolate
(C-35) on different media

Media            Growth in diameter x
                  in cm on 15th day

           R1    R2    R3    R4    R5

PDA       8.4    8.2   8.2   8.3   8.2
MEA       8.4    8.3   8.5   8.0   8.4
OAM       9.2    8.9   9.0   9.2   8.6
CPA       8.2    8.9   8.6   8.5   9.0
CD @ 5%   0.28

* Average of five replications

Table 3. Growth rate of Chaetomium isolate
(C-35) at different temperatures

Temperature   Growth in diameter * in cm on
              14th day

               R1    R2    R3    R4    R5    R6

200C          8.5    6.6   7.3   8.2   7.5   8.0
250C          7.0    8.1   7.1   7.4   8.0   8.0
300C          7.0    8.6   8.3   8.3   8.5   8.6
350C          8.9    9.0   8.4   8.5   8.5   8.8
400C          9.0    9.0   9.0   9.0   9.0   9.0
450C          3.6    3.7   3.5   3.6   3.4   3.4
CD @ 5%       0.33

* Average of six replications

Table 4. Integrated approach (morphological and
molecular) for the identification of Chaetomium
species

Isolate   Identified Species   ITS Region
No.       based on             identification based
          Morphology           on NCBI Data

C-1       C.elatum             C. elatum
C-2       C.atrobrunneum       C.atrobrunneum
C-3       C.globosum           C.globosum
C-4       C.brasilense         C.brasiliense
C-5       C.cochliodes         C.globosum
C-6       C.cochliodes         C.globosum
C-7       C.globosum           C.globosum
C-8       C.funicola           C.funicola
C-9       C.funicola           C.funicola
C-10      C.funicola           C.funicola
C-11      C.atrobrunneum       C.atrobrunneum
C-12      C.atrobrunneum       C.atrobrunneum
C-13      C.atrobrunneum       C.atrobrunneum
C-14      C.megalocarpum       C.megalocarpum
C-15      C.globosum           C.globosum
C-16      C.globosum           C.globosum
C-17      C.globosum           C.globosum
C-18      C.cochliodes         C.globosum
C-19      C.globosum           C.globosum
C-20      C.globosum           C.globosum
C-21      C.globosum           C.globosum
C-22      C.globosum           C.globosum
C-23      C.globosum           C.globosum
C-24      C.globosum           C.globosum
C-25      C.globosum           C.globosum
C-26      C.globosum           C.globosum
C-27      C.globosum           C.globosum
C-28      C.globosum           C.globosum
C-29      C.globosum           C.globosum
C-30      C.globosum           C.globosum
C-31      C.globosum           C.globosum
C-32      C.globosum           C.globosum
C-33      C.globosum           C.globosum
C-34      C.brasilense         C.brasiliense
C-35      C.brasilense         C.brasiliense
C-36      C.funicola           C.funicola
C-37      C.megalocarpum       C.megalocarpum
C-38      C.globosum           C.globosum
C-39      C.brasilense         C.brasiliense
C-40      C.cochliodes         C.globosum
C-41      C.globosum           C.globosum
C-42      C.globosum           C.globosum
C-43      C.globosum           C.globosum
C-44      C.nigricolor         C.nigricolor
C-45      C.globosum           C.globosum
C-46      C.globosum           C.globosum
C-47      C.globosum           C.globosum
C-48      C.globosum           C.globosum
C-49      C.globosum           C.globosum
C-50      C.megalocarpum       C.megalocarpum
C-51      C.globosum           C.globosum
C-52      C.globosum           C.globosum
C-53      C.megalocarpum       C.megalocarpum
C-54      C.globosum           C.globosum
C-55      C.perlucidum         C.perlucidum
C-56      C.globosum           C.globosum
C-57      C.megalocarpum       C.megalocarpum
C-58      C.atrobrunneum       Catrobrunneum
C-59      C.globosum           C.globosum
C-60      C.funicola           C.funicola
C-61      C.perlucidum         C.perlucidum
COPYRIGHT 2015 Oriental Scientific Publishing Company
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Sekhar, V.Chandra; Prameeladevi, T.; Kamil, Deeba
Publication:Journal of Pure and Applied Microbiology
Article Type:Report
Geographic Code:9INDI
Date:Sep 1, 2015
Words:4957
Previous Article:Therapeutic efficacy of lytic bacteriophage PSAE-1 against Salmonella Abortusequi in Guinea pig model.
Next Article:Draft genome sequence of the endophytic bacterium Providencia rettgeri MR4 isolated from Abuliton indicum--a salt tolerant plant.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |