Printer Friendly

A Novel Hydroxymethyldihydropterin Pyrophosphokinase-dihydropteroate Synthase (HPPK-DHPS) Gene from a Nutraceutical Plant Seabuckthorn, Involved in Folate Pathway is Predominantly Expressed in Fruit Tissue.

Byline: Shazia Arif, M. Ramzan Khan, Syed Dilnawaz Ahmed Gardezi, Zaheer Abbas and Ghulam Muhammad Ali

Abstract

Seabuckthorn (Hippophae rhamnoides L.) is a hardy fruit-producing plant. With medicinal and nutraceutical properties, its fruits, seeds and leaves are enriched with astonishing array of nutrients. Especially, its bark contains vitamins, essential oils and minerals, for which most of the staple crops are deficient. This study was envisaged to isolate the folate pathway HPPK- DHPS ortholog from seabuckthorn. The target gene Hydroxymethyldihydropterin pyrophosphokinase-dihydropteroate synthase linked in the pathway of folate biosynthesis was successfully isolated and cloned. The sequences analysis revealed that this novel genomic locus is 2354 bp in size. The coding region is interrupted by a single large intron. The coding sequence is 1539 bp long which is similar to its ortholog in tomato. The newly isolated gene has prominent nucleotide mutations randomly distributed over the entire length of the sequence. Mutations are only of substitution type, and no deletions or insertions are detectable.

All the mutations were of non-synonymous type. Expression profile of HrHPPK-DHPS with semi- quantitative RT-PCR revealed the higher accumulation of transcripts in leaf and fruits tissues. Phylogenetic reconstruction revealed gene duplication in soybean and Arabidopsis orthologs. A considerable conservation in 3-dimensional structure of folate protein HPPK-DHPS was observed; however, notable differences in substrate binding pockets were also visible. Hence, HrHPPK-DHPS is a novel ortholog isolated from medicinal plant seabuckthorn.

Keywords: Folate; HPPK-DHPS; Seabuckthorn; Gene expression; Biofortification

Introduction

Seabuckthorn (Hippophae rhamnoides L.) is a hardy fruit producing plant of the family Elaeganaceae, naturally distributed in Asia and Europe. The fruit of seabuckthorn is the store house of vitamins and other important bioactive substances (Xurong et al., 2001). Seabuckthorn berries contain appreciable levels of vitamin B1, P and K (Lu, 1992) and folate vitamers (Gutzeit et al., 2008). Micronutrient deficiency is preventing an estimated one third of the world population from reaching their physical and intellectual potentials.

Folate or folic acid, a water-soluble vitamin B is identified as advantageous to human health. Seabuckthorn fruit is considered as high source of folate found in the range of 29 ug/100 g fresh weight (Marcus, 2005; Virendra, 2006). It has been reported previously that total folate contents in seabuckthorn berries is found in the range of about 39 ug/100 g, and 5-methyltetrohydrofolate was illustrated as the principal folate vitamers found in seabuckthorn berry. Tracings of tetrahydrofolate were noticed, although distantly lower than the detecting point (Stralsjo et al., 2003). Total folate substances of seabuckthorn fruit berries and juice analyzed ranged from 29 up to 81 ug/100 g. Comparing seabuckthorn folate contents with other berries, reveals that the maximum folate contents of 96 ug/100 g are investigated amongst these berries (Stralsjo et al., 2003; Gutzeit et al., 2008).

Folate is a B-group vitamin critical for normal cellular function and division. Its deficiency in humans leads to a number of serious diseases, most notably anemia and neural tube defects in newborns (Lucock, 2000), and mental disorders such as psychiatric syndromes, and decreased cognitive performance among the elders (Calvaresi and Bryan, 2001; Hultberg et al., 2001). In addition, higher risk of cardio -vascular diseases seems to correlate with high Hcy levels in blood (Quinlivan et al., 2002) caused by the inefficient re-methylation of Hcy upon folate deficiency (Stover, 2004). Increased plasma-Hcy content may also be a risk factor for different forms of dementia including Alzheimer's disease (Seshadri et al., 2002).

There are a number of genes coding for vitamins particularly folate in this nutraceautical plant. The plant bi-functional HPPK-DHPS is an important enzyme in the folate biosynthetic pathway. Tetrahydrofolate and its one-carbon derivatives, collectively termed folates, are essential cofactors for one-carbon transfer reactions in the biosynthesis of certain amino acids, pantothenate, purines, and thymidylate (Hanson et al., 2000; Ravanel et al., 2004). During organ differentiation, folate is synthesized-preferentially in highly dividing tissues and in photosynthetic leaves. This is associated with high levels of the HPPK-DHPS protein and a pool of folate, 3- to 5-fold higher than in the rest of the plant.

In plant HPPK-DHPS, the DHPS reaction is feedback inhibited by dihydropteroate dihydrofolate and THF-Glu suggesting that this domain could be a potential regulatory point of the mitochondrial branch of folate pathway (Mouillon et al., 2002). Arabidopsis is unique among higher plants with sequenced genome in having two genes coding for HPPK-DHPS (Storozhenko et al., 2007). The first one encodes the mitochondrial isoform involved in de novo synthesis of THF, and the second is highly expressed in developing seeds and encodes a cytosolic enzyme whose function remains to be established. The third mitochondrial step is the ATP dependent attachment of glumate to the carboxyl moiety of pABA to form dihydrofolate. It is catalyzed by a mono-functional dihydrofolate synthase (Ravanel et al., 2001).

Seabuckthorn has a great nutraceautical potential for genetic improvement of cereal crops through genetic engineering, hitherto little efforts has been made in isolating folate genes from this plant. But before this application it is important to isolate and analyze these genes and to study their expression patterns using molecular techniques. Therefore we isolated and clone HPPK-DHPS gene, to analyze the sequence of this gene using bioinformatics tools, to study the expression patterns of this genes in various tissues at different developmental stages and comparative homology modeling for deciphering the 3D structure of HPPK-DHPS protein.

Materials and Methods

Seabuckthorn (Hippophae rhamnoides ssp. Sinensis) plants were grown in glass house and the fields of National Institute for Genomics and Advanced Biotechnology, National Agricultural Research Centre, Islamabad Pakistan. For nucleic acid extraction, leaf, berry, bud and seed samples were harvested from plants at different bud, leaf, fruit and seed development stages. Fruit was harvested once or twice a week during the ripening period from seabuckthorn nursery, frozen in liquid nitrogen and stored at -80C until processed for nucleic acid extraction and expression analysis.

Designing of Primers

Nucleotide sequences of HPPK-DHPS genes were retrieved from National Center for Biotechnology Information (NCBI) database. A pair of gene specific primers designed from the conserved region of HPPK-DHPS for the amplification of full length coding region of HrHPPK- DHPS gene. Primers for expression analysis through RT- PCR were designed from newly isolated sequence of HrHPPK-DHPS gene. The sequences of the primers used in the study are listed in Table 1.

DNA Extraction

Advancements in functional genomics has revealed that there is positive correlation between number of introns found and gene expression, furthermore, introns containing transgenes showed enhancements of gene expression than the same gene lacking introns (Brinster et al., 1988). Therefore we set out to isolate the HrHPPK-DHPS gene from DNA instead of cDNA. Genomic DNA was isolated from the leaf samples of seabuckthorn using a standard CTAB protocol (Doyle and Doyle, 1987).

PCR Amplification and Molecular Cloning

Diluted DNA was used as template for standard PCR amplification for HrHPPK-DHPS gene amplification using the Takara Ex Taq(tm) polymerase (Cat# RR001). PCR amplification was performed in a total reaction volume of 50 uL using the gene specific primers with initial denaturation step of 94C for 3 min, amplification with 35 cycles of 94C for 60s, annealing at 57C for 75s, elongation at 72C for 145s, followed by final extension at 72C for 10 min. The amplified product of HPPK-DHPS was gel purified using the Gene JET(tm) Gel extraction kit (Thermo Fisher Scientific USA) and cloned into the pTZ57R/T vector (Fermentas USA) for sequencing from MACROGEN (Korea).

Total RNA Isolation and Gene expression Analysis

Total RNA from different tissues of seabuckthorn was extracted using the TRIZOL(r) Reagent (Invitrogen USA). It was quantified with Thermo Scientific's NanoDropTM Lite (USA). Quality of extracted RNA was assessed on 1.5% agarose gel. The first strand cDNA was synthesized using AMV-RT reverse transcriptase (Fermentas USA #EP0641). Multiplex semi-quantitative RT-PCR was carried out to discern the differential expression patterns of newly isolated HrHPPK-DHPS gene transcripts in leaf, fruit bud and seed of seabuckthorn (Khan et al., 2013). The 18SrRNA gene was used as an internal control. The reaction was repeated thrice for both the biological as well as technical replicates. The amplified products were resolved on 2% agarose gel and photographed.

Sequence Analysis and Phylogenetic Reconstruction

The new gene sequence was edited using Mac Vector(tm) 7.2.3 software (Accerlrys Inc.) gcg/Wisconsin Package, university of Wisconsin USA). After the sequences were retrieved for each gene family, the sequences and phylogenetic analyses were performed using Mac Vector version 7.2.3, and MEGA 5 (Kumar et al., 2008). Clustal W (Thompson et al., 1994) in Mac Vector 7.2 was used as a multiple alignment tool for aligning the amino acids. The nucleotide sequences were translated in the Mac Vector program. The default parameters were used. Sequences too diverged disturbing the alignments were removed manually while performing the multiple alignment procedure. Using the alignment file phylogenetic tree was constructed using the Neighbor Joining method (Saitou and Nei, 1987; Russo et al., 1996) implemented in MEGA5. The complete deletion option was used to exclude any site which postulated a gap in the sequence.

As amino acid substitution models, uncorrected proportion (p) of amino acid differences and distance were used. The bootstrap method (Felsenstein, 1985) was used to test the authenticity of the generated tree topologies. The calculation at 1000 pseudo replicates gave the bootstrap probability of each interior branch in the tree.

Table 1: Detail of primers used for Hr-HPPK-DHPS gene amplification and expression studies

Gene###Primer name###Primer sequence (5'-3')###Application

HPPK-DHPS###HPPK-F###ATGAATGTCTTCAGGCGTTTTCTGCCC###Cloning

HPPK-DHPS###HPPK-R.###TTAACTGTTTTGTCTCTGTTTTCTTT###Cloning

HPPK-DHPS###HPPK-F###ATGTCTGCCTTGTGTATCTA###Expression analysis

HPPK-DHPS###HPPK-R###TTATACATCCATCAAGATTC###Expression analysis

18sRNA###18s RNA-F###GTAACCCGTTGAACCCCATT###Internal control

18sRNA###18s RNA-R###CCATCCAATCGGTAGTAGCG###Internal control

M13###M13 Seq -F###GTAAAACGACGGCCAGTG###Colony PCR and plasmid PCR

M13###M13 Seq- R###GGAAACAGCTATGACCATG###Colony PCR and plasmid PCR

Homology Modeling and Protein Structure Prediction

The three dimensional (3D) structural modeling of folate protein (HrHPPK-DHPS) was performed by MODELLAR 9V10 homology modeling program. The amino acid sequence of HrHPPK-DHPS (512aa) retrieved in FASTA format was subjected to protein-protein blast (Blastp) search against the protein data bank (PDB) to identify a appropriate template structure for comparative modeling. The 2BMB_A was preferred as a proper template with query sequence having 33% identity, 89% query coverage and E-value of 7e-70. The modeler quality was assessed based on sequence alignment by Blast and template structure used. The structure was predicted by MODELLAR with alpha helices and beta-pleated sheets visualized by Chimera 1.6.

Results

A New HPPK-DHPS Sequence Identified from Seabuckthorn

In order to isolate HPPK-DHPS ortholog, gene specific primers were used to amplify dihydropterin gene fragment using genomic DNA as template. A full length 2354 bp target genomic fragment was amplified. The distinct high molecular weight band of HPPK-DHPS observed on agarose gel (Fig. 1) was purified, cloned and sequenced.

The newly isolated sequence was edited using Mac Vector(tm) 7.2.3, software (Accerlrys Inc.) gcg/Wisconsin Package university of Wisconsin USA). Blast results exhibited maximum hits with HPPK-DHPS gene of S. lycopersicom followed by P. sativum, M. truncatula, C. arietinum, G. max, A. thaliana, A. lyrata, T. aestivum, B. distachyo and O. sativa, thereby confirming the presence of new sequence of HPPK-DHPS gene in seabuckthorn. All positions of codon containing gaps and missing data were eliminated. The length of the sequenced clone was 2.3 kb due to the presence of a single large intron. The 1539 bp coding sequence was extracted and found to be exactly equal in length to tomato gene that codes for 513aa. Thus, HrHPPK-DHPS gene sequence revealed no variation in the length of the nucleotide sequence. Clustal W multiple alignments of HPPK-DHPS gene with the original gene sequence were generated and considerable variability was observed in the sequence of this novel gene.

A total of 35 nucleotide mutations were detectable in the final dataset. Mutations in the sequence were only of substitution type, and no deletion and insertion were found. The mutations found were randomly distributed in the entire sequence without specific domain and as these mutations resulted in changes in the protein structure (non-synonymous mutations). The amino acid sequence deduced from the nucleotide sequence indicates that the product of translation is a precursor of about 512 amino acid residues. The sequence identity was 97% at amino acid level. HPPK- DHPS protein sequences were retrieved from NCBI protein database of different species. Multiple sequence alignment has shown the high sequence similarity of HrHPPK-DHPS translated amino acid sequence with different proteins from number of plant species including tomato, Arabidopsis, soybean and wheat. Sequence similarities and difference among selected protein homologue sequences are shown in Fig. 2.

Phylogenetic Relationship of Seabuckthorn HPPK- DHPS Gene with other Plants Species

In order to probe the evolutionary relationship between newly isolated sequence and those in the database, phylogenetic reconstruction was carried out. For this purpose the coding sequences of HPPK-DHPS homologue from different plant species such as S. lycopersicum, T. aestivum B. distachyon, C. arietinum, O. sativa, A. thaliana, P. sativum, M. truncatula, G. max and A. lyrata were employed. A neighbour-joining tree in Fig. 3 demonstrates that sequences are clearly differentiated into different clades. Four groups comprising brassicaeceous HPPK- DHPS, cereals, pea family and tomato as a member of Solanaceae are observed. The un-rooted tree clearly separates out HPPK-DHPS of seabuckthorn and establishes its relationship with tomato. This indicates divergence in sequences. Interestingly two gene duplication events were observed. A. thaliana and G. max showed two sequences of HPPK-DHPS on different chromosomes; therefore this is gene duplication as species are diploid.

This is very interesting finding as duplications are important for evolutionary natural selection. The monocots i.e. T. aestivum, B. distachyon, O. sativa, seems to be the progenitors as present at the base. Higher bootstrap values are indicative of increased reliability of the tree. These results demonstrated that HPPK-DHPS genes are well differentiated in different clusters. The newly isolated HrHPPK-DHPS sequence though shows clustering with tomato genes, however, divergence do exist.

The comparison of cumulative data from cDNA sequence, amino acid sequence, phylogenetic reconstruction and expression pattern demonstrated that there is a considerable variability in the gene structure and evolutionary relationship of HrHPPK-DHPS with other homologs. To what extent mutations in HrHPPK-DHPS contribute to functional divergence, characterization through site-directed mutagenesis and transformation is necessary. But before transformation, it is paramount to do the expression analysis of HrHPPK-DHPS in different tissues of the seabuckthorn.

HPPK-DHPS is Differentially Expressed in Seabuckthorn Tissues

The relative abundance of the total RNA coding for Vector(tm) 7.2.3. (Accerlrys Inc.) gcg/Wisconsin pakage university of Wisconsin) from seabuckthorn and its ortholog from S. lycopersicum, G. max, A. thaliana and T. aestivum. Amino acids in blocks highlight similarity.

HrHPPK-DHPS was estimated by quantitative RT-PCR. In order to discern the expression patterns of HPPK-DHPS gene in different tissues of seabuckthorn, total RNA from four different tissues like leaf, fruit bud and seed were extracted. Normalization was done using constitutive expression 18SrRNA gene. cDNA was synthesized from equal amount of total RNA. The transcript signals of HrHPPK-DHPS were strongly detectable in the fruit and leaf tissues (Fig. 4) and RNA signals barely detectable in fruit bud. Nevertheless, weak expression of this gene was found in seed. Hence, differences in expression patterns in different tissues are quite obvious and HrHPPK-DHPS gene is strongly expressed in metabolically active part of the plant tissues.

Tertiary Structure of Folate Protein

The 3D structure of selected original Saccharomyces cerevisiae gene templates (Lawrence et al., 2005) were used as starting point for homology modeling (Fig. 5A). Modeled tertiary protein structure of different plant species including seabuckthorn HPPK-DHPS (B), S. lycopersicum (C), A. thaliana (D), G. max (E) and T. aestivum (F) were compared and shown in Fig. 5, respectively. The domain architecture consisting of Pterin domain from 230-498 residues and HPPK domain from 47-172 amino acid residues was evaluated using the Chimera program for seabuckthorn protein. HPPK is the upstream and the adjacent enzyme to DHPS in the folate biosynthetic pathway. All the 3D structures of 5 different protein fold classes ranged in size from 512-561 amino acid residues. The ~ 250-residue pterin-binding (DHPS) domains were found to have (beta/alpha) 8 barrel fold, which adopted shape of a distorted cylinder. It has eight alpha-helices gathered around the outside of an inner cylinder of parallel beta-strands.

It is partially buried within the (beta/alpha) 8 barrel. The pterin binding residues are highly conserved among five species. The 3D structure of the target protein was also searched from protein data bank (PDB) but no 3D structure of folate protein from plant has been reported to date. The 3-dimentional structure can better predict the function of the protein. The work revealed the significant structural variation in petering binding domain among the various orthologus proteins. We detect a slight but noticeable difference with respect to the substrate binding pockets opening that might be responsible for structure and function of this protein.

Discussion

Seabuckthorn is a super vitamin rich in antioxidants wild plant. Its berries contain a large variety of substances which possess a strong biological activity. Since inadequate folate intake is a worldwide problem in human nutrition, hence, raising folate levels in grain is a target for metabolic engineering (Scott et al., 2000; Bouis, 2002). To solve the problem of micronutrient deficiency, the fortification of staple food has proven to be very efficient for certain micronutrients. A practicable approach is genetic engineering to create a cereal crop plant producing higher levels of folate. In this scenario, availability of complete plant genomes, the growing number of ESTs, and the advances made in HPLC analysis of folates hold great promise (Hanson and Gregory, 2002).

The isolation and cloning of a single gene (HPPK- DHPS) in folate biosynthesis pathway was successfully carried out for the first time from seabuckthorn in this study. A full length fragment of HPPK-DHPS gene containing large single intron was obtained using standard PCR amplification. The HPPK-DHPS gene has already been cloned from several plants including Arabidopsis, other dicots and monocots. As there were no deletions and insertions in the extracted coding sequence, the size of newly isolated sequence remained conserved. The length of coding sequence was restricted to 1539 bp for this gene. The amino acid sequence deduced from the nucleotide sequence indicates that the product of translation is a precursor of about 512 amino acid residues. The homology analysis using Clustal W alignments showed that HrHPPK-DHPS sequence was 97% identical to sequence of S. lycopersicom cultivar (SlHPPK-DHPS). The HrHPPK-DHPS fragment cloned in this study contained a large single intron.

This will be further cloned in expression vector for maximum expression in transgenic plant. It is well established that introns results in increased stability and expression of genes (Buchman and Berg, 1988; Okkema et al., 1993). Introns can significantly affect gene expression in plants and many other eukaryotes in a variety of ways. Some introns contain enhancer elements or alternative promoters, while many others elevate mRNA accumulation by a different process.

It is obvious from expression study that there was a remarkable difference in the accumulation pattern of HPPK- DHPS between different stages of development. The expression was not detectable in bud while its accumulation gradually lowered in seed but in the fruit and leaf tissues transcript expression was rather similar and considerably higher than other tissues. Expression of HPPK-DHPS gene in tomato, Arabidopsis and pea in dissimilar tissues and at different developmental stages has been reported (Fabrice et al., 1997).

The proteins involved in the folate synthesis are different from one species to another. The phylogenetic analysis differentiated the HPPK-DHPS genes from different species into 4 different groups. HPPK-DHPS from seabuckthorn conglomerated with S. lycopersicum gene. It can be inferred that these two proteins might have the same properties. But functional characterization of these two proteins through ectopic expression or knocking down is required to validate this hypothesis. Nevertheless, the divergence among different species exists due to their clustering. Interestingly duplication of HPPK-DHPS gene in some plants is also observed. This might provide the evolutionary advantage to this family during selection processes.

The evolutionary trajectory of a protein through sequence analysis is constrained by its function. HPPK is the upstream and adjacent enzyme to DHPs in the folate biosynthetic pathway. The polypeptide consist of two structural domains which is its respective mono-functional HPPK and DHPs domains (Sandeep et al., 2012), this allowed us to construct a 3D protein structure of H. rhamnoides by applying homology modeling approach. The rationale behind this method is the observation that proteins with similar sequence usually share the same overall 3D folding patterns. Therefore, experimentally determined protein structures were usually used as templates to predict the confirmation of another protein with a similar amino acid sequence (Havel and Snow, 1991; David, 1997). This work also revealed the significant structural variation in petering binding domain among the various orthologus proteins. We detect a slight but noticeable difference with respect to the substrate binding pockets opening.

There might be a clue about functional attributes regarding 3D structure of different binding proteins that is triggering the function. The eminence of homology model performed through MODELLER and Chimera program depends on the quality of the sequence alignment by Blast and template protein structure used. The structural analysis and figures generated with MODELLER software (Swiss Institute of Bioinformatics Switzerland) were presented in Fig. 5. These structures provide a good foundation for functional analysis of genes.

Based on structural and experimental analysis we posit that there exists a novel HPPK-DHPS gene in seabuckthorn assumed to be recruited in folate synthesis pathway. No deletion or insertions are detectable, however, non- synonymous substitutions are found in the entire sequence. Expression profile of HrHPPK-DHPS with quantitative RT- PCR flaunted the higher accumulation of transcripts in leaf and fruits tissues. Phylogenetic reconstruction revealed that HPPK-DHPS from seabuckthorn is sister to tomato ortholog and there seems to be gene duplication in Arabidopsis and soybean orthologs. In spite of considerable similarities in 3D structures, there exist variations in substrates binding sites that may confer different functions.

Conclusion

The current investigation present evidences for varying expression levels of the bi-functional HPPK-DHPS on the folate status in plants. Based on sequence similarity, clustering and phylogenetic differentiation of genes, it is concluded that HPPK-DHPS isolated from seabuckthorn is a novel gene isolated from this plant. In this study we predicted and compared three dimensional structure of HPPK-DHPS protein, which was not available in plant species. This study has future implications in exploring the potential of wild medicinal plants for genetic improvement of staple food crops through biofortification to meet the folate deficiency in human diet.

Acknowledgment

This research was supported by National Institute for Genomics and Advanced Biotechnology project and partially by ingenuous Ph.D. scholarship as well as six month IRSIP program awarded to SA by Higher Education Commission of Pakistan. We are grateful to Mr. Noman Iftikhar (NIGAB) for help in generating 3-dimensional structure of HrHPPK-DHPS protein and two anonymous reviewers for valuable comments and suggestions.

References

Brinster, R.L., J.M. Allen, R.R. Behringer, R.E. Gelinas and R.D. Palmiter, 1988. Introns increase transcriptional efficiency in transgenic mice. Proc. Natl. Acad. Sci. USA, 85: 836-840

Bouis, H.E., 2002. Plant breeding: a new tool for fighting micronutrient malnutrition. J. Nutr., 132: 491S-494S

Buchman, A.R. and P. Berg, 1988. Comparison of intron-dependent and intron-independent gene expression. Mol. Cell Biol., 8: 4395-4405

Calvaresi, E. and J. Bryan, 2001. B vitamins, cognition, and aging: a review. J. Gerontol. B. Psychol. Sci., 56: 327-339

David, T.J., 1997. Progression in protein structure prediction. Curr. Opin. Str. Biol., 7: 377-387

Doyle, J.J. and J.L. Doyle, 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull., 19: 11-15

Fabrice, R., D. Macherel, J.M. Mouillon, J.R. Garin and D. Roland, 1997. Folate biosynthesis in higher plants: purification and molecular cloning of a bifunctional 6-hydroxymethyl 7, 8- dihydropterin pyrophosphokinase/7, 8-dihydropteroate synthase Localized in mitochondria. EMBO J., 16: 947-957

Felsenstein, J., 1985. Confidence limits on Phylogenies: An approach using the Bootstrap. Evolution, 39: 783-791

Gutzeit, D., S. Monch, G. Jerz, P. Winterhalter and M. Rychlik, 2008. Folate content in seabuckthorn berries and related products (Hippophae rhamnoides L. ssp. rhamnoides): LC-MS/MS determination of folate vitamers stability influenced by processing and storage assessed by stable isotope dilution assay. Anal Bioanal. Chem., 391: 211-219

Hanson, A.D., D.A. Gage and Y. Shachar-Hill, 2000. Plant one carbon metabolism and its engineering. Trends Plant Sci., 5: 206-213

Hanson, A.D. and J.F. Gregory III, 2002. Synthesis and turnover of folates in plants. Curr. Opin. Plant Biol., 5: 244-249

Havel, T.F. and M.E. Snow, 1991. A new method for building protein conformations from sequence alignments with homologous of known structures. J. Mol. Biol., 217: 1-7

Hultberg, B., A. Isaksson, K. Nilsson and L. Gustafson, 2001. Markers for the functional availability of cobalamin/folate and their association with neuropsychiatric symptoms in the elderly. Int. J. Geriatr. Psychiatr., 16: 873-878

Khan, M.R., I. Khan and G.M. Ali, 2013. MPF2-like MADS-box genes affecting SOC1 and MAF1 expression are implicated in flowering time control. Mol. Biotechnol., 54: 25-36

Kumar, S., J. Dudley, M. Nei and K. Tamura, 2008. MEGA: A biologist- centric software for evolutionary analysis of DNA and protein sequences. Brief Bioinform., 9: 299-306

Lawrence, M.C., P. Iliades, R.T. Fernley, J. Berglez, P.A. Pilling and I.G. Macreadie, 2005. The three-dimensional structure of the bifunctional 6- hydroxymethyl-7, 8-dihydropterin pyrophosphokinase/dihydropteroate synthase of Saccharomyces cerevisiae. J. Mol. Biol., 348: 655-670

Lucock, M., 2000. Folic acid: nutritional biochemistry, molecular biology, and role in disease processes. Mol. Genet. Metab., 71: 121-138

Lu, R., 1992. Seabuckthorn-A Multipurpose Plant Ostrobothnia in Finland. COST action 836, Meeting species for fragile mountains, ICIMOD Occasional WG 6 Cane and bush fruits. Institute of Food Paper No. 20. Katmandu, Nepal, 62p. Chemistry and Technology, Graz, Austria, p: 19

Marcus, C.C.W.E., 2005. Seabuckthorn - Hippophae rhamnoides L. A Whole Food Answer to Better Nutrition. riyasilver.trdinfotech.com/seabuckthorn.htm.

Mouillon, J.M., S. Ravanel, R. Douce and F. Rebeille, 2002. Folate synthesis in higher plant mitochondria: coupling between the dihydropterin pyrophosphokinase and the the dihydropteroate synthase activities. Biochem. J., 363: 313-319

Okkema, P.G., S.W. Harrison, V. Plunger, A. Aryana and A. Fire, 1993. Sequence requirements for myosin gene expression and regulation in Caenorhabditis elegans. Genetics, 135: 385-404

Quinlivan, E.P., J. McPartlin, H. McNulty, M. Ward, J.J. Strain, D.G. Weir and J.M. Scott, 2002. Importance of both folic acid and vitamin B12 in reduction of risk of vascular disease. Lancet, 359: 227-228

Ravanel, S., H. Cherest, S. Jabrin, D. Grunwald, Y. Surdin-Kerjan, R. Douce and F. Rebeille, 2001. Tetrahydrofolate biosynthesis in plants; molecular and functional characterization of dihydrofolate synthetase and three isoforms of folylpolyglutamate synthetase in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA, 98: 15360-15365

Ravanel, S., R. Douce and F. Rebeille, 2004. The uniqueness of tetrahydrofolate synthesis and one-carbon metabolism in plants. Advances in Photosynthesis and Respiration. In: Plant Mitochondria: From Genome to Function, Vol. 17, pp: 277-292. Day D.A., Millar H. and Whelan J. (eds.) Great Britain: Kluwer, The Netherlands

Russo, C.A.M., N. Takezaki and M. Nei, 1996. Efficiencies of different genes and tree-building methods in recovering a known vertebrate phylogeny. Mol. Biol. Evol., 13: 525-536

Saitou, N. and M. Nei, 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4: 406-425

Sandeep, C., D. Olan, M.C. Brett, N. Janet, S.S. Jamie, G.M. Ian, F. Ross, S.P. Thomas and D.S. James, 2012. Structure of S. aureus HPPK and the Discovery of a New Substrate Site Inhibitor Inhibitor. PLoS ONE., 7: e29444

Scott, J.M., F. Rbeill and J. Fletcher, 2000. Folic acid and folates the feasibility of nutritional enhancement in plant foods. J. Sci. Food Agric., 80: 795-824

Seshadri, S., A. Beiser, J. Selhub, P.F. Jacques, I.H. Rosenberg, R.B. D'Agostino, P.W. Wilson and P.A. Wolf, 2002. Plasma homocysteine as a risk factor for dementia and Alzheimer's disease. N. Engl. J. Med., 346: 476-483

Stralsjo, L., H. Ahlin, C.M. Witthoft and J. Jastrebova, 2003. Folate determination in Swedish berries by radioprotein-binding assay (RPBA) and high performance liquid chromatography (HPLC). Eur. Food Res. Technol., 216: 264-269

Storozhenko, S., V. De Brouwer, M. Volckaert, O. Navarrete, D. Blancquaert, G.F. Zang, W. Lambert and D. Van der Straeten, 2007a. Folate fortification of rice by metabolic engineering. Nat. Biotech., 25: 1277-1279

Stover, P.J., 2004. Physiology of Folate and Vitamin B12 in Health and Disease. Nutr Rev., 62: S3-12

Thompson, J.D.I., D.G. Higgins and T.J. Gibson, 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22: 4673-4680

Virendra, S., 2006. Seabuckthorn (Hippophae L.) A Multipurpose Wonder Plant Vol. II: Biochemistry and Pharmacology, ISBN: 9788170354154 8170354153

Xurong, T., M. Peter and A. Tigerstedt, 2001. Variation of physical and chemical characters within and elite Seabuckthorn (Hyppophae rhamnoides L.) breeding population. Sci. Hortic., 88: 203-214
COPYRIGHT 2016 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Arif, Shazia; Khan, M. Ramzan; Gardezi, Syed Dilnawaz Ahmed; Abbas, Zaheer; Ali, Ghulam Muhammad
Publication:International Journal of Agriculture and Biology
Article Type:Report
Date:Apr 30, 2016
Words:5082
Previous Article:Promoter Analysis of Cold-responsive (COR) Gene from Capsella bursa-pastoris and Expression Character in Response to Low Temperature.
Next Article:High-efficiency Regeneration of Seedlings from Hypocotyl Explants of Tung Tree (Vernicia fordii).
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters