Printer Friendly

A New Bacterial Disease of Cassava in Venezuela Caused by Enterobacter cloacae.

Byline: M.A. SANTANA, M. RODRIGUEZ, J. MATEHUS, J. FAKS, A. BOCSANCZY, A. GERSTL, G. ROMAY, J. MONTILLA, C.E. FERNANDE, N. MORENO ZAMBRANO AND D. MARVAL

ABSTRACT

In this article we report a new cassava (Manihot esculenta Crantz) bacterial disease in Venezuela. The disease has been observed in different Venezuelan regions since 2001. Leaves of the collected samples showed angular water-soaked lesions on the leaf lamina, which became later necrotic with a chlorotic halo. Advanced disease stages induce an early senescence of leaves leaving the stem bare. Bacteria isolated formed small beige, glistening, smooth colonies with regular margins within 24 h incubation at 30oC on LB agar or semi-selective threhalose agar. All isolates were Gram negative, facultative anaerobic with several peritrichious flagella observed under the Electron Microscope. The bacterium was identified as Enterobacter cloacae by biochemical assays, but 16S rRNA gene sequence analysis did not allow discrimination between E. cloacae and Pantoea agglomerans.

Other PCR based identification methods such as ERIC and GIRRN-LIRRN ribotyping, and hsp60 sequence identified the strains as E. cloacae. Pathogenicity test on cassava plants reproduced the disease symptoms and allowed the re- isolation of E. cloacae from the infected tissues. This is the first report of a disease caused by E. cloacae on cassava and it may have an impact on cassava seed production. (c) 2012 Friends Science Publishers

Key Words: Cassava; Enterobacter; Pathogenicity; Venezuela

INTRODUCTION

Cassava (Manihot esculenta Crantz) is a tropical starchy root crop, native to South America, especially important as staple food in sub-Saharan Africa, Asia and America, representing the main sources of calories and income for more than 500 million people worldwide. Cassava is a perennial plant, propagated by 30 cm long stem sections, with a storage root producing cycle ranging between 8-18 months depending upon the varieties. In South America cassava is mostly grown on small farms, without fertilization and usually intercropped with other edible plants such as yams, sweet potato, maize and beans. However, cassava grows better than any other major food plant in poor soils and under drought conditions (Ospina and Ceballos, 2002).

Despite the adaptability of the crop to poor conditions, and the estimated potential of productivity of 80 tonnes per hectare, the world average yield for cassava has remained in 12-13 tonnes per hectare (FAOSTAT, 2007). However, yields can be improved by using healthy and well adapted genetic material as vegetative seed, sandy well drained soils, fertilization and adequate agriculture practices such as disease and pest control (Ospina and Ceballos, 2002;).

Several bacterial diseases have been reported in cassava including Cassava Bacterial Blight (CBB) caused by Xanthomonas axonopodis pv. manihotis (Xam), bacterial angular leaf spot caused by X. campestris pv. cassavae, bacterial stem gall caused by Agrobacterium tumefaciens Biovar 1, bacterial stem rot caused by Pectobacterium carotovorum sbsp. carotovorum (Erwinia carotovora pv. carotovora) and bacterial wilt caused by E. herbicola. E. herbicola was renamed E. agglomerans by Beji et al. (1988) and later replaced in genus Pantoea as Pantoea agglomerans (Gavini et al., 1989) (http://www.apsnet.org/online/common/names/cassava.asp).

The major cassava bacterial disease limiting productivity in different parts of South America (Colombia and Venezuela) and Africa is cassava bacterial blight (CBB). Yield losses due to CBB can reach up to 80-90% during high epiphytotic periods such as those reported in Zaire and Colombia (Lozano, 1986; Sanchez and Verdier, 1998; Ospina and Ceballos, 2002). CBB in cassava has been extensively studied and a high genetic diversity in the different population of Xam in Colombia and Venezuela has been found (Verdier et al., 1998b; Restrepo et al., 2000). With the idea to understand the dynamic of the genetic variability of Xam population, we attempted to study isolation and characterization of the genetic diversity of different Venezuelan populations of Xam, initiated previously by Verdier et al. (1998a), and found a new bacteriosis present on cassava fields. In this study we report the identification and characterization of the causal agent of this bacterial disease in Venezuela.

MATERIALS AND METHODS

Bacterial isolation and culture: Cassava leaves showing angular water-soaked lesions or necrotic lesions on the leaf lamina were collected in 2001, 2005 and 2008, from different Venezuelan regions (Anzoategui, Monagas and Portuguesa). Pieces of water-soaked lesions were transferred to a sterile saline solution (0.85%) and the bacteria were allowed to diffuse into the solution from the edge of the dissected tissue. Bacterial strains were isolated by streaking on LB agar or on semiselective trehalose agar media plates used for the isolation of X. axonopodis pv manihotis (Schaad et al., 2001). Plates were incubated 24 h at 30oC. Single colonies were restreaked at least two times to ensure purity. All isolates were stored at -80degC in LB supplemented with 20% glycerol.

Physiological and biochemical characterization: Bacteria were grown in LB at 30degC to an optical density of 1 OD. Freshly grown bacterial cultures were used for all the assays. Gram stain and the 3% KOH test were performed.

Flagella were observed under an EM (Philips Cryo CM120) from an o/n bacterial culture carefully re-suspended in water (1:104 dilution factor) and negative stained (Servicio de Microscopia Electronica del Departamento de Biologia Estructural, Instituto Venezolano de Investigaciones Cientificas). Biochemical identification was performed using API20E strips (bioMerieux, Inc.) and the MicroScan Autoscan4 system. All tests were conducted more than once to confirm the strain identification. Fatty Acid Analysis was performed using the MIDI Inc microbial identification system by the service of the University of Florida, Plant Pathology Department, Gainesville, USA, (Dr Ellen Dickstein).

Pathogenicity test on cassava plants: Pathogenicity studies were performed using cultures of the different isolated strains, grown in LB at 30degC for 24 h. Cultures were adjusted to an estimated density of 108 CFU/mL by optical density previous to plant inoculation. Healthy cassava in vitro plants from the IDEA Germoplasm Bank, greenhouse plantlets or stem cutting plants were used for the pathogenicity test. All cassava plant material was initially grown from in vitro plants using cassava micropropagation media containing Murashige and Skoog (1962) salts supplemented with thiamine 10 mg/L, myo-inositol 100 mg/L, 2% sucrose, 0.027 uM a-naphthaleneacetic acid, 0.023 uM gibberellic acid and 0.18% PhytagelTM. Leaf inoculations were done with a sterile tooth stick previously dipped in the bacteria culture. Plants were also inoculated with sterile LB medium as a negative control. Initially, 28 cassava cultivars were assayed to study their susceptibility to the pathogen.

All the experiments were conducted in triplicate. Plants were evaluated for the presence of disease symptoms during 2-4 weeks. Individual plants were evaluated using the disease severity rating scale of 1 to 6 where 1, no symptoms; 2, less than 50% leaf area with lesions; 3, 50% or more leaf area with lesions; 4, 100% of leaf area with lesions; 5, several dead leaves and 6, symptoms on the stem or dead plant. Plant tissue with disease symptoms were sampled and strains isolated and identified again. Experiments with in vitro plants, greenhouse plantlets or stem cutting plants were performed in triplicates. At least three sets of independent experiments were conducted with each plant material.

Genomic DNA and Plasmid Isolation: DNA was isolated from o/n cultures either by the procedure described by Chen and Kuo (1993) or using Wizard(r) Genomic DNA purification kit from Promega. Total DNA was electrophoresed in 0.8% agarose gel containing Tris-borate- EDTA (TBE) buffer as described by Sambrook et al. (1989). DNA was stained with 0.5 ug/mL of ethidium bromide and visualized and photographed under UV light with the Molecular Imager Chemidoc System from BioRad.

PCR amplification: Partial 16S ribosomal RNA gene amplification was performed as described by Lu et al. (2000), using U1 and U2 universal primers. Reactions were performed in a final volume of 25 uL containing 0.2 uM of each primer, 200 uM dNTPs, 10 mM Tris-HCl [pH 8.4], 3 mM MgCl2, 1 U GoTaq(r) Flexi DNA polymerase from Promega and 100 ng of template DNA. Amplification reactions were carried out in a PT-100 MJ Research thermocycler. After 10 min of denaturation at 94degC, 35 cycles of 60 sec of denaturation at 94degC, 60 sec of annealing at 55degC and 2 min of extension at 72degC were performed, with a final extension at 72degC for 10 min.

ERIC-PCR analysis and PCR ribotyping were performed as described by Versalovic et al. (1991) and Appuhamy et al. (1998). The primers were ERIC IR 5'ATGTAAGCTCCTGGGGATTCAC 3' and ERIC2 5'AAGTAAGTGACTGGGGTGAGCG 3'for ERIC PCR analysis; and GIRRN 5'GAAGTCGTAACAAGG3' and LIRRN 5'CAAGGCATCCACCGT 3' for ribotyping.

Reactions were performed in a final volume of 25 uL containing 0.2 uM of each primer, 200 uM dNTPs, 10 mM Tris-HCl [pH 8.4], 3 mM MgCl2, 1 U GoTaq(r) Flexi DNA polymerase from Promega and 100 ng of template DNA. Amplification reactions were carried out in a PT-100 MJ thermocycler. After 5 min of denaturation at 95degC, 35 cycles of 30 sec of denaturation at 94degC, 30 sec of annealing at 50degC and 6 min of extension at 72degC were performed, with a final extension at 72degC for 6 min. Enterobacter cloacae strain ATCC 13047 and P. agglomerans USBCU1 (Biotechnology Lab. collection) were used as reference for PCR experiments.

PCR reactions of hsp60 were performed as reported by Hoffmann and Roggenkamp (2003), using primers Hsp60-F 5'GGTAGAAGAAGGCGTGGTTGC 3'and Hsp60-R 5' ATGCATTCGGTGGTGATCATCAG 3'. X. axonopodis pv. manihotis containing the gene encoding for pathogenicity protein PathB was detected by PCR using XV and XK specific primers (Verdier et al., 1998a; Schaad et al., 2001).

DNA products were electrophoresed in 1-2% agarose gel containing either Tris-acetate-EDTA or Tris-borate- EDTA buffer as described by Sambrook et al. (1989). DNA fragments were stained with 0.5 ug/mL of ethidium bromide and visualized and photographed under UV light with the Molecular Imager Chemidoc System from BioRad. Amplified DNA fragments were purified using the AxyPrepTM PCR Cleanup kit from Axygen and then sequenced by the sequencing service of the Biotechnology Center, Instituto de Estudios Avanzados (IDEA), Caracas, Venezuela. Following sequencing, DNA sequences were analyzed using DNAMAN and a NCBI BLAST was conducted to compare the sequenced fragment (~341 bp for hsp60 and ~850 bp for pathB) with sequences published in the Genebank. (http://www.ncbi.nlm.nih.gov/BLAST/).

RESULTS

Symptoms on diseased plants: Fig. 1 shows plants from the field with leaves showing necrotic lesions with a chlorotic halo. Advanced stages of the disease induced an early senescence of leaves leaving the stem bare.

Isolation and physiological and biochemical identification: Samples from Anzoategui, Portuguesa and Monagas states yielded small beige, glistening, smooth colonies with regular margins on LB plates after 24 h incubation at 30oC. Longer incubations (48-72 h) allow the growth of Xam, when present, recognized as a mucoid, cream shining colonies, with no antagonist between them. Fig. 2 is an electron microscopy photograph of strain Gua56 showing rod-shaped bacterial cells with rounded ends with several peritrichous flagella.

Table I shows the results of physiological and biochemical characterization of the bacterial isolates as well as the results for E. cloacae. Biochemical tests indicated that the strains isolated belong to the species E. cloacae (99% identity with the results expected for E. cloacae). Identical results were obtained with API20E tests and MicroScan Autoscan4 system. However, compared with Anz03, Gua56 and Mon11, Mon536 was negative for the production of acid from rhamnose. Resistance to ampicillin and cefazolin

Table I: Physiological and biochemical characteristic of the E cloacae isolated strains. E. cloacae ATCC 13047 was use as a reference strain

Characteristic###Anz03###Gua56###Mon11###Mon536###E. cloacae

Gram stain###-###-###-###-###-

Motility###+###+###+###+###+

Yellow Pigment###-###-###-###-###-

b-Galactosidase###+###+###+###+###+

Arginina dihydrolase###+###+###+###+###+

Lysine decarboxylase###-###-###-###-###-

Ornithine decarboxylase###+###+###+###+###+

Citrate utilization###+###+###+###+###+

Hydrogen sulfide###-###-###-###-###-

Ureasa###-###-###-###-###-

Tryptophan deaminase###-###-###-###-###-

Indole###-###-###-###-###-

Voges-Proskauer###+###+###+###+###+

Gelatin liquefaction###-###-###-###-###-

Acid from:

Glucose###+###+###+###+###+

Mannitol###+###+###+###+###+

Inositol###-###-###-###-###-

Sorbitol###+###+###+###+###+

Rhamnose###+###+###+###-###+

Sucrose###+###+###+###+###+

Melibiose###+###+###+###+###+

Amygdalin###+###+###+###+###+

Arabinose###+###+###+###+###+

Trehalose###+###+###+###+###+

Oxidase###-###-###-###-###-

Nitrate reduction###+###+###+###+###+

Catalase###+###+###+###+###+

Anaerobic growth###+###+###+###+###+

Growth at 42oC###+###+###+###+###NE

Growth at 5% NaCl###+###+###+###+###NE

NE means no essayed

was detected in Anz03. Fatty acids profile of Gua56 was not conclusive; allowing the inclusion of the strain GUA56 in the family group of Enterobacteraceas, genus Enterobacter sp. Gua 56 strain had a similarity index of 0.917, 0.696 and 0.651 with E. cancerogenus, E. asburiae and E. hormaechei, respectively.

Molecular identification: In order to confirm the biochemical results, molecular techniques were applied. The first approach for the molecular identification of the isolates was sequencing of 16S ribosomal RNA gene. Partial gene sequences of the four strains were compared with the sequences present in GenBank. Table II shows the percentage of identity of our sequences with the sequences of the 16S ribosomal RNA gene of different species. Since 16S rRNA gene sequence analysis was not conclusive and did not allow the discrimination between E. cloacae and P. agglomerans, enterobacterial repetitive intergenic consensus primers (ERIC) and PCR ribotyping identification methods were performed. The results of these experiments are presented in Fig. 3. From the results of ERIC-PCR analysis and PCR ribotyping with GIRRN-LIRRN primers it can be conclude that the isolated strains have identical fragment mass than one of the E. cloacae strain used as control.

In addition hsp60 DNA sequence of GUA56 showed

Table II: Percentage of maximum identity found for the 16S rRNA gene sequences of the isolated strains when compared with the sequences on the GeneBank

###Pantoea agglomerans###Enterobacter cloacae

Strain###Total Score###Q. Coverage###Max. Ident.###Gaps###Total Score###Q. Coverge###Max.Ident.###Gaps

Anz03###1299###718/730 (94%)###98%###0###1297###718/730 (94%)###98%###0

Gua56###1478###833/852 (99%)###97%###4###1487###835/852 (99%)###98%###4

Mon11###935###563/589 (82%)###95%###15###933###563/589 (82%)###95%###15

Mon46###1613###881/885 (100%)###99%###0###1613###881/885 (100%)###99%###0

MonA4###1607###878/884 (99%)###99%###0###1618###880/884 (99%)###99%###0

Table III: Susceptibility of cassava varieties to Gua56 strain

Control###1###1###1###1###

22###1###2###2###2

24###1###2###2###2

35###3###5###5###5

46###1###2###3###3

47###1###2###2###3

48###1###2###2###3

49###1###1###3###5

50###2###5###5###5

51###1###2###3###5

52###2###5###5###6

53###1###1###2###3

54###1###2###2###3

55###2###2###3###5

56###2###5###5###5

57###1###2###2###2

58###1###1###2###3

59###2###2###3###5

60###2###2###2###3

61###1###2###2###3

62###2###2###3###3

63###2###3###3###3

64###2###2###2###3

65###1###2###2###3

85###1###2###3###5

86###3###5###5###5

89###2###3###5###6

90###2###2###3###5

Plants were evaluated for the presence of disease symptoms during 4 weeks. Individual plants were evaluated using the disease severity rating scale of 1 to 6 where 1= no symptoms, 2= less than 50% of leaf lesion, 3= 50% or more of leaf damage, 4= 100% of leaf damage, 5= several dead leaves and 6= symptoms on the stem or dead plant. The values represent the absolute values of the average between replicas (n=3).

99,4% identity in a fragment of 342 bp with chaperonin GroL (Hsp60) partial sequence of E. cloacae ssp. cloacae NCTC9394 published in GenBank under the accession number FP929040.1, and 100% identity with a fragment of 333 bp of E. cloacae partial sequence of hsp60 gene for strains numbers 8, 40, 32, 157 and 131, accession numbers AJ417137.1, AJ417133.1, AJ417130.1, AJ417121.1 and AJ417120.1, respectively.

Representative isolates Gua56 and Anz03 have been deposited into the Venezuelan Collection of Microorganism, Universidad Central de Venezuela, under accession number CVCM 1992 and CVCM 1993. 16S rRNA gene partial sequences of these strains were introduced in the GenBank under the accession numbers GU593270 and GU593272.

Pathogenicity tests: The pathogenicity tests were performed with the different E. cloacae strains isolated, and cassava plants grown either from stem cutting in the reproduced the symptoms described for the disease on susceptible cassava varieties. Using in vitro cassava plants, a test of susceptibility to E. cloacae of 28 cassava varieties of IDEA germoplasm bank was performed with the Gua56 isolate (Table III). Cassava varieties 52 and 89 were the most susceptible to the infection with E. cloacae. Several varieties such as 22, 24 and 57 however, were resistant to the infection.

Plasmid profile: The pathogenicity of Xanthomonas axonopodis pv. manihotis is associated with a plasmid of 44 kbp (p44) carrying the effector gene pathB (Verdier et al., 1998a; Gonzalez et al., 2002). In order to study the origin of the pathogenicity of the isolated E. cloacae strains, total DNA was isolated and separated on agarose gels. Plasmids were shown to be present (Fig. 5). A Xam DNA sample characterized in our lab was also included in order to compare the plasmid profile between the two cassava pathogens. E. cloacae strains contained 3 plasmids. Two plasmids were larger than the ones present in Xam, which are very close in size (Fig. 5). Also a third plasmid, hard to separate from the genomic DNA, was observed in E. cloacae strains (not shown).

In order to check on the possibility that none of the plasmids present in E. cloacae strains have the gene enconding PathB reported by Verdier et al. (1998a), a PCR with specific primers were performed (Fig. 6), and only DNA from Xam amplified a fragment of the expected size (898 bp) indicating that a different mechanism of pathogenicity than the one present in Xam is present in E. cloacae.

DISCUSSION

In the results presented here, isolation and characterization of the causal agent of a new cassava bacterial disease is described. Physiological and biochemical characterization indicated that the causal agent of the disease was a species of E. cloacae complex. Several members of the family Enterobacteriaceae such as P. agglomerans, E. cloacae, E. cancerogenus, P. carotovorum and S. marcescens are pathogens of plants, sharing many characteristic as being rod shaped, Gram negative, non-spore forming and facultatively anaerobic among others. However, only P. carotovorum and P. agglomerans were previously described as causal agent of diseases in cassava. In the present study molecular methodologies were used to confirm the identification of the isolates. 16S rRNA gene sequencing was not useful in the identification of the strains because it has a poor discrimination power between Pantoea and Enterobacter species.

Similar results have been obtained by other authors (Sproer et al., 1999; Janda and Abbott, 2007, Rodriguez et al., 2008). On the other hand, ERIC and PCR ribotyping with GIRRN-LIRRN primers showed an identical profile to that of the E. cloacae reference strain used in this study. A different band pattern was obtained in GUA56 when compared to the P. agglomerans reference strain used. Sequencing of tuf and atpD conserved genes has been recommend by Paradis et al. (2005) since they provide a better discrimination between pairs of species belonging to the family Enterobacteriaceae. On the other hand, Hoffmann and Roggenkamp (2003), working on the population genetics of the nomenspecies E. cloacae, used a combination of sequence and PCR-restriction fragment length polymorphism analysis of three housekeeping genes hsp60, rpoB and hemB, as well as ampC gene, in order to analyze the genetic structure and the phylogenetic relationship between the clusters of the E. cloacae complex.

These authors based on the neighbor-joining tree of the hsp60 sequences, defined 13 genetic clusters in the E. cloacae complex. GUA56 hsp60 partial gene sequence confirms the identification of the isolated strains as E. cloacae ssp. cloacae. E. cloacae, an opportunistic human pathogenic bacterium, has been found as endophyte of several plant species with no deleterious effect on the host plant (Hinton and Bacon, 1995) and as seed associated bacterium suppressing seed infections (Kageyama and Nelson, 2003). E. cloacae has been also reported as pathogenic bacteria of economic important crops such as onion, papaya, ginger, apple, macadamia, dragon fruit, mulberry and mung bean sprouts (Nishijima et al., 1987; Bishop and Davis, 1990; Nishijima et al., 2004; Nishijima et al., 2007; Masyahit et al., 2009; Wang et al., 2010) and different species of orchids (Takahashi et al., 1997).

The bacterial pathogenicity of an endophyte may be related to the interaction and horizontal transfer of DNA encoding pathogenicity factors, with other microorganisms. In Venezuela, Xam is endemic in areas where cassava is traditionally grown. Very often, when the rainy season starts, watersoaked leaf lesions caused by Xam can be observed in susceptible cultivars. So, it could be of special interest to study the interaction of E. cloacae infection and Xam infection in the Anzoategui and Monagas states, where it is known that there is a high infectivity of Xam. The results obtained however, indicate that at least there is no transfer of Xam pathB gene to E. cloacae. Other pathogenicity mechanisms such as the presence of quorum sensing, biofilm formation and the production of proteolytic enzymes need to be addressed in the strains isolated, as well as the conditions that induce the expression of factors that mediates the pathogenicity of E. cloacae in plants.

CONCLUSION

This is the first report of a disease caused by Enterobacter cloacae on cassava in Venezuela. Biochemical assays and PCR based identification methods such as ribotyping, ERIC and hsp60 gene sequence identified the different isolated strains as E. cloacae.

Acknowledgement: This work was supported by Decanato de Investigaciones, USB. We wish to thank Laboratorio de Microbiologia, Clinica Leopoldo Aguerrevere for analyzing the microbiological samples; Laboratorio de Genomica, Biotechnology Center of IDEA for sequencing the DNA fragments and Laboratorio de Petroleo of IDEA for helping us with ERIC-PCR analysis and PCR ribotyping. We also thank Yhendy Garcia for technical support.

REFERENCES

Appuhamy, S., J.G. Coote, J.C. Low and R. Parton, 1998. PCR methods for rapid identification and characterization of Actinobacillus seminis strains. J. Clin. Microbiol., 36: 814-817

Beji, A., M. Mergaert, F. Gavini, F. Izard, K. Kersters, H. Leclerc and J. De Ley, 1988. Subjective synonymy of Erwinia herbicola, Erwinia milletiae, and Enterobacter agglomerans and redefinition of the taxon by genotypic and phenotypic data. Int. Syst. Bacteriol., 38: 77-88

Bishop, A.L. and R.M. Davies, 1990. Internal decay of onions caused by Enterobacter cloacae. Plant Dis., 74: 692-694

Chen, W. and T. Kuo, 1993. A simple and rapid method for the preparation of gram-negative bacterial genomic DNA. Nucleic Acids Res., 21:2260

FAOSTAT, 2007. Available on line (accessed September, 2009) http://faostat.fao.org/site/567/DesktopDefault.aspx?PageID=567#anc or

Gavini, F., J. Mergaert, A. Beji, C. Mielcarek, D. Izard, K. Kersters and J. De Ley, 1989. Transfer of Enterobacter agglomerans (Beijerinck, 1888) Ewing and Fife 1972 to Pantoea gen. nov. as Pantoea agglornerans comb. nov. and description of Pantoea dispersa sp. nov. Int. J. Syst. Bacteriol., 39: 337-345

Gonzalez, C., S. Restrepo, J. Thome and V. Verdier, 2002. Characterization of pathogenic and non-pathogenic strains of Xanthomonas axonopodis pv. manihotis by PCR-based DNA fingerprinting techniques. FEMS Microbiol. Lett., 215: 23-31

Hinton, D.M. and C.W. Bacon, 1995. Enterobacter cloacae is an endophytic symbiont of corn. Mycopathol., 129: 117-125

Hoffmann, H. and A. Roggenkamp, 2003. Population genetics of the nomenspecies Enterobacter cloacae. Appl. Environ. Microbiol., 69: 5306-5318

Janda, J.M. and S.L. Abbott, 2007. 16S rRNA gene sequencing for bacterial identification in the diagnostic laboratory: pluses, perils and pitfalls. J. Clin. Microbiol., 45: 2761-2764

Kageyama, K. and E.B. Nelson, 2003. Differential inactivation of seed exudate stimulation of Pythium ultimum sporangium germination by Enterobacter cloacae influences biological control efficacy on different plant species. Appl. Environ. Microbiol., 69: 1114-1120

Lozano, J.C., 1986. Cassava bacterial blight: A manageable disease. Plant Dis., 70: 1089-1093

Lu, J.J., C.L. Perng, S.Y. Lee and C.C. Wan, 2000. Use of PCR universal primers and restriction endonuclease digestions for detection and identification of common bacterial pathogens in cerebrospinal fluid. J. Clin. Microbiol., 38: 2076-2080

Masyahit, M., K. Sijam, Y. Awang and M. Ghazali, 2009. First report on bacterial soft rot disease on dragon fruit (Hylocereus spp.) caused by Enterobacter cloacae in peninsular Malaysia. Int. J. Agric. Biol., 11: 659-666

Murashige, T. and F. Skoog, 1962. A revised medium for rapid growth and bio-assays with tobacco tissue cultures. Physiol. Plant, 15: 473-496

Nishijima, K., H.M. Couey and A.M. Alvarez, 1987. Internal yellowing, a bacterial disease of papaya fruits caused by Enterobacter cloacae. Plant Dis., 71: 1029-1034

Nishijima, K., A.M. Alvarez, P.R. Hepperly, M.H. Shintaku, L.M. Keith, D.M. Sato, B.C. Bushe, J.W. Armstrong and F.T. Zee, 2004. Association of Enterobacter cloacae with rhizome rot of edible ginger in Hawaii. Plant Dis., 88: 1318-1327

Nishijima, K.A., M.M. Wall and M.S. Siderhurst, 2007. Demonstrating pathogenicity of Enterobacter cloacae on macadamia and identifying associated volatiles of gray kernel of macadamia in Hawaii. Plant Dis., 91: 1221-1228

Ospina, B. and H. Ceballos, 2002. La Yuca en el Tercer Milenio: Sistemas Modernos de Produccion, Procesamiento, Utilizacion y Comercializacion. Centro Internacional de Agricultura Tropical (CIAT), Cali, Colombia

Paradis, S., M. Boissinot, N. Paquette, S.D. Belaguer, E.A. Martel, D.K. Boudreau, F.J. Picard, M. Ouellette, P.H. Roy and M.G. Bergeron, 2005. Phylogeny of the Enterobacteriaceae based on genes encoding elongation factor Tu and F-ATPase b-subunit. Int. J. Syst. Evol. Microbiol., 55: 2013-2025

Restrepo, S., M.C. Duque and V. Verdier, 2000. Characterization of pathotypes among isolates of Xanthomonas axonopodis pv. manihotis in Colombia. Plant Pathol., 49: 680-687

Rodriguez, M., J. Matehus, A. Gerstl and M.A. Santana, 2008. Isolation and identification of a phytopathogenic bacteria from water yam (Dioscorea Alata L.). Interciencia, 33: 532-536

Sambrook, J., T. Maniatis and E.F. Fritsch, 1989. Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory Press, New York, USA

Sanchez, G.M. and V. Verdier, 1998. Evaluacion de la resistencia de la yuca al anublo bacteriano causado por Xanthomonas axonopodis pv. manihotis. Fitopatol. Colom., 22: 94-97

Schaad, N.W., J.B. Jones and W. Chun, 2001. Laboratory guide for identification of Plant Pathogenic Bacteria, 3rd edition. APS Press, St. Paul, Minnesota, USA

Sproer, C., U. Mendrock, J. Swiderski, G. Lang and E. Stackebrandt, 1999. The phylogenetic position of Serratia buttiauxella and some other genera of the familiy Enterobacteriaceae. Int. J. Syst. Bacteriol., 44: 846-849

Takahashi, Y., K. Takahashi, M. Sato, K. Watanabe and T. Kawano, 1997. Bacterial leaf rot of Odontioda orchids caused by Enterobacter cloacae. Annl. Phytopathol. Soc. Japan, 63: 164-169

Verdier, V., G. Mosquera and K. Assigbetse, 1998a. Detection of the Cassava Bacterial Blight pathogen, Xanthomonas axonopodis pv. manihotis, by Polymerase Chain Reaction. Plant Dis., 82: 79-83

Verdier, V., S. Restrepo, G. Mosquera, M.C. Duque, A. Gerstl and R. Laberry, 1998b. Genetic and pathogenic variation of Xanthomonas axonopodis pv. manihotis in Venezuela. Plant Pathol., 47: 601-608

Versalovic, J., T. Koeuth and J.R. Lupski, 1991. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res., 19: 6823-6831

Wang, G.F., G.L. Xie, B. Zhu, J.S. Huang, B. Liu, P. Kawicha, L. Benyon and Y.P. Duan, 2010. Identification and characterization of the Enterobacter complex causing mulberry (Morus alba) wilt disease in China. European J. Plant Pathol., 126: 465-478

M.A. SANTANA, M. RODRIGUEZ, J. MATEHUS, J. FAKS, A. BOCSANCZY, A. GERSTL, G. ROMAY, J. MONTILLA, C.E. FERNANDE, N. MORENO ZAMBRANO AND D. MARVAL

Universidad Simon Bolivar, Division de Ciencias Biologicas, Departamento de Biologia Celular, Caracas 1080, Venezuela, +Instituto de Estudios Avanzados, Centro de Biotecnologia, Laboratorio de Biotecnologia Agricola, Caracas 1080, Venezuela, ++Agroindustrial Mandioca C.A., Temblador, Estado Monagas, Venezuela, Instituto Nacional de Investigaciones Agricolas, Estacion El Tigre, El Tigre, Estado Anzoategui, Venezuela, Universidad del Zulia, Facultad de Agronomia, Departamento de Botanica, Maracaibo 15205, Estado Zulia, Venezuela, Instituto Nacional de Investigaciones Agricolas, Estacion Sabaneta, Sabaneta, Estado Barinas, Venezuela, Undergraduate Program. Universidad Catolica Andres Bello, Escuela de Educacion, Caracas 1080, Venezuela, 1Corresponding author's e-mail: msantana@usb.ve,

To cite this paper: Santana, M.A., M. Rodriguez, J. Matehus, J. Faks, A. Bocsanczy, A. Gerstl, G. Romay, J. Montilla, C.E. Fernande, N. Moreno Zambrano and D. Marval, 2012. A new bacterial disease of cassava in venezuela caused by Enterobacter cloacae. Int. J. Agric. Biol., 14: 183-189
COPYRIGHT 2012 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Santana, M.A.; Rodriguez, M.; Matehus, J.; Faks, J.; Bocsanczy, A.; Gerstl, A.; Romay, G.; Montilla,
Publication:International Journal of Agriculture and Biology
Article Type:Report
Geographic Code:3VENE
Date:Apr 30, 2012
Words:4690
Previous Article:Enhancement of Efficacy in Controlling Postharvest Decays and Extending Shelf Life of Mangoes by Combined Pre- and Post- harvest Chemical...
Next Article:Biochemical and Nutritional Evaluation of Unleavened Flat Breads Fortified with Healthy Flaxseed.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters