A New Dacrymycetaceous Species, Calocera himalayca sp. nov. (Basidiomycota: Dacrymycetales) from Pakistan.

Byline: Muhammad Hanif and Abdul Nasir Khalid

Abstract

While exploring biodiversity of mushrooms from Pakistan, Calocera himalayca was found growing on decaying wood in coniferous forests of Pakistan's Part of Himalaya. C. himalayca is very greasy in texture unlike the true coral fungi. Morphologically, it resembles with C. viscosa and often confused with some of the Ramaria species of coral fungi, but the greasy, viscid surface is an immediately obvious distinguishing feature of this species. The basidiomata were collected and characterized morpho-anatomically and rDNA was used to infer its phylogenetic topology/ placement with its allies. Copyright 2015 Friends Science Publishers

Keywords: Amplification; Bright orange; Logs; Stipitate basidioma

Introduction

Genus Calocera (Fr.) Fr. is represented by 15 species worldwide (Kirk et al., 2008). From Pakistan, only three species of this genus viz; C. cornea (Batsch) Fr., C. stricta Fr. and C. viscosa (Pers.) Fr., have been reported (Ahmad et al., 1997). They are greasy in texture unlike the true coral fungi and often confused with some members of Gomphales (species of Ramaria Fr. ex Bonord. and Clavulina J. SchrAlt.), but the greasy, viscid surface is an immediately obvious distinguishing feature of this species. The order Dacrymycetales is one of the wood decaying group of fungi which are involved in the degradation of cellulose, hemicelluloses and lignin. They have mechanism of lignin degradation involving degradatory enzymes (ligninolytic enzymes, lignin Peroxidases, manganese Peroxidases, Laccases, aryl-alcohol Oxidases).

These are also used in biological pulping, kraft pulp discoloration, decolorization of waste waters, coal solubilization, degradation of polystyrenes, bioremediation of toxic environmental pollu tants, chlorinated organic compounds, polycyclic aromatic hydrocarbons, nitro-substituted compounds, dyes and other toxic compounds (Rajarathnam et al., 1998). Fungal inventories within the Himalayan Moist Temperate Forests (HMTF) of Pakistan revealed a new species of Calocera growing on decaying logs Abies pindrow Royle. This new species, C. himalayca is supported by molecular extraction and is described herein.

Materials and Methods

The sampling sites are located in the HMTF of Pakistan and show high basidiomycetes biodiversity. These forests are dominated by conifers (Khalid, 1998; Niazi, 2008). The temperature ranges from -4 to 25C. Soil is loamy with gravels and rock stones of variable sizes. These conditions ideally favor the decomposition of rotting log. During the exploration of biodiversity of mushrooms, a species of Calocera was collected from Helipad, Khanspur-Ayubia found growing on Abies pindrow rotting logs. Field notes were prepared. This fungus was given a tentative number and vouchered. It was morphologically characterized following Reid (1974). Small portions from the hymenium (about 1 cm) were placed in 2% CTAB buffer in 1.5 ml eppendorff and kept at -20C for further analysis. The collected specimen was dried with fan heater overnight and kept in vouchered Ziploc bags.

The measurements of spores and other microscopic features were taken with micrometer and were drawn with the aid of a camera lucida.Basidiospores were observed at 1600A-.

DNA Extraction

DNA was extracted by modified CTAB method following Gardes and Bruns (1993). The hymenial tissue was removed with sterile forceps and rinsed with sterile H2O. The extraction was modified for silica emulsion binding and purification (Gene-Clean; Q-Biogene, Irvine, CA, USA).

Polymerase Chain Reaction and Sequencing

Polymerase chain reaction (PCR) was carried out following Gardes and Bruns (1993), using the fungus-specific ITS1F primer (CTTGGTCATTTAGAGGAAGT) and the eukaryotic ITS4 primer (TCCTCCGCTTATTGATATGC) to amplify the nuclear rDNA-ITS region. The hot-start enzyme JumpStart (Sigma, St Louis, MO, USA) was used to catalyse the PCR with 2 min at 94C, followed by 30 cycles of 30 s at 94C, 30 s at 53C, 40 s + 5 s per cycle at 72C, and finishing with 5 min at 72C. The PCR products were purified with QIAquick (Qiagen Inc., Valencia, CA, USA), sequenced bi-directionally using the reverse and forward primers and BigDye 3.1 on an ABI 3730 DNA sequencer (Applied Biosystems, Foster City, CA, USA) and edited in sequencher 4.5 (Gene Codes, Ann Arbor, MI, USA) in Jodrell Laboratory, Royal Botanical Gardens, Kew, UK. DNA sequences were submitted to Basic Local Alignment Search Tool (BLAST) and used to query the nucleotide collection using default settings.

DNA sequences of C. himalayca was submitted in GenBank and its phylogenetic position was inferred.

Alignment and Phylogenetic Analysis

Phylogenetic position of C. himalayca was confirmed by making tree using 30 rDNA ITS sequences including four (04) sequences obtained from C. himalayca from Pakistan. All the sequences were aligned and corrected manually by using Clustal W and Mega 5 programme used for making Maximum likelihood tree with 1000 bootstrapping. Percentage Identities were calculated using software DNA Star (DNA Star, Inc. 3801 Regent Street Madison, WI 53705 USA). Aligned sequences were then used for making phylogenetic tree.

Results

Enumeration of Taxon

Calocera himalayca sp. nov. Hanif and Khalid Fig. 1(AC).

Etymology:

Calocera himalayca is named due to the holotype location in Himalayan Forests.Stipitate and deep-rooted basidiomata, bright yellow to orange in color, dichotomously branched with pointed tips. Have frequent Probasidia, cylindrical to clavate, becoming bifurcate.

Morphoanatomical Characterization

Basidiomata stipitate, deep-rooted, 510 cm long, bright yellow when fresh becoming orange on drying, dichotomously branched, branches erect, terete, or compressed, with pointed tips. Hymenium amphigenous Probasidia cylindrical to clavate, becoming bifurcate, 4050 x 56 m. Basidiospores subglobose to reniform, hyaline, apiculum at the base, 1 septate, guttulate, 7.09.0 x 4.46.6 m.

Habit and Habitat

On decaying Abies pindrow logs, in group of 24 basidiomata.

Material Examined

Pakistan, KPK, Aubia, Khanspur, Helipad, 34 01' 30.89'' N, 73 25' 18.78''E, elevation 1974 m, 26 Jul 2008, M. Hanif, MH2678.141 (LAH # MH2678.1 HOLOTYPE); KPK, Nathia Gali, Near Governor's House, 34 04' 18.18'' N, 73 23' 34.44''E, elevation 2408 m, 18 Aug 2009, M. Hanif, MH188902.288 (LAH # MH188902.2 PARATYPE). Punjab, Murree, 33 54' 25.60'' N, 73 23' 36.90'' E, elevation 2188 m, 11 Aug 2009, M. Hanif, MH1189.302 (LAH # MH0889.3 PARATYPE). Gilgit Baltistan, Fairy Meadows, 26 Aug 2010, M. Hanif, MH26810.287 (LAH # MH26810.4 PARATYPE).

Molecular Phylogenetic analysis

Calocera himalayca generated 209-219 bases long fragments when PCR products of rDNA-ITS were sequenced bidirectionally (Fig. 4). Initial BLAST analysis of all the isolates resulted in 98% similarity with C. viscosa and 95% query coverage (DQ 520102.1). rDNA-ITS sequences of all these 4 isolates of C. himalayca were identical to each other (Fig. 5). In order to investigate its molecular phylogenetic relatedness with the rDNA sequences of its related species deposited in the GenBank and with other sequences of its morphological allies, phylogenetic tree was constructed. Total 23 rDNA-ITS sequences were included along with 4 sequences of C. himalayca isolates from Pakistan, while Xylaria sp. was used as an out group. The aligned ITS1-5.8S-ITS2 dataset was 387 bases long, out of which 133 ambiguously aligned characters were excluded from the analysis. The alignment of 255 characters was used for further analyses. The maximum likelihood tree was constructed to find out molecular relatedness.

In the alignment of 255 characters, 127 nucleotides were conserved, 92 were parsimony informative and 117 were variable. Cladogram was divided into 2 major clades (Fig. 3). All the sequences belonging to order Decrymycetales were clustered together in clade I with strong bootstrap frequency (91%). All the isolates of C. himalayca grouped together within clade I with high bootstrap support (98%). Clade II composed of sequences of order Gomphales; morphological allies of genus Calocera. Isolates of C. himalayca from Pakistan shared 100% analyzed genetic characters with each other. These isolates shared 95.45% analyzed genetic characters with C. viscosa (DQ520102.1) and significantly differed genetically (3.05.2%). These isolates of C. himalayca shared 91% analyzed genetic characters and had 12% genetic divergence (Fig. 2) compared with C. cornea (AY789083.1).

There were 9 polymorphic sites indicating insertions and deletions in alignment of 4 isolates of C. himalayca and C. viscosa (DQ520102.1) at positions 26, 31, 44, 168, 207, 210, 211, 212 and 219 (data not shown). Phylogenetic analysis and number of polymorphic sites confirm that C. himalayca

Table 1: rDNA sequences downloaded from GenBank for molecular characterization and phylogenetic analyses

Name of fungal species###Isolate/Voucher No.###Accession No.###County of origin

Calocera cornea###AFTOL-ID 438###AY789083.1###USA

Calocera himalayca###MH288###Unpublished###PAKISTAN

Calocera himalayca###MH287###Unpublished###PAKISTAN

Calocera himalayca###MH302###Unpublished###PAKISTAN

Calocera himalayca###MH141###Unpublished###PAKISTAN

Calocera sp.###KRCF731###AB374292.1###JAPAN

Calocera sp.###Wu9910-12###FJ195751.1###TAIWAN

Calocera sp.###ICMP 16998###GQ411508.1###NEW ZEALAND

Calocera viscosa###AFTOL-ID 1679###DQ520102.1###GERMANY

Cerinosterus luteoalbus###WRCF-AW12###AY618667.1###CANADA

Clavulina cf. amethystina###O 62152###EU862204.1###SPAIN

Clavulina cf. amethystina###PRM 896664###EU862203.1###SPAIN

Clavulina cf. amethystina###O 175524###EU862208.1###SPAIN

Clavulina cf. cristata###O 65398###EU862205.1###SPAIN

Clavulina cf. rugosa###O 67776###EU862207.1###SPAIN

Clavulina samuelsii###PDD:89881###GU222317.1###NEW ZEALAND

Dentocorticium sulphurellum###FP11801###JN165018.1###USA

Marasmius androsaceus###ZK24/08###FR717227.1###CZECH REPUBLIC

Marasmius androsaceus###NN008037###JN943605.1###USA

Ramaria botrytis###snf213###AF377055.1###USA

Ramaria formosa###OSC 1064203###EU525994.1###USA

Ramaria stricta###JMP0055###EU819419.1###USA

Xylaria hypoxylon###MH143###Unpublished###PAKISTAN

Is a novel species, which nested with genus Calocera and C. viscosa appeared as its sister species.

Discussion

The taxonomic history of Dacrymycetalean genera has been reviewed by Oberwinkler (1993). Some studies discussing the phylogenetic relationship in this class have been published (Weiss and Oberwinkler 2001; Shirouzu et al., 2007). Shirouzu et al. (2009) re-examined Dacrymycetous fungi in Japan using taxonomic studies along with molecular phylogenetic analyses. Dacrymycetales, initially established by Hennings (1898; as Dacryomycetinieae) and composed of the single family Dacrymycetaceae, which was introduced by SchrAlter (1889; as Dacryomycetini) including many genera. McNabb (1964, 1965ae, 1966, 1973) re-examined the validity of described genera and finally recognised eight genera in the Dacrymycetaceae viz: Calocera, Cerinomyces, Dacrymyces, Dacryopinax, Ditiola, Femsjonia, Guepiniopsis and Heterotextus.

Genus Calocera of class Dacrymycetes represented by only 3 species in Pakistan viz; C. cornea, C. viscosa and C. stricta (Ahmad et al., 1997). Calocera himalayca was first collected from Helipad, Khanspur, KPK growing on decaying wood of Abies pindrow. Initially this was confused with C. viscosa. When rDNA-ITS regions this species was amplified and analyzed, it looked different from C. viscosa already described from Pakistan phylogenetically as well. Calocera himalayca clustered within Clade Dacrymycetales for the present studies (Fig. 3). Members of class Dacrymycetes are known as jelly fungi characterized by imperforate parenthesomes and basidia that are usually branched. The present species, C. himalayca, is being described as a new addition, which is characterized by stipitate, deep-rooted dichotomously branched basidiomata, bright yellow to orange colour.

This species looks morphologically very close to C. viscosa and some variations in morpho-anatomic fe atures.

C. himalayca was found to grow in a group of 24 basidiomata, Murree, Khanspur, Nathiagali, Fairy Meadow, Pakistan. While C. viscosa grows scattered on conifer wood. Both C. himalayca and C. viscosa are similar in colour and size of basidiomata. Spores of C. viscosa are longer (7.515 m) than C. himalayca. Presence of clamps in tramal hyphae (Fig. 1C) of C. himalayca is another unique feature that delimits C. viscosa from it. C. himalayca also differs from C. cornea reported from Pakistan. C. cornea has relatively small, simple, slightly branched, palmate or dendroid basidiomata, white to yellow colour, clampless hyphae and slightly longer (7.512.5 m) basidiospores. Phylogenetically, C. himalayca clustered within clade I (Decrymcetales) near C. viscosa (DQ520102.1) and C. cornea (AY89083.1) with strong (91%) bootstrap frequency (Fig. 3). All these three species closely resemble in jelly like appearance of their basidiomata. C. himalayca differs from rest of two in having clamped tramal hyphae.

These morpho-anatomic differences and interspecific rDNA-ITS variations of C. himalayca compared with C. viscosa and C. cornea are the evidences for novelty of the described species.

Acknowledgments

We sincerely thank Higher Education Commission of Pakistan for funding the training of the first author at the Imperial College, London and Royal Botanic Gardens, Kew, UK.

References

Ahmad, S., SH. Iqbal and A.N. Khalid, 1997. Fungi of Pakistan. Sultan Ahmad Mycological Society of Pakistan, Department of Botany, University of Punjab, Quaid-e-Azam Campus, Lahore-54590, Pakistan

Gardes, M. and T. Bruns, 1993. ITS primers with enhanced specificity for Basidiomycetes: application to the identification of mycorrhizae and rusts. Mol. Ecol., 2: 113118.doi:10.1111/j.1365- 294X.1993.tb00005.x PMid:8180733

Hennings, P., 1898. Dacrymycetineae, Exobasidiineae, Hymenomycetineae. In: Die NatA1/4rlichen Pflanzenfamilien I Teil. Abteilung, Vol. 1, pp: 96102.

Engler, A. and K. Prantl (eds.). Engelmann, Germany Khalid, A.N., 1998. Taxonomic affinities of ectomycorrhizal macromycetes of Pines of Pakistan. Ph.D Thesis, Department of Botany, University of the Punjab, Lahore, Pakistan

Kirk, P.M., G.C. Ainsworth, P.F. Cannon and D.W. Minter, 2008. Ainsworth and Bisby's Dictionary of Fungi, 10th edition. CAB International, UK

McNabb, R.F.R., 1964. Taxonomic studies in the Dacrymycetaceae I. Cerinomyces Martin. N.Z. J. Bot., 2: 415424

McNabb, R.F.R., 1965a. Taxonomic studies in the Dacrymycetaceae II. Calocera (Fries) Fries. N.Z. J. Bot., 3: 3158

McNabb, R.F.R., 1965b. Taxonomic studies in the Dacrymycetaceae III. Dacryopinax Martin. N.Z. J. Bot., 3: 5972

McNabb, R.F.R., 1965c. Taxonomic studies in the Dacrymycetaceae IV. Guepiniopsis Patouillard. N.Z. J. Bot., 3: 159169

McNabb, R.F.R., 1965d. Taxonomic studies in the Dacrymycetaceae V. Heterotextus Lloyd. N.Z. J. Bot., 3: 215222

McNabb, R.F.R., 1965e. Taxonomic studies in the Dacrymycetaceae VI. Femsjonia Fries. N.Z. J. Bot., 3: 223228

McNabb, R.F.R., 1966. Taxonomic studies in the Dacrymycetaceae VII. Ditiola Fries. N.Z. J. Bot., 4: 546558

McNabb, R.F.R., 1973. Taxonomic studies in the Dacrymycetaceae VIII. Dacrymyces Nees ex Fries. N.Z. J. Bot., 11: 461524

Niazi, A.R., 2008. Biodiversity of ectomycorrhizas in conifers from Himalayan Moist Temperate Forests of Pakistan. Ph.D. Thesis, Department of Botany, University of the Punjab, Lahore, Pakistan

Oberwinkler, F., 1993. Genera in a monophyletic group: the Dacrymycetales. Mycologia Helvetica, 6: 3572

Rajarathnam, S., M.N. Shashirekha and Z. Bano, 1998. 'Biodegradative and Biosynthetic Capacities of Mushrooms: Present and Future Strategies', Critical. Rev. Biotechnol., 18: 91236

Reid, D.A., 1974. A monograph of the British Dacrymycetales. Transactions of the Brit. Mycol. Soc., 62: 433494

SchrAlter, J., 1889. Die Pilze Schlesiens, Vol. 3. J.U. Kern's Verlag, Germany

Shirouzu, T., D. Hirose and S. Tokumasu, 2007. Sequence analyses of 28S rRNA gene D1/D2 region suggests Dacrymyces (Heterobasidiomycetes, Dacrymycetales) is polyphyletic. Mycoscience, 48: 388394

Shirouzu, T., D. Hirose and S. Tokumasu, 2009. Taxonomic study of the Japanese Dacrymycetes. Persoonia, 23: 1634

Weiss, M. and F. Oberwinkler, 2001. Phylogenetic relationships in Auriculariales and related groups hypotheses derived from nuclear ribosomal DNA sequences. Mycol. Res., 105: 403415

Article Details

Printer friendly Cite/link Email Feedback
Publication:	International Journal of Agriculture and Biology
Article Type:	Report
Geographic Code:	9PAKI
Date:	Jun 30, 2015
Words:	2448
Previous Article:	Antifungal Properties of Extracts of Sesame (Sesamum indicum).
Next Article:	Zinc Oxide, Zinc Sulfate and Zinc Oxide Nanoparticles as Source of Dietary Zinc: Comparative Effects on Growth and Hematological Indices of Juvenile...
Topics:	Basidiomycota Discovery and exploration