Printer Friendly

A New Subspecies of a Ciliate Euplotes musicola Isolated from Industrial Effluents.

Byline: Raheela Chaudhry and Abdul Rauf Shakoori

Abstract.- The copper resistant ciliates RE-1 and RE-2 isolated from industrial effluents and tentatively identified on microscopic observation as members of the genus Euplotes were subjected to SS rRNA gene analysis. The nucleotide sequence of the two SS rRNAs from these ciliates were deposited in GenBank under accession numbers DQ917684 and EU103618. Phylogenetic analysis revealed that RE-1 belonging to the muscicola group was most closely related to Euplotes muscicola, while RE-2 belonging to the adiculatus group was most closely related to Euplotes adiculatus, with which they showed the fewest differences in their SS rDNA sequences. The nucleotide sequences of closely related Euplotes spp. were aligned and all the sequences were compared to check the species variations. In the nucleotide sequence of RE-1, fewer variations were observed in the regions 323-516 and 906-1303 when compared with other species of the group.

General mutations are more frequent among the species in both groups of Euplotes as more than 160 general variations were observed among the species of muscicola group, while around 100 general base pair differences were detected in adiculatus group. On the basis of the results of this study as well as microscopic observations new subspecies Euplotes muscicola lahorensis subsp. nov. is being reported.

Key words: Ribotyping of ciliates, copper resistant ciliate, SSrRNA gene.

INTRODUCTION

The ciliate identification is principally based upon morphological and ultrastructural characteristics (Foissner et al., 1999; Finlay and Fenchel, 1999; APHA, 1989; Curds, 1982; Curds et al., 1983). It is often very difficult and complicated to study the composition of the ciliate community of a given environment. Species definition or affiliation of the organisms to a single species may become problematic, especially in the cases of morphological similarity. So to find the middle ground, uncertain and undecided species are lumped together in species complexes e.g. Vorticella convallaria-complex, Vorticella aquadulcis- complex, etc. (Foissner et al., 1992).

The introduction of modern molecular methods based on DNA analysis and fingerprints, especially the methods targeted at ribosomal RNA operon endowed with exact insight into similarity studies of microorganisms. The examples of application of molecular methods for identification of bacteria are numerous, likewise, there are articles which deal with identification of protozoa (Lynn et al., 2000: Regensbogenova et al., 2004). Molecular characters, specifically the sequences of the small (SSrRNA) and large (LSrRNA) subunits of rRNA genes and some protein-coding genes make a new database available, with which phylogenetic hypo- theses that have been primarily based on morpho- logical observations can be tested (Greenwood et al., 1991b; Baroin-Tourancheau et al., 1998; Hirt et al., 1995; Hammerschmidt et al., 1996; Clark, 1997; Bernhard and Schlegel, 1998; Stechmann et al.,1998; Struder-Kypke et al., 2000).

Takeshi et al. (2002) used the sequence of SS rRNA gene as a marker for the identification of vorticellid ciliates. Jerome and Lynn (1996) used a riboprinting strategy for identification of morphologically difficult to differentiate species of the Tetrahymena pyriformis complex. Only in a few cases these techniques have been applied to distinguish species within a genus e.g., Tetrahymena (Nanney et al., 1998; Struder- Kypke et al., 2001) and Paramecium (Struder- Kypke et al., 2000b). SSrRNA have been commonly used to identify ciliate species and to re-evaluate the phylogenetic relationships of many ciliate groups (Ragan et al., 1996; Stoeck et al., 1998)

The cosmopolitan, hypotrich genus Euplotes (Class Spirotrichea, Order Euplotida) is remarkable among ciliates for its species richness (Kusch et al.,2000). Attributable to its abundance, its ubiquitous distribution, and the simplicity of culturing this

Culture maintenance and growth media

The ciliate cultures of RE-1 and RE-2 were maintained in Bold-basal salt medium [NaNO3 (0.25 g/l), CaCl2.H2O (0.025 g/l), MgSO4.7H2O (0.075 g/l), K2HPO4 (0.075 g/l), KH2PO4 (0.175 g/l), NaCl (0.025 g/l), EDTA (0.05 g/l), KOH (0.031 g/l), FeSO4.7H2O (0.04 g/l), H2SO4 (0.001 M), H3BO3 (0.01142 g/l), ZnSO4.7H2O (0.00881 g/l), MnCl2.4H2O (0.00144 g/l), MoO3 (0.00071 g/l), CuSO4.5H2O (0.00157 g/l) and Co(NO3) 2.6H2O (0.00049 g/l)], diluted 1:1000 with distilled water, with 5-7 wheat grains (Shakoori et al., 2004). The pH of the medium was adjusted at 7.3 - 7.6 and kept at room temperature (27+-2degC) in normal day light. The growth of culture was observed daily by counting number of protozoan cells in the medium under light microscope. Every time, readings in triplicate were taken and their means were calculated (Haq et al., 2000). Growth curves were prepared by plotting a graph between time (days) of incubation along the X-axis and number of cells per ml along the Y-axis.

Copper resistance

To study the effect of copper on growth of ciliates, two sets of cultures, control and treated, each of three sterilized 250 ml flasks containing 50 ml of Bold-basal salt medium (pH 7.5) supplemented with 5-7 wheat grains, were inoculated with the culture and incubated at28+-2degC. Copper stress was given by adding CuSO4. 5H2O stock solution (50 mg/ml) in the medium.

In control set, no metal ions were added to the medium. Continuous observation under microscope showed the growth of RE-1 and RE-2.

Isolation and analysis of genomic DNA

High molecular weight genomic DNA was isolated from vegetatively growing cells of RE-1 and RE-2 after starving for 15 h in 10 mM Tris-HCl (pH 7.5) before harvesting at 6741 x g (Eppendorf MiniSpin Plus Personal Microcentrifuge). The cell pellet was re-suspended in 0.5 ml lysis buffer (42% urea, 0.30 M NaCl, 10 mM Tris-HCl (pH 7.5), 10 mM EDTA, 1% SDS), and gently shaken till homogeneity. Genomic DNA was extracted by phenol: chloroform extraction method (Sambrook et al., 1989). The upper aqueous phase was separated and DNA was precipitated with absolute ethanol. The DNA pellet was washed with 500 ul of 75% ethanol, air dried and dissolved in sterile de-ionized H2O. For removal of RNA from genomic DNA 5 ul RNAase (10 mg/ml) was added in the isolated genomic DNA. It was run on 1% agarose gel in TAE buffer and DNA concentration was determined by taking its absorbance at 260 nm and A260/A280 ratio was calculated to check its quality.

Molecular identification of metal resistant ciliates

For molecular identification of the copper resistant ciliates RE-1 and RE-2 either genomic DNA or whole organism was used in the PCR to amplify SS rRNA gene (18 S rDNA).

Primer designing

Different sets of primers were selected and designed for the amplification of SS rRNA gene (Table I).

Table I.- Primers used to clon e and sequence SS rRNA gene of RT-1, RE-1 and RE-2.

Primer Name###Sequence (5' - 3')###Length

(nt)

EukFor###AATATGGTTGATCCTGCCAGT###21

EukRev###TGATCCTTCTGCAGGTTCACCTAC###24

M13 F###GTAAAACGACGGCCAGT###17

M13 R###CAGGAAACAGCTATGAC###17

SS rRNA-4F###YAGAGGTGAAATTCT###15

SS rRNA-5R###GGTGGTGCATGGCCG###15

IntEukFor###GCGAGGAACAATGGGAGGGC###20

IntEukRev###CCKCCTTCAAGATTCAYAATTTC###23

Primers based on conserved regions in eukaryotic 18S rRNA genes (EukFor and EukRev) were the same as described by Regensbogenova et al. (2004). Positively screened clones were sequenced with M13 forward, M13 reverse, one forward and one reverse internal universal 18S primers (Elwood et al., 1985). Subsequently, one forward internal primer (IntEukFor) and one reverse internal primer (IntEukRev) were designed using online web programs such as Primer3 etc. to get the complete sequence of the amplified product.

Amplification of SS rRNA gene For amplification of SS rRNA gene of the two ciliates RE-1 and RE-2, a single or a few protozoa cells of each ciliate culture was picked from in vitro culture under the microscope, washed with sterile water and put into 50 ul of separate reaction mixtures containing 0.5 mM of each deoxynucleoside triphosphate (dNTPs), 100 pmol of each primer, 1X Taq buffer with (NH4)2SO4 - MgCl2 (Fermentas), 2 mM MgCl2 and 0.5 U of Taq DNA polymerase (Fermentas # EP 0402). In another case 350-400 ng of genomic DNA of each ciliate was used in the separate PCR reactions instead of protozoan cell of ciliate culture. Primers based on conserved regions in eukaryotic18S rRNA genes and the reaction conditions described by Regensbogenova et al. (2004) were used with little modification.

An initial denaturation step at 95oC for 5 min was followed by 35 cycles each of 94oC for 1 min, 52oC for 1 min and 72oC for 1 min, and a final extension at 72oC for 10 min in a Gene Amp Thermal Cycler 2720 (Applied Biosystem, Singapore). Quality and quantity of amplified DNA (the nearly complete SS rDNA gene) were determined by electrophoresis in 1.5 % agarose gel (Sambrook and Russell, 2001).

DNA extraction (Gene clean)

PCR products were purified from agarose gel in 1X TAE buffer, using DNA Extraction Kit (Fermentas # K0513) using prescribed protocol.

Ligation into cloning vector

The nearly complete SS rRNA gene obtained (after gene clean) was ligated in pTZ57 R/T cloning vector using Fermentas InsTAcloneTM PCR Cloning Kit (# K 1214) in 3: 1 insert: vector ratio according to the prescribed protocol. Vector pTZ57 R without insert and vector pTZ57 R/T with insert was also incubated with the experimental tubes as positive and negative controls, respectively.

Confirmation of positive clones and sequence analysis

For the confirmation of positive clones (white colonies), plasmid DNA was isolated by miniprep method (Sambrook and Russell, 2001) and subjected to double digestion with EcoR1 (Fermentas #ER0272) and HindIII (Fermentas #ER0501) using Tango Y (2X) buffer. Restricted fragments were analyzed on 1.5 % agarose gel.

For nucleotide sequencing, plasmids of the positive clones were prepared using QIAprep(r) Spin Miniprep Kit. The clones were sequenced in Beckman Coulter CEQ 8000 Automated Genetic Capillary Analyzer. For sequencing initially M13 forward (Fermentas # S0100) and M13 reverse (Fermentas # S0101) sequencing primers were used. Complete sequence of the SS rRNA gene was obtained by sequencing with internal universal SS rRNA primers (Elwood et al., 1985), one oligonucleotide complementary to evolutionary conserved region of the coding strand of eukaryotic SS rRNA genes (SS rRNA-4F; Eukaryotic location 892-906) and the other complementary to evolutionary conserved region of the noncoding strand of ion 1262-1277). Moreover, forward internal primer (IntEukFor) and reverse internal primer (Ineukaryotic SS rRNA genes (SS rRNA-5R, eukaryotic locattEukRev), designed using online Beckman Coulter CEQ 8000 Automated Genetic Capillary Analyzer.

For sequencing initially M13 forward (Fermentas # S0100) and M13 reverse (Fermentas # S0101) sequencing primers were used. Complete sequence of the SS rRNA gene was obtained by sequencing with internal universal SS rRNA primers (Elwood et al., 1985), one oligonucleotide complementary to evolutionary conserved region of the coding strand of eukaryotic SS rRNA genes (SS rRNA-4F; Eukaryotic location 892-906) and the other complementary to evolutionary conserved region of the noncoding strand of ion 1262-1277). Moreover, forward internal primer (IntEukFor) and reverse internal primer (Ineukaryotic SS rRNA genes (SS rRNA-5R, eukaryotic locattEukRev), designed using online

To test the relationships within the genus Euplotes, the two ophryoglenid species Ichthyophthirius multifiliis U17354 (Wright and Lynn, 1995) and Ophryoglena cantenula U17355 (Wright and Lynn, 1995) were chosen as outgroup species.

The phylogenetic tree was constructed using MEGA 3.1 (Kumar et al., 2004). Genetic distances were calculated with the DNADIST program of the PHYLIP package, ver. 3.51c (Felsenstein, 1993) based on the Kimura 2-parameter model (Kimura, 1980). To construct sequence identity matrix CLUSTALX program was used and this matrix showed percentage sequence similarity among SS rRNA gene sequences of different Euplotes species. The alignment was pair-wise, calculated by using an open gap penalty of 100% and unit gap penalty of 0%. Similarity matrix was calculated with a gap penalty of 0% and after discarding unknown bases. The programs FITCH (Fitch-Margoliash least squares method (Fitch and Margoliash, 1967) and NEIGHBOR (neighbor-joining method (Saitou and Nei, 1987) of this package were used to construct distance trees.

Bootstrap analysis was performed using the same software package to test the statistical reliability of the topology of the neighbor- joining tree with 1000 bootstrap resamples of the data.

RESULTS

Microscopic observations

On microscopic observation RE-1 and RE-2 were tentatively identified as member of the genus Euplotes. This genus is characterized by rows of fused larger cilia running along the ventral (bottom) surface. The organisms used these large cilia, that is tufted together to form cirri, to position themselves for feeding and movement. The size of RE-2 is slightly larger than that of RE-1 (Fig. 1). Basic cell shape of RE-1 was ovoid (ellipsoid), while that of RE-2 was slightly elongated and ovoid and both had funnel-shaped buccal cavity. Both cultures were very interesting ciliates with a transparent body. They had a band-like macronucleus (the big backward "C"). From the side, both RE-1 and RE-2, were quite thin and can be seen using their cirri and "walking" along objects e.g. walking on the edge of an air bubble.

Effect of copper on growth of ciliates

Primarily the cultures of both Euplotes RE-1 and RE-2 were maintained in Bold basal salt medium. Growth curves, plotted between time (days) of incubation and number of cells per ml revealed gradual increase in the number of cells in the medium. Both the ciliates, Euplotes RE-1 and RE-2, showed good growth in Bold-basal salt medium (Fig. 2). Euplotes RE-1 attained maximum growth on 5th day in Bold-basal salt medium in which the cell number increased from 0.4 x 103 cells ml-1 at the time of inoculation to 32 x 103 cells ml-1 (80 fold). In contrast, Euplotes RE-2 attained maximum growth on 4th day. In Bold-basal salt medium the increase in cell count was 89.47 fold (from 0.38 x 103 cells ml-1 at the time of inoculation to 34 x 103 cells ml-1 on 4th day). A gradual increase in the number of cells, both in the control and treated cultures is obvious. The lag phase was prolonged in both the ciliate cultures in the copper containing medium (Fig. 2).

In Euplotes RE-1 the maximum growth was attained on 7th day and in RE-2 the maximum growth was achieved on 5th day in the copper treated cultures. The decrease in the cell counts of Euplotes RE-1 and RE-2 in copper containing medium was 2.4 and 2.15 fold, respectively. The reduction in cell population of Euplotes RE-1 was 83.91%, while that of RE-2 was82.84% after eight days of incubation in copper containing media.

Ribotyping

PCR amplification of the small subunit ribosomal (18S) RNA gene from genomic DNA (Fig. 3B) yielded a fragment of approximately 1800

SS rRNA genes of ciliates RE-1 and RE-2 were 1818 bp and 1875 bp long and were deposited in GenBank under Accession numbers DQ917684 and EU103618, respectively. On the basis of BLASTn search results of 1818 bp SS rDNA sequence of RE-1 and 1875 bp sequence of RE-2 proved them to be Euplotes muscicola and Euplotes adiculatus, respectively. These search results also confirmed the initial microscopic identification results.

Phylogenetic analysis

The alignment of nucleotide sequences of closely related Euplotes spp. selected from BLASTn search results was done using CLUSTALW. All the sequences were compared to check the species variations (Tables I and II of supplementary data).

Nucleotide differences between Euplotes spp., after the alignment, are shown in Tables V and VI. In the nucleotide sequence of E. muscicola SBSrc, the one belonging to the muscicola group* of Euplotes sp., fewer variations (general and specific mutations) were observed in the regions 323-516 and 906-1303 when compared with other species of the group (Table I of supplementary data). More base pair differences (general mutations) were observed in the other regions. Most of the points of differences between the SS rRNA sequences of the E. muscicola SBSrc and other members of the group are clustered within two regions: ~ 506-575 and ~ 1464-1457 (using numbers from E. muscicola SBSrc sequence). Seventeen specific mutations were observed, the common ones being T - G/A transversions and T - C transitions. Specific deletion of nucleotides A at position 549, T at position 1487, C at positions 559 and 566 and G at position 1386 was also observed in E. muscicola SBSrc.

There was a deletion of T at position 124 in both E. muscicola and E. muscicola SBSrc. Moreover, A - G transition at position 876 and C - A transversion at position 1391 was also detected which are also the variations of both E. muscicola and E. muscicola SBSrc with other species of the muscicola group.

SS rRNA genes of ciliates RE-1 and RE-2 were 1818 bp and 1875 bp long and were deposited in GenBank under Accession numbers DQ917684 and EU103618, respectively. On the basis of BLASTn search results of 1818 bp SS rDNA sequence of RE-1 and 1875 bp sequence of RE-2 proved them to be Euplotes muscicola and Euplotes adiculatus, respectively. These search results also confirmed the initial microscopic identification results.

Phylogenetic analysis

The alignment of nucleotide sequences of closely related Euplotes spp. selected from BLASTn search results was done using CLUSTALW. All the sequences were compared to check the species variations (Tables I and II of supplementary data).

Nucleotide differences between Euplotes spp., after the alignment, are shown in Tables V and VI. In the nucleotide sequence of E. muscicola SBSrc, the one belonging to the muscicola group* of Euplotes sp., fewer variations (general and specific mutations) were observed in the regions 323-516 and 906-1303 when compared with other species of the group (Table I of supplementary data). More base pair differences (general mutations) were observed in the other regions. Most of the points of differences between the SS rRNA sequences of the E. muscicola SBSrc and other members of the group are clustered within two regions: ~ 506-575 and ~ 1464-1457 (using numbers from E. muscicola SBSrc sequence). Seventeen specific mutations were observed, the common ones being T - G/A transversions and T - C transitions. Specific deletion of nucleotides A at position 549, T at position 1487, C at positions 559 and 566 and G at position 1386 was also observed in E. muscicola SBSrc.

There was a deletion of T at position 124 in both E. muscicola and E. muscicola SBSrc. Moreover, A - G transition at position 876 and C - A transversion at position 1391 was also detected which are also the variations of both E. muscicola and E. muscicola SBSrc with other species of the muscicola group.

Sequences of E. adiculatus and other species of the adiculatus group. Out of these specific variations three were G - A and C - T transitions while seven were the specific transversions viz., A - T, C - A, G - C, G - T, T - A and T - G. No specific deletions and insertions were observed. General mutations are more frequent among the species in both groups of Euplotes as more than 160 general variations were observed among the species of muscicola group while around 100 general base pair differences were detected in adiculatus group.

Comparisons of the two groups of Euplotes sp. (Euplotes muscicola group and Euplotes adiculatus group) SS rRNA sequences discovered that universal or ciliate-specific sequences (regions that are conserved among among all Euplotes sp.) were interspersed among semi-conserved sequences (regions of intermediate conservation) and non-conserved sequences (regions that display very high rates of genetic drift). The semi-conserved sequences are of use for the construction of quantitative molecular phylogenies concerning distantly related organisms whereas the non conserved regions are important for resolving close phylogenetic relationships. Because of not having sequence variation, the highly conserved regions do not give information about sequence divergence; however, they are potentially helpful for rapidly sequencing SS rRNA genes.

DISCUSSION

Heavy metal pollution corresponds to an important environmental problem due to the poisonous and noxious effect of metals; furthermore, their accumulation throughout the food chain leads to serious ecological and health problems. The heavy metals are bio-accumulated in the body of microorganisms and other aquatic plants and animals. The organisms utilize a range of strategies to reduce heavy metal toxicity depending on the nature of heavy metal and the organism under stress. An ample variety of microorganisms such as bacteria, fungi, algae, yeast and protozoa are originated in waters receiving industrial effluents. Their presence indicates their ability to resist the stressful conditions. Among protozoa, ciliates are fine candidates for use as whole cell biosensors to sense the presence and to find out the bio-available concentration of heavy metal ions in the natural samples (Martin-Gonzalez et al., 2006).

Microscopic observation

Microscopic observation revealed the copper resistant ciliates to be the members of genera Euplotes. When these ciliates were exposed to sub- lethal concentration of copper, dense granules appeared in the cytoplasm. Martin-Gonzalez et al. (2006) also reported that when ciliated protozoa were exposed to sub-lethal concentrations of Cd or Zn, the most general and noticeable obvious change was the appearance of very electron-dense granules in the cytoplasm. They reported that initially, these granules or inclusions seemed to form inside electroluscent small vacuoles, but afterward the electron-dense material extended more or less uniformly/ consistently and the original vacuole disappeared. It is expected that these cytoplasmic granules correspond to complexes formed by both metallic cations (Cu2+, Cd2+ and Zn2+) and metallothioneins. At this stage, heavy metals are not bioavailable and thus they are not toxic to cells.

Growth media used

Information about the nutrition of ciliates is imperative to study them (Holz, 1964). In general Protozoa culture grows in salt medium supplemented with organic compounds (Weekers and Vogels, 1994). Both the ciliates Euplotes RE-1 and RE-2 showed good growth on Bold-basal salt medium which supports the fact that ciliates possess elaborate and complex mechanisms to manufacture their bio-molecules by using salts present in the environment or by utilizing scant organic molecules released in the culture medium by other organisms (Rehman et al., 2005).

Tolerance of ciliates to copper

Metal tolerance is defined as the maximum metal concentration at which organisms survived and multiplied. It is very intricate to establish comparisons of the toxic and deadly effects of heavy metals among the reported studies using ciliates, because of the diversity of the experimental conditions used (Nilsson, 1989; Martin-Gonzalez et al., 1999; Gutierrez et al., 2003). This study reports the growth and survival of two ciliates Euplotes RE- 1 and RE-2 on Bold-basal salt medium in the presence of copper, which has hampered the growth of ciliates. The common trend was decreased cell growth with increasing copper concentration in the medium. Growth period was delayed when copper concentration was increased. In the literature it was reported previously (Sudo and Aiba, 1973; Brady et al., 1994) that a concentration of 25-27 ppm copper reduced the growth of V. microstoma and Opercularia sp. from activated sludge by 50%.

Salvado et al. (2001) reported that the ciliate Euplotes affinis did not apparently suffer great losses at 24 hours, in the presence of 5-10 mg/l copper and in due course it increased its population, which is considered as a regular succession of species. Thus ciliates are proficient of surviving when metal concentrations higher than those normally found in water and environment are present, as a consequence of their adaptability and stability of their metabolic processes in the stress conditions. Brady et al. (1994) stated that repetitions growth in the medium containing same copper concentration resulted in improved growth, arguing for a mechanism of tolerance by adaptation. A strain of T. pyriformis tested by Nicolau et al. (2001) was more sensitive to Zn than to Cu, in contrast with earlier reports using the same species (Yamaguchi et al., 1973; Piccinni et al., 1987; Nilsson, 2003).

CONCLUSIONS

Three ciliates isolated from industrial effluent were identified (by amplifying SS rRNA gene) as Euplotes muscicola and Euplotes adiculatus. On the basis of the results of this study new subspecies Euplotes muscicola lahorensis subsp. nov. is being reported.

REFERENCES

APHA, 1989. Standard methods for the examination of water and wastewater. 17th ed. Published jointly by American Public Health Association, American Water Work Association and Water Pollution Control Federation, 1015 Fifteenth Street, NW, Washington DC 20005.

BAROIN-TOURANCHEAU, A., VILLALOBO, E., TSAO, N., TORRES, A. AND PEARLMAN, R. E., 1998. Protein coding gene trees in ciliates: Comparison with rRNA-based phylogenies. Mol. phylogen. Evol., 10:299-309.

BERNHARD, D. AND SCHLEGEL, M., 1998. Evolution of histone H4 and H3 genes in different ciliate lineages. J. mol. Evol., 46: 344-354.

BERNHARD, D., STECHMANN, A., FOISSNER, W., AMMERMANN, D., HEHN, M. AND SCHLEGEL, M., 2001. Phylogenetic relationships within the class Spirotrichea (Ciliophora) inferred from small subunit rRNA gene sequences. Mol. phylogen. Evol., 21 (1):86-92.

BORROR, A.C. AND HILL, B. F., 1995. The order Euplotida (Ciliophora): Taxonomy, with division of Euplotes into several genera. J. euk. Microbiol., 42: 457-466.

BRADY, D., GLAUM, D. AND DUNCAN, J. R., 1994.Copper tolerance in Saccharomyces cerevisiae. Lett. appl. Microbiol., 18: 245-250.

CHEN, Z. AND SONG, W., 2001a. Phylogenetic positions of Uronychia transfuga and Diophrys appendiculata (Euplotida, Hypotrichia, Ciliophora) within hypotrichous ciliates inferred from the small subunit ribosomal RNA gene sequences. Eur. J. Protistol.,37: 291-301.

CHEN, Z. AND SONG, W., 2001b, Unpublished NCBI data base accession No. AF452707, AF452708

CHEN, Z., SONG, W. AND WARREN, A., 2000. Studies on six Euplotes spp. (Ciliophora: Hypotrichida) using RAPD fingerprinting, including comparison with morphometric analyses. Acta Protozool., 39: 209-216.

CHEN, Z. AND SONG, W., 2002. Unpublished NCBI data base accession No. AF164136.

CLARK, C. G., 1997. Riboprinting: A tool for study of genetic diversity in micro-organisms. J. euk. Microbiol., 44: 277-283.

CURDS, C.R., 1975. A guide to the species of Euplotes (Hypotrichida, Ciliatea). Bull. Br. Mus. nat. Hist. (Zool.), 28: 3-61.

CURDS, C. R., 1982. The ecology and role of protozoa in aerobic sewage treatment processes. Ann. Rev. Microbiol., 36: 27-46.

CURDS, C. R., GATES, M. A. AND ROBERTS, D-MCL.,1983. British and other freshwater ciliated protozoa, Part II, Cambridge University Press, London.

DI GIORGIO, F.P., CARRASCO, M.A., SIAO, M.C., MANIATIS, T. AND EGGAN, K., 2007. Non-cell automous effect of glia on motor neurons in an embryonic stem cell-based ALS model. Nat. Neurosci., 10: 608-614.

DI GINSEPPE, G. AND DINI, F., 2007. Unpublished NCBI data base accession No. Ay361908.

EDMONDSON, W. T., 1966. Fresh water biology, John Wiley and Sons, USA.

ELWOOD, H.J., OLSEN, G.J. AND SOGIN, M.L., 1985. The smallsubunit ribosomal RNA gene sequences from the hypotrichous ciliates Oxytricha nova and Stylonychia pustulata. Mol. Biol. Evol., 2: 399-410.

FELSENSTEIN, J., 1993. Phylip: Phylogeny Inference Package, Vers. 3.51c. University of Washington, Seattle.

FINLAY, B. J. AND FENCHEL, T., 1999. Divergent perspectives on protist species richness. Protist, 150:229-233.

FITCH, W. M. AND MARGOLIASH, E., 1967. Construction of phylogenetic trees. Science, 155: 279-284.

FOISSNER, W., BERGER, H. AND KOHMANN, F., 1992.Taxonomische und okologische Revision der Ciliaten des Saprobiensystems - Band II: Peritrichia, Heterotrichida, Odontostomatida. Landesamtes fur Wasserwirtschaft Heft 5/92. Informationsberichte des Bayer, Munchen, pp. 502.

FOISSNER, W., BERGER, H. AND SCHAUMBURG, J.,1999. Identification and ecology of limnetic plankton ciliates. Landesamtes fur Wasserwirtschaft Heft 3/99. Informationsberichte des Bayer, Munchen, pp. 793.

GATES, M. A. AND CURDS, C. R., 1979. The dargyrome of the genus Euplotes. Bull. Br. Mus. nat. Hist. (Zool.),35: 127-200.

GREENWOOD, S. J., SCHLEGEL, M., SOGIN, M. L. AND LYNN, D. H., 1991b. Phylogenetic relationships of Blepharisma americanum and Colpoda inflata within the phylum Ciliophora inferred from complete small subunit rRNA sequences. J. Protozool., 38: 1-6.

GUTIERREZ, J. C., MARTIN-GONZALEZ, A., DIAZ, S.AND ORTEGA, R., 2003. Ciliates as a potential source of cellular and molecular biomarkers/biosensors for heavy metal pollution. Eur. J. Protistol., 39: 461-467.

HADDAD, Y.-K. AND KLOETZEL, J.A., 2007. Reassessing the phylogeny of euplotid ciliates using ribosomal sequences. J. euk. Microbiol., 54: 185.

HAMMERSCHMIDT, B., SCHLEGEL, M., LYNN, D. H., LEIPE, D. D., SOGIN, M. L. AND RAIKOV, I. B.,1996. Insights into the evolution of nuclear dualism in the ciliates revealed by phylogenetic analysis of rRNA sequences. J. euk. Microbiol., 43: 225-230.

HAQ, R. U., REHMAN, A. AND A.R. SHAKOORI, A. R.,2000. Effect of dichromate on population and growth of various protozoa isolated from industrial effluents. Folia Microbiol., 45: 275-278.

HIRT, R. P., DYAL, P. L., WILKINSON, M., FINLAY, B.J., ROBERTS, D. MCL. AND EMBLEY, T. M.,1995. Phylogenetic relationships among karyorelictids and heterotrichs inferred from small subunits rRNA sequences: Resolution at the base of the ciliate tree. Mol. phylogen. Evol., 4: 77-87.

HOLZ, G. G. Jr., 1964. Nutrition and metabolism of ciliates, In: Biochemistry and physiology of Potozoa (ed. S. H. Hunter), Academic Press, New York, vol. 3, pp. 199-223.

JEROME, C. A. AND LYNN, D. H., 1996. Identifying and distinguishing sibling species in the Tetrahymena pyriformis complex (Ciliophora, Oligohymenophorea) using PCR/RFLP analysis of nuclear ribosomal DNA. J. euk. Microbiol., 43: 492-497.

KIMURA, M., 1980. A simple method of estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. mol. Evol., 16: 111-120.

KUMAR, S., TAMURA, K. AND NEI, M., 2004. MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform., 5: 150-163.

KUSCH, J., WELTER, H., STREMMEL, M. AND SCHMIDT, H.J., 2000. Genetic diversity in populations of a freshwater ciliate. Hydrobiologia,431: 185-192.

LI, L. AND SONG, W., 2006. Phylogenetic position of the marine ciliate, Certesia quadrinucleata (Ciliophora: Hypotrichia: Hypotrichida) inferred from the complete small subunit ribosomal RNA gene sequence. Eur. J. Protisol., 42: 55-61.

L.I, Y.S., GU, F.K. AND NIU, Y.N., 2007. Unpublished NCBI data base accession No. EF535728.

LYNN, D. H., GRANSDEN, S., WRIGHT, A.G. AND JOSEPHSON, G., 2000. Characterization of a new species of the ciliate Tetrahymena (Ciliophora: First report of Tetrahymena from a mammal. Acta Protozool., 39: 289-294.

MARTIN-GONZALEZ, A., DIAZ, S., JARENO, C. AND GUTIERREZ, J. C., 1999. The use of protists in ecotoxicology: Applications and perspectives. Recent Res. Devel. Microbiol., 3: 93-111.

MARTIN-GONZALEZ, A., BORNIQUEL, S., DIAZ, S., GALLEGO, A. AND GUTIERREZ, J.C., 2006. Cytotoxicity and bioaccumulation of heavy metals by ciliated protozoa isolated from urban wastewater treatment plants. Res. Microbiol., 157: 108-118.

NANNEY, D. L., PARK, C., PREPARATA, R. AND SIMON, E. M., 1998. Comparison of sequence differences in a variable 23S rDNA domain among sets of cryptic species of ciliated protozoa. J. euk. Microbiol., 45: 91-100.

NICOLAU, A., DIAS, N., MOTA, M. AND LIMA, N., 2001.Trends in the use of protozoa in the assessment of wastewater. Res. Microbiol., 152: 621-630.

NILSSON, J. R., 1989. Tetrahymena in cytotoxicology: With special reference to effects of heavy metals and selected drugs. Eur. J. Protistol., 25: 2-25.

NILSSON, J. R., 2003. How cytotoxic is zinc? A study on effects of zinc on cell proliferation, endocytosis, and fine structure of the ciliate Tetrahymena. Acta Protozool., 42: 19-29.

PETRONI, G., DINI, F., VERNI, F. AND ROSATI, G., 2002.A molecular approach to the tangled intrageneric relationships underlying phylogeny in Euplotes (Ciliophora, Spirotrichea). Mol. phylogen. Evol., 22:118-130.

PETRONI, G., DI GUISEPPE, G., ROSATI, F., VERNI, F.AND DINNI, F., 2003. An interdisciplinary approach to the phylogenetic relationships of the genus Euplotes. Eukary. Cell, 2: 115-22.

PICCINNI, E., IRATO, P., COPPELLOTTI, O. AND GUIDOLIN, L., 1987. Biochemical and ultrastructural data on Tetrahymena pyriformis treated with copper and cadmium. J. Cell Sci., 88: 283-293.

PRESCOTT, M.L., HARLEY, J., DONALD, P. AND KLEIN, A., 1999. Unpublished NCBI data base accession No. AF164136.

RAGAN, M. A., CAWTHORN, R. J., DESPRES, B., MURPHY, C. A., SINGH, R. K., LOUGHLIN, M. B. AND BAYER, R. C., 1996. The lobster parasite Anophryoides haemophila (Scuticociliatida: Orchitophryidae): nuclear 18S rDNA sequence, phylogeny and detection using oligonucleotide primers. J. euk. Microbiol., 43: 341-346.

REGENSBOGENOVA, M., KISIDAYOVA, S., MICHALOWSK, T., JAVORSKY, P., MOON-VAN DER STAAY, S. Y., MOON-VAN DER STAAY, G. W. M., HACKSTEIN, J. H. P., MCEWAN, N. R., JOUANY, J., NEWBOLD, J.C. AND PRISTAS, P., restriction analysis of amplified 18S rRNA gene. ActaProtozool., 43: 219-224.

REHMAN, A., ASHRAF, S., QAZI, J. I. AND SHAKOORI, A. R., 2005. Uptake of lead by a ciliate, Stylonychia mytilus, isolated from industrial effluents: potential use in bioremediation of wastewater. Bull. environ. Contam. Toxicol., 75: 290-296.

SAITOU, N. AND NEI, M., 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4: 406-425.

SALVADO, H., MAS, M., MENENDEZ, S. AND GRACIA, M. P., 2001. Effects of shock loads of salt on protozoan communities of activated sludge. Acta Protozool., 40: 177-185.

SAMBROOK, J., FRITSCH, E. F. AND MANIATIS, T.,1989. Molecular cloning; a laboratory manual (2nd edition), Cold Spring Harbor Laboratory Press, New York.

SAMBROOK, J. AND RUSSELL, D. W., 2001. Molecular cloning: a laboratory manual (3rd edition), Cold Spring Harbor Laboratory Press, New York.

SHAKOORI, A. R., REHMAN, A. AND HAQ, R. U., 2004. Multiple metal resistance in the ciliate protozoan, Vorticella microstoma, isolated from industrial effluents and its potential in bioremediation of toxic wastes. Bull. environ. Contam. Toxicol., 72: 1046-1051.

SMITH, C. T. AND CHAO, EE-Y., 2003. Phylogeny of choanozoa, apusozoa, and other protozoa and early eukaryote megaevolution. J. mol. Evol., 56: 540-63.

STECHMANN, A., SCHLEGEL, M. AND LYNN, D.H.,1998. Phylogenetic relationships between Prostome and Colpodean ciliates tested by small subunit rRNA sequences. Mol. phylogen. Evol., 9: 48-54.

STOECK, T., PRZYBOS, E. AND SCHMIDT, H. J., 1998. A combination of genetics with inter- and intra-strain crosses and RAPD-fingerprints reveals different population structures within the Paramecium aurelia species complex, Eur. J. Protistol., 34: 348-355.

STRUDER-KYPKE, M. C., WRIGHT, A.-D. G., FOKIN, S.I. AND LYNN, D. H., 2000. Phylogenetic relationships of the genus Paramecium inferred from small subunit rRNA gene sequences. Mol. phylogen. Evol., 14: 122-130.

STRUDER-KYPKE, M. C., WRIGHT, A.-D. G., JEROME C. A. AND LYNN, D. H., 2001. Parallel evolution of histophagy in ciliates of the genus Tetrahymena. BMC. Evol. Biol., 1:5.

SUDO, R. AND AIBA, S., 1973. Effect of copper and hexavalent chromium on the specific growth rate of ciliate isolated from activated sludge. Water Res., 7:1301-1307.

TAKESHI, I., MIKAMI, K., FANG, J. AND ASAI, H., 2002.Phylogenetic relationships between Vorticella convallaria and other species inferred from small subunit rRNA gene sequences. Zool. Sci., 19: 931-937.

TAN, M., JAHN, C. L. AND PRICE, C. M., 1994. Origin usage during Euplotes ribosomal DNA amplification. Gene, 151(1-2): 231-235.

THOMPSON, J. D., HIGGINS, D. G. AND GIBSON, T. J.,1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting position-specific gap penalties and weight matrix choice. Nucl. Acids Res., 22: 4673-4680.

TUFFRAU, M., 1960. Re'vision du genre Euplotes, fonde'e sur la comparison des structures superficielles. Hydrobiologia, 15: 1-77.

VALLESI, A., DI GIUSEPPE, G., DINI, F. AND LUPORINI, P., 2008. Pheromone evolution in the protozoan ciliate, Euplotes: The ability to synthesize diffusible forms is ancestral and secondarily lost. Mol. Phylogen. Evol., 47: 439-442.

VANNINI, C., ROSATI, G., VERHI, F. AND PETRONI, G.,2004. Identification of the bacterial endosymbionts of the marine ciliate Euplotes magnicirratus (Ciliophora, Hypotrichia) and proposal of "Candidatus Devosita euplotis". Int. J. Syst. Evol. Microbiol., 54: 1151-1156.

VANNINI, C., PETRONI, G., VERNI, F. AND ROSATI, G.,2005. Polynucleobacter bacteria in the brackish-water species Euplotes harpa (Ciliata, Hypotrichia). J. Euk. Microbiol., 52: 116-122.

WEEKERS, P. H. H. AND VOGELS, G. D., 1994. Axenic cultivation of the free living soil amoeba, Acanthamoeba castellanii and Harmanella vermiformes in a chemostat. J. Microbiol. Meth., 19:13-18.

WRIGHT, A. D. G. AND LYNN, D. H., 1995. Phylogeny of the fish parasite Ichthyophthirius and its relatives Ophryoglena and Tetrahymena (Ciliophora, Hymenostomatia) inferred from 18S ribosomal RNA sequences. Mol. Biol. Evol., 12: 285-290.

YAMAGUCHI, N., WADA, O., ONO, T., TAZAKI, K. AND TOYOKAWA, K., 1973. Detection of heavy metals toxicity by Tetrahymena pyriformis culture method. Ind. Hlth., 11: 27-31.
COPYRIGHT 2012 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Chaudhry, Raheela; Shakoori, Abdul Rauf
Publication:Pakistan Journal of Zoology
Article Type:Report
Geographic Code:9PAKI
Date:Jun 30, 2012
Words:5901
Previous Article:Prevalence of Paramphistomosis in Relation to Meteorological Factors.
Next Article:Monogenoidea on Indian Siluriform Fishes I: On a New Species and Designation of Neotypes to Some Indian Species of the Genus Bychowskyella Achmerow,...
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |