Printer Friendly

A STRATEGY OF TADOF1 CASSETTE DEVELOPMENT IN PLANT EXPRESSION VECTOR TO ENHANCE NITROGEN ASSIMILATION IN WHEAT.

Byline: A. Hasnain, A. Maqbool and Kauser A. Malik

ABSTRACT

TaDof1 gene is involved in enhanced nitrogen assimilation in plants. Nitrogen assimilation is essential to t he growth and development of plants as it produces large quantities of organic nitrogen including proteins, amino acids and nucleic acids. In plants functional genomic studies, gene cloning and vector construction for transformation are common procedures. The availability of effective transformation vector is one of the pre-requisites for plant transformation studies. Current research depicts the cloning of complete cassette of TaDof1 in a binary monocot expression vector (pSB219) using basic cloning strategy. The digested fragments of the vector and insert were ligated followed by transformation of ligated product in E. coli (strain DH10[alpha]). The synthetic plasmid was successfully co-transformed along with the helper plasmid pAL154 in Agrobacterium tumefaciens (strain AGL1).

The plasmid constructed in this study is suitable for Agrobacterium-mediated transformation of elite wheat varieties. The study paves the way of developing transgenic TaDof1 wheat cultivars exhibiting enhanced nitrogen assimilation.

Keywords: Nitrogen use efficiency, Gene cloning, Single-gene cassette construction, Agrobacterium-mediated transformation, Wheat transformation.

INTRODUCTION

Wheat is providing the greatest part of daily nutritional requirement for human diet. Annual world production of wheat was around 685 million tons in 2009. In order to meet the increasing need for wheat, production should be raised to an annual rate of 2% without any additional land (Sparks et al., 2014). Traditional breeding methods have reached a plateau, where increase in nitrogen application does not improve productivity. The use of biotechnological approach certainly holds a great promise to increase wheat production (Sparks and Jones, 2014). Agrobacterium tumefaciens naturally infects the wound sites in plant causing the formation of crown gall tumors. Agrobacterium-mediated transformation in plants has become the most commonly used method for the introduction of foreign genes into plant cells and subsequent regeneration of transgenic plants (Sparks et al., 2014).

Nevertheless, because of lower transformation efficiencies and genotype dependence, the transformation of wheat still presents more difficulties than transformation of other cereals such as rice and maize (Sparks and Jones, 2014). Nitrogen assimilation is crucial to growth and development of plants. An enormous amount of nitrogen fertilizers is added to fields to increase crop yield (Nosengo, 2003). Due to excessive fertilizing regimes, the adverse effects of nitrogen in the environment include algal blooms (Vitousek et al., 2009; Wuebbles, 2009), stratospheric ozone depletion and global warming (Coruzzi and Zhou, 2001). Increasing nitrogen fertilizer cost has resulted in demand for more nitrogen use efficient (NUE) crops i.e., crops that are better able to uptake, assimilate and remobilize the nitrogen available to them (Yanagisawa and Sheen, 1998).

Since a single transcription factor affects multiple genes in a metabolic pathway, it is possible to modulate the pathway using transcription factors (Yanagisawa et al., 2004). Dof1 transcription factor, unique to plants, is involved in enhanced nitrogen use efficiency in plants. Dof1 over-expressing in rice and Arabidopsis showed increased expression of the gene encoding phosphoenol pyruvate carboxylase (PEPC). PEPC is involved in increased carbon flow towards nitrogen assimilation pathway (Kurai et al., 2011). Triticum aestivum Dof1 (TaDof1) transcription factor is involved in enhanced nitrogen use efficiency in plants (Kumar et al., 2009). Gene cloning is a technique used for getting high copy number of a specific DNA fragment, recovering large quantity of protein produced by the particular gene. In the present study, TaDof1 was cloned in vector pSB219 using basic cloning strategy.

The development of plant expression vectors with a gene of interest has been extensively exercised over the last few decades (Dafny-Yelin and Tzfira, 2007). Cloning of the desired gene into plasmid vectors involves several steps. Initially, DNA and plasmid vector are digested with the same restriction enzymes. Then, ligation of digested products is done using ligation enzyme. Finally, transformation of ligation product into competent E. coli cells is performed via different transformation methods followed by selection and screening of the desired recombinants. There are different strategies that can be adopted for cloning. Blunt-end DNA cloning introduces the insertion of blunt-ended DNA or 5'-end phosphorylated PCR product into a linearized blunt-ended vector (Upcroft and Healey, 1987). The limitations of blunt-end cloning are non-directional ligation and self-ligation of vector (An et al., 2010).

TA cloning is achieved by Taq DNA polymerase which has non-template-dependent terminal transferase activity which helps adding a single deoxyadenosine (A) to 3' ends of PCR products. The PCR product can be directly cloned into a linearized T-vector that has a single base 3'-T overhang on each end (Zhou et al., 1995). The major drawback of this strategy is non-directional cloning, the insert (DNA or PCR product) is ligated in linearized T-vector in both the orientations. Among gene cloning methods, sticky-end cloning is the most efficient and widely used method (Conze et al., 2009). In order to produce sticky or complementary ends, insert DNA and vector are separately cut with the same restriction endonuclease enzymes. The insert DNA is ligated into plasmid vector by DNA ligase (An et al., 2010). In this study, a gene cloning strategy was used to clone a single transgene cassette in a binary monocot expression vector pSB219.

TaDof1 was cloned under CaMV35S promoter and Nos terminator. The synthetic plasmid containing the complete TaDof1 cassette was subsequently transformed in A. tumefaciens for wheat transformation.

MATERIALS AND METHODS

Gene and promoter resources: TaDof1 accession number AY955493.2 from Triticum aestivum codes for transcription factor (Yanagisawa et al., 2004). The nucleotide sequence was retrieved from GenBank (accession number AY955493.2). The coded protein comprises of 291 amino acids. TaDof1 transcription factor gene was got synthesized from Operon Technologies, USA. Cauliower mosaic virus 35S (CaMV35S) promoter was amplified from pGR187. The amplified CaMV35S promoter comprised of 438 bp.

Bacterial strains: The binary monocot expression vector pSB219 was obtained from Leibniz Institute of Plant Genetics and Crop Plant Research, Germany. The expression vector was maintained in E. coli strain DH10[alpha]. TaDof1 construct was developed in pSB219. TaDof1 cassette was co-transformed with pAL154 into AGLI strain of A. tumefaciens having C58 chromosome background. The pAL154 provides replication function in trans to pSB219. It has a 15 kb Komari fragment having additional virulence genes (virB, virC and virG542) for efficient plant transformation (Wu et al., 2008). The pAL154 and A. tumefaciens were kindly provided by Ms. Caroline Sparks, Rothamsted Research, UK. The TaDof1 construct developed in pSB219 was used for A. tumefaciens (AgL1) transformation.

Plasmid construction: The GFP expression cassette in pSB219 was replaced with TaDof1 cassette (Fig. 1). For promoter insertion, CaMV35S was PCR amplified from already available vector using primers (35S-HinF-1 and 35S-AscR-1) with the restriction sites HindIII and Asc1 (Table 1). Pfu DNA Polymerase (Cat# EP0502) which is highly thermostable polymerase was used for amplification of genes. The PCR product was digested and cleaned (Favorgen PCR purification kit Cat# FAPCK001-1). The vector pSB219 was digested with the respective restriction enzymes (HindIII and Asc1) and purified. The vector was purified by gel extraction and the PCR product was purified through a column (Favorgen PCR purification kit Cat# FAPCK001-1). The ligated product was transformed into E. coli DH10[alpha] by electroporation method (EppendorfEporatorA(r), Hamburg, Germany) set (Yanagisawa et al., 2004).

Nos terminator was PCR amplified from already available vector using Nos-specific primers Nos-Eco8-F2 and Nos-Sda-R2 with restriction sites Eco81I and Sda1 (Table 1). The PCR amplified product and the plasmid were double digested with Eco81I and Sda1 and purified. After ligation, the product was transformed in E. coli DH10[alpha] by electroporation method. Synthetic TaDof1 was PCR amplified using primers Dof-Asc-F2 and Dof-Eco8-R2 with the restriction sites (Asc1 and Eco81I) (Table 1). The PCR product and the plasmid were double digested with Asc1 and Eco81I and purified. E. coli DH10[alpha] was transformed with the ligated product by electroporation method. Selection of bacterial cells was performed on spectinomycin (100mg/L). Screening was done by colony PCR with the respective primers of promoter, gene and terminator. The cloned plasmids were confirmed with restriction digestion (Fig. 3) and sequencing analysis (Fig. 5). DNA Ligation Kit (Thermo Scientific, EU, Lithuania) was used for ligation reactions.

Concentration of the plasmid and DNA insert was determined by using nanodrop spectrophotometer (Thermo Scientific). The ligation reaction mixture contained 1:4 ratio of plasmid and DNA insert. T4 DNA Ligase (5u/ul), 5X Rapid ligation Buffer and nuclease-free water were also added in ligation reaction. The ligation mixture was incubated at 22AdegC for 1 hour and then at 16AdegC overnight. The ligation mixture was added in E. coli DH10[alpha] competent cells and then electroporated with electroporator (Eppendorf EporatorA(r), Hamburg, Germany) set at 2.4 kV using cuvette with 2mm gap width (Yanagisawa et al., 2004). In one vial of competent cells (100ul), 1ul of ligation mixture was added and incubated on ice for 30 minutes. After electroporation, 800ul of LB broth was added and the samples were incubated at 37AdegC for one hour. Transformation mixture (120ul) was spread on LB agar plates containing spectinomycin (100mg/L) and incubated at 37AdegC overnight.

Detection of recombinants: To analyze the presence and orientation of the DNA insert in recombinant clones, colony PCR, restriction digestion and sequencing analyses were performed. The colony PCR method was firstly applied for the detection of recombinants. Individual colony was picked and re-suspended in 25 ul of PCR master mix. Restriction analysis was also done using appropriate restriction endonuclease enzymes. Plasmid DNA was isolated from an overnight bacterial culture and cut with restriction endonucleases HindIII, AscI, Eco8I1 and SdaI. These enzymes were found on the map of cloning vector. If the transformed colony carried right orientation of the DNA insert, plasmid was sequenced with forward and reverse sequencing primers.

Strain construction: A. tumefaciens transformation was done by electroporation method as mentioned previously (Yanagisawa et al., 2004). The TaDof1 cassette was co-transformed with pAL154 into AGLI strain of A. tumefaciens. Bacterial cells were grown on media containing rifampicin (50mg/L), spectinomycin (100mg/L) and tetracyclin (2mg/L). Screening was done on the basis of colony PCR using gene junction primers PGF2 junc (ATCCTTCGCAAGACCCTTCC), PGR2 junc (TGGAGTTGGAGTTGGACGAC), GTF2 junc (ATGACGAACTACCCCTTCGC) and GTR2 junc (TAATCATCGCAAGACCGGCA) (Table 1).

Table 1. Primer sequences used in study.

Primer###Sequence###Application/notes

35S-HinF-1###5-CCCAAGCTTAACATGGTGGAGCAC-3###Amplification of CaMV35S promoter from plasmid pGR187

35S-AscR-1###5-TTGGCGCGCCGTCCTCTCC-3

Nos-Eco8-F2###5-AATCCTTAGGGATCGTTCAAACATT-3###Amplification of Nos terminator from plasmid pBRACT404

Nos-Sda-R2###5-AATCCTGCAGGGATCTAGTAACATA-3

Dof-Asc-F2###5-TTGGCGCGCCACCATGC-3###Amplification of dof1

Dof-Eco8-R2###5-AATCCTTAGGCTAGGGTAGGTA-3

PG F1 junc###5-GACGTAAGGGATGACGCACA-3###Amplification of promoter gene junction region

PG R1 junc###5-ACTTGGTGTTGGTGGACTCG-3

GT F2 junc###5-ATGACGAACTACCCCTTCGC-3###Amplification of gene terminator junction region

GT R2 junc###5-TAATCATCGCAAGACCGGCA-3

Table 2. Details of plasmid vector.

Plasmid###Insert###Unique RE sites###Selection marker###GenBank accession

pSB219###CaMV 35S promoter###HindIII, Asc1###aadA###AB863158.1

pSB219###Dof1 transcription factor###Asc1, Eco81I###aadA###AY955493.2

pSB219###Nos terminator###Eco81I, Sda1###aadA###LC221392.1

RESULTS AND DISCUSSION

Development of TaDof1 cassette in pSB219 vector: Cloning of gene is a basic technique widely used in molecular biology in order to get large number of copies of the DNA fragment in host cells that is finally translated into the desired protein (Tulpova et al., 2018). In the present study, the transgene delivered was under the control of CaMV35S promoter since it is a strong and constitutive promoter (Seternes et al., 2016). For transcription of gene, Nos terminator was used as it is extensively used as a stop signal in transgenic organisms. Nos terminator was for the first time identified by Lipp et al. (1999). The TaDof1 cassette was developed in a binary monocot transformation vector pSB219. The vector had two selectable markers; aadA gene that confers resistance to aminoglycosides spectinomycin and streptomycin in E. coli and a bar gene (hpt) that induces resistance against BASTA (Table 2).

The bar gene, under the control of maize ubiquitin promoter, makes this vector a reliable candidate to be used in further studies for screening of putative transgenic wheat plants residing pSB219. TaDof1 construct comprised of 1,602 bp which include CaMV35S promoter (having 99% identity to NCBI accession number AB863158.1), synthetic TaDof1, the stop codon and the Nos terminator (Fig. 1, Table 2). The insert was cloned between left and right T-DNA borders of pSB219. The cassette was cloned using HindIII, AscI, Eco8I1 and SdaI in the multiple cloning site (MCS) of pSB219. The physical map of MCS is shown in Fig. 2. For each fragment, specific primers with appropriate restriction sites were designed and used. The restriction sites were added to primers in order to obtain directional cloning. For CaMV35S promoter, HindIII and AscI sites were added; for TaDof1 gene, AscI and Eco81I sites were added and for Nos terminator, Eco81I and SdaI sites were added to the primers.

In order to create sticky ends compatible with vector sticky ends, each PCR amplified fragment and vector were cut with the same restriction enzymes. Firstly, HindIII and AscI were used to digest promoter and vector, secondly, AscI and Eco81I were employed to cut gene and vector followed by using Eco81I and SdaI to digest terminator and vector. The digestion of each fragment with respective enzymes created sticky ends having 5'end overhangs. For successful cloning of Dof1 gene in a plant vector, Kurai et al. (2011) added BglII and EcoRI restriction sites to forward and reverse primers of Dof1 gene. An effector plasmid was constructed in which PstI-HincII insert of Dof1 cDNA was cloned in plant expression vector (Yanagisawa, 2000). In another study by Yanagisawa and Sheen (1998), NcoI-PstI insert of Dof1 was cloned in a plant expression vector between 35SC4PPDK promoter and Nos terminator. In our experiment, the digested products were ligated using ligation enzyme.

DNA ligase enzyme is used to ligate the insert DNA into plasmid vector (An et al., 2010). Different parameters affect ligation reaction which include ratio of DNA insert and plasmid vector, temperature and components of buffer (Costa and Weiner, 1994). In the current investigation, the ligation reaction was set under optimum conditions using T4 DNA ligase enzyme. The cloning of each fragment in pSB219 was confirmed by restriction digestion analysis (Fig. 3). In addition to these molecular detection methods, sequence analyses of the positive colonies were also performed. The sequence analyses confirmed that full-length error free genes were cloned in monocot expression vector (Fig. 5). Previously, a linear gene cassette (35S-phytase gene-nos) having T-DNA borders was introduced in a plant transformation vector (Gao et al., 2007).

The ligated product was transformed in E. coli DH10[alpha] competent cells. Abid et al. (2017) transformed E. coli with a monocot expression vector in which phytase gene cassette was cloned. After transformation, screening of transformed colonies was done by PCR amplification of CaMV35S promoter, TaDof1 and Nos terminator.

Agrobacterium tumefaciens transformation: A. tumefaciens (strain AGL1) was employed to transform the confirmed recombinant vector using electroporation method. Electroporation involves the use of high voltage current to open pores found in the cell membrane. As a result, proteins, nucleic acids and membrane-impermeable molecules easily enter the cells. To make the cell membrane permeable, the electric pulses must be strong but not so intense that result in cell death (Yang et al., 2011). The results of electroporation vary according to the size and type of cells, size of plasmid and temperature. In the current study, a high voltage of 2.4 kV was used because the size of the vector pSB219 was large. In a study, a strong influence of increasing pulse number on electroporation was observed in Agrobacterium-mediated transformation (Mahmood et al., 2008). Wheat embryogenic calli were infected with A. tumefaciens (AGL1 strain) harboring plasmid with the gene of interest (Habib et al., 2014).

In the current investigation, the plasmid with complete TaDof1 cassette and the helper plasmid pAL154 were co-transformed in AGL1 strain (A. tumefaciens). Marker-free transgenic wheat developed by Agrobacterium-mediated transformation harbored the helper plasmid pAL154 (Wang et al., 2016). The plasmid pAL154 facilitates transformation as it contains Komari fragment. The results were verified by colony PCR using gene junction primers (Table 1). PCR amplification results using gene junction primers are shown in Fig. 4. The transformed A. tumefaciens can be used to express the transgene in elite wheat cultivars in future studies.

Acknowledgments: The project was supported by Agricultural Linkages Programme (ALP) under Pakistan Agricultural Research Council (PARC), Pakistan. Project Identification No. CS-313.

Authors' contributions: The experiment was executed by Ammarah Hasnain and planned/designed by Asma Maqbool. The data were analyzed by Kauser A. Malik.

REFERENCES

Abid, N., A. Khatoon, A. Maqbool, M. Irfan, A. Bashir, I. Asif, M. Shahid, A. Saeed, H. Brinch-Pedersen, and K. A. Malik (2017). Transgenic expression of phytase in wheat endosperm increases bioavailability of iron and zinc in grains. Transgenic. Res. 26(1): 109-122.

An, Y., A. Lv, and W. Wu (2010). A quikchange-like method to realize efficient blunt-ended DNA directional cloning and site-directed mutagenesis simultaneously. Biochem. Biophys. Res. Commun. 397(2): 136-9.

Conze, T., A. Shetye, Y. Tanaka, J. Gu, C. Larsson, J. Goransson, G. Tavoosidana, O. Soderberg, M. Nilsson, and U. Landegren (2009). Analysis of genes, transcripts, and proteins via DNA ligation. Annu. Rev. Anal. Chem. (Palo Alto Calif) 2: 215-39.

Coruzzi, G. M., and L. Zhou (2001). Carbon and nitrogen sensing and signaling in plants: emerging 'matrix effects'. Curr. Opin. Plant Biol. 4(3): 247-253.

Costa, G. L., and M. P. Weiner (1994). Protocols for cloning and analysis of blunt-ended PCR-generated DNA fragments. PCR Methods Appl. 3(5): S95-106.

Dafny-Yelin, M., and T. Tzfira (2007). Delivery of multiple transgenes to plant cells. Plant Physiol. 145 (4): 1118-28.

Gao, X.R., G. K. Wang, Q. Su, Y. Wang, L. J. An (2007). Phytase expression in transgenic soya beans: stable transformation with a vector-less construct. Biotechnol. Lett. 29 (11): 1781-1787.

Habib, I., M. Rauf, J. Qureshi, M. Ahmed, S. Mansoor, N.A. Saeed (2014). Optimization of somatic embryogenesis and Agrobacterium-mediated transformation of elite wheat (Triticum aestivum L.) cultivars of Pakistan. Int. J. Agric. Biol. 16: 1098-1104.

Kumar, R., R. Taware, V.S. Gaur, S.K. Guru, and A. Kumar (2009). Inuence of nitrogen on the expression of TaDof1 transcription factor in wheat and its relationship with photosynthetic and ammonium assimilating efciency. Mol.Biol. Rep. 36:2209-2220.

Kurai, T., M. Wakayama, T. Abiko, S. Yanagisawa, N. Aoki, and R. Ohsugi (2011). Introduction of the Zmdof1 gene into rice enhances carbon and nitrogen assimilation under low-nitrogen conditions. Plant Biotechnol. J. 9 (8): 826-37.

Lipp, M., P. Brodmann, K. Pietsch, J. Pauwels, E. Anklam, T. Borchers, G. Braunschweiger, U. Busch, E. Eklund, F. D. Eriksen, J. Fagan, A. Fellinger, H. Gaugitsch, D. Hayes, C. Hertel, H. Hortner, P. Joudrier, L. Kruse, R. Meyer, M. Miraglia, W. Muller, P. Phillipp, B. Popping, R. Rentsch, and A. Wurtz (1999). IUPAC collaborative Trial Study of a method to detect genetically modified soy beans and maize in dried powder. J. AOAC Int. 82 (4): 923-8.

Mahmood, T., T. Zar, and S. Naqvi (2008). Multiple pulses improve electroporation efficiency in Agrobacterium tumefaciens. Electron. J. Biotechnol. North America. 1115 (01).

Nosengo, N. (2003). Fertilized to death. Nature. 425 (6961): 894-5.

Seternes, T., T.C. Tonheim, A.I. Myhr, and R.A. Dalmo (2016). A plant 35S CaMV promoter induces long-term expression of luciferase in Atlantic salmon. Sci. Rep. 6:25096.

Sparks, C. A., A. Doherty, and H. D. Jones (2014). Genetic transformation of wheat via Agrobacterium-mediated DNA delivery. Methods Mol. Biol.1099: 235-50.

Sparks, C. A., and H. D. Jones (2014). Genetic transformation of wheat via particle bombardment. Methods Mol. Biol.1099: 201-18.

Tulpova, Z., M. C. Luo, H. Toegelova, P. Visendi, S. Hayashi, P. Vojta, E. Paux, A. Kilian, M. Abrouk, J. Bartos, M. Hajduch, J. Batley, D. Edwards, J. Dolezel, and H. Simkova (2018). Integrated physical map of bread wheat chromosome arm 7ds to facilitate gene cloning and comparative studies. N. Biotechnol.

Upcroft, P., and A. Healey (1987). Rapid and efficient method for cloning of blunt-ended DNA fragments. Gene. 51(1): 69-75.

Vitousek, P. M., R. Naylor, T. Crews, M.B. David, L.E. Drinkwater, E. Holland, P.J. Johnes, J. Katzenberger, L.A. Martinelli, and P.A. Matson (2009). Nutrient imbalances in agricultural development. Science. 324 (5934): 1519.

Wang, G.P., X.D. Yu, Y.W. Sun, H.D. Jones, and L.Q. Xia (2016). Generation of marker-and/or backbone-free transgenic wheat plants via Agrobacterium-mediated transformation. Front Plant Sci. 7 (1324).

Wu, H., A. Doherty, and H. D. Jones(2008). Efficient and rapid Agrobacterium-mediated genetic transformation of durum wheat (Triticum turgidum L. var. durum) using additional virulence genes. Transgenic Res. 17 (3): 425-36.

Wuebbles, D. J. (2009). Nitrous oxide: no laughing matter. Science. 326 (5949): 56-57.

Yanagisawa, S. (2000). Dof1 and Dof2 transcription factors are associated with expression of multiple genes involved in carbon metabolism in maize. Plant J. 21(3): 281-8.

Yanagisawa, S., A. Akiyama, H. Kisaka, H. Uchimiya, and T. Miwa (2004). Metabolic engineering with Dof1 transcription factor in plants: Improved nitrogen assimilation and growth under low-nitrogen conditions. Proc. Natl. Acad. Sci. USA 101 (20): 7833-8.

Yanagisawa, S., and J. Sheen (1998). Involvement of maize Dof zinc finger proteins in tissue-specific and light-regulated gene expression. Plant Cell. 10 (1): 75-89.

Yang, L., Q. Yang, K. Sun, Y. Tian, and H. Li (2011). Agrobacterium tumefaciens mediated transformation of Chiv gene to Trichoderma harzianum. Appl. Biochem. Biotechnol. 163 (8): 937-45.

Zhou, M. Y., S. E. Clark, and C. E. Gomez-Sanchez (1995). Universal cloning method by TA strategy. Biotechniques. 19 (1): 34-5.
COPYRIGHT 2018 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of Animal and Plant Sciences
Date:Dec 31, 2018
Words:3732
Previous Article:ASSOCIATION MAPPING OF QUALITY TRAITS WITH SSR MARKERS IN TALL FESCUE (FESTUCA ARUNDINACEA SCHREB.).
Next Article:QSY-3 CONTROLS MULTIPLE MORPHOLOGY, PHENOLOGY AND GRAIN YIELD TRAITS IN RICE (ORYZA SATIVA L.) UNDER SALINITY STRESS.

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |