Printer Friendly

-gingerol dampens hepatic steatosis and inflammation in experimental nonalcoholic steatohepatitis.

ABSTRACT

The aim of the study was to investigate the effects of [6]-gingerol ((S)-5-hydroxy-l-(4-hydroxy-3methoxyphenyl)-3- decanone) in experimental models of non-alcoholic steatohepatitis. HepG2 cells were exposed to 500 [micro]mol/l oleic acid (OA) for 24 h and preincubated for an additional 24 h with [6]-gingerol (25, 50 or 100 [micro]mol/l). [6]-Gingerol (100 [micro]mol/l) inhibited OA-induced triglyceride and inflammatory marker accumulation in HepG2 cells. After being fed a high-fat diet (HFD) for 2 weeks, male golden hamsters were dosed orally with [6]-gingerol (25,50 or 100 mg/kg/day) once daily for 8 weeks while maintained on HFD. [6]-Gingerol (100 mg/kg/day) alleviated liver steatosis, inflammation, and reversed plasma markers of metabolic syndrome in HFD-fed hamsters. The expression of inflammatory cytokine genes and nuclear transcription factor-[kappa]B(NF-[kappa]B) were increased in the HFD group; these effects were attenuated by [6)-gingerol. The hepatic mRNA expression of lipogenic genes such as liver X receptor-[alpha], sterol regulating element binding protein-1c and its target genes including acetyl-CoA carboxylase, fatty acid synthase, stearoyl-CoA desaturase 1, and acyl-CoA:diacylglycerol acyltransferase 2 in HFD-fed hamsters was also blocked by [6]-gingerol. [6]-Gingerol may attenuate HFD-induced steatohepatitis by downregulating NF-[kappa]B-mediated inflammatory responses and reducing hepatic lipogenic gene expression.

Keywords:

[6)-Gingerol

Inflammation

Lipogenesis

Nuclear transcription factor [kappa]B

Steatohepatitis

Introduction

Non-alcoholic fatty liver disease (NAFLD) refers to a wide spectrum of liver diseases ranging from simple fatty liver (steatosis) to nonalcoholic steatohepatitis (NASH) and cirrhosis. NASH pathology is characterized by microvesicular or macrovesicular steatosis, inflammation, hepatocyte degeneration, and sometimes fibrosis (Schuppan and Schattenberg 2013). A variety of liver cells including hepatocytes, hepatic macrophages, and hepatic stellate cells are involved in the pathogenesis of NASH (Xu et al. 2010). In particular, inflammatory processes secondary to insulin resistance are regarded as a characteristic finding of NASH (McCullough 2006). Among the inflammatory mediators, chemokines play pivotal roles in the recruitment of various cells, including immune cells, to the sites of inflammation through interactions with chemokine receptors (Braunersreuther et al. 2012). Inflammatory mediators such as tumor necrosis factor-[alpha] (TNF-[alpha]) and interleukin (IL)-1[beta] further stimulate hepatocytes and hepatic stellate cells to induce hepatocyte steatosis and fibrosis, respectively. The interactions of cytokines and growth factors with their receptors initiate different signaling pathways, leading to the activation of multiple transcriptional factors, such as nuclear transcription factor-[kappa]B (NF-[kappa]B), which also has a role in liver fibrogenesis (Oakley et al. 2005). Currently, there is no approved therapy for NAFLD, and research efforts to identify effective treatment strategies have been mostly unsuccessful. Nevertheless, therapies targeting the occurrence of inflammation are particularly appealing for this condition.

Zingiber zerumbet (L) Smith (Zingiberaceae family), commonly known as the pinecone or shampoo ginger, has gained much interest from scientists all over the world because of its high medicinal values (Yob et al. 2011). It has been an important plant for the traditional Chinese and Indian pharmacopeias and is widely used to relieve muscular aches, rheumatism, pains, coughs, sinusitis, sore throats, diarrhea, cramps, indigestion, loss of appetite, motion sickness, fever, flu, chills and other infectious diseases (Yob et al. 2011). The ethanol extract of Z. zerumbet recently has been found to attenuate fat accumulation in liver, improving insulin resistance, inhibiting inflammation, and repressing hepatic lipogenesis (Chang et al. 2014). [6]-Gingerol ((S)5-hydroxy-l-(4-hydroxy-3-methoxyphenyl)-3- decanone) is an aromatic polyphenol and one of the pungent constituents of Z. zerumbet (Chang et al. 2012). It has an inhibitory effect on xanthine oxidase responsible for generation of reactive oxygen species like superoxide anion (Chang et al. 1994). Mounting evidence suggests that [6]-gingerol has varied pharmacological activities including antioxidant, anti-inflammatory, anticancer, analgesic and antiplatelet effects (Guh et al. 1995; Young et al. 2005; Kim et al. 2007). [6]-Gingerol has been shown to block the NF-[kappa]B pathway through suppressing the cytokine-induced oxidative stress (Li et al. 2013). These results may open novel treatment options whereby [6]-gingerol could potentially protect against hepatic inflammation which underlies the pathogenesis of chronic diseases such as insulin resistance, type 2 diabetes mellitus, atherosclerosis, and NAFLD.

There is strong evidence that the prevalence of NAFLD worldwide has increased substantially over the past decades, in parallel with the global trends in over-nutrition. The high-fat diet (HFD)-induced animal model of NAFLD has been widely used to study disease pathogenesis and to evaluate new treatments (Bhathena et al. 2011). The lipoprotein profiles of hamsters are more similar to humans than to those of mice or rats (de Silva et al. 2004). Therefore, this study was undertaken to determine if [6]-gingerol can prevent the development of steatosis and limit the expression of inflammatory genes in hamsters fed a HFD. Hepatic steatosis in human beings is associated with accumulation of excess oleic acid (OA), a monounsaturated omega-9 fatty acid and the end product of de novo fatty acid synthesis (Araya et al. 2004). Treatment of HepG2 cells, a human hepatoblastoma cell line, with OA induces morphological similarities to steatotic hepatocytes (Janorkar et al. 2009). These effects of [6]-gingerol on NAFLD/NASH were further characterized by OA induced hepatic steatosis in HepG2 cells.

Materials and methods

Cell cultures

Human hepatoma HepG2 cells were obtained from the Bioresource Collection and Research Center (BCRC 60025) of the Food Industry Research and Development Institute (Hsinchu, Taiwan). The cells were cultured in minimum essential medium containing fetal bovine serum (10% by volume), l -glutamate (2 mmol/l), sodium pyruvate (1 mmol/l), penicillin (100 U/ml), streptomycin (100 [micro]g/ml), and sodium pyruvate (1 mmol/l) at 37[degrees]C in a humidified atmosphere containing 5% C[0.sub.2].

The cells were grown to 70% confluence and incubated in serumfree medium (starvation) for 24 h before treatments. After 24 h of serum-starvation, cells were treated for 24 h with 25, 50, or 100 [micro]mol/l [6]-gingerol ([greater than or equal to] 98%; Sigma-Aldrich Co.; Cat. No. G1046) or Bezalip (100 [micro]mol/l; bezafibrate; Roche Molecular Biochemicals, Almere, The Netherlands) before they were exposed to 500 [micro]mol/l OA (Sigma-Aldrich Co., St. Louis, MO; Cat. No. P0500) for another 24 h. [6]-gingerol, Bezalip or OA were dissolved in 0.1% dimethyl sulfoxide (DMSO; Sigma-Aldrich Co.), medium or 0.1 % ethanol, respectively, and added to the culture media to the final concentration specified. DMSO at this concentration does not modify the cell viability (data not shown). Cells treated with 0.1% DMSO served as the untreated control. The concentration regime was selected based on the previous report demonstrating that [6]-gingerol protects hepatocellular carcinoma HuH7 cells against IL-1[beta]-induced inflammatory insults (Li et al. 2013). Cell viability was assayed using 3-(4,5-dimethylthiazol-2yl)-5-(3 carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS; Promega, Madison, WI, USA). Subconfluent monolayers of HepG2 cells were stained with Oil-Red-O (Sigma-Aldrich Co.) to determine fat accumulation.

Cell viability assay

OA-treated HepG2 were seeded at a density of 1 x [10.sup.5] cells/ml in 96-well plates. The plates were then incubated for 24 h at 37[degrees]F under 5% C[O.sub.2]. MTS solution (5 mg/ml) was added to each well, and the cells were cultured for another 2 h, after which the optical density was read at 490 nm. The percentage of cell viability was calculated using the following equation: % viability = 100 x (mean absorbance of treated cells/mean absorbance of control).

Oil Red O stain

OA-induced lipid accumulation in HepG2 cells was evaluated by Oil Red O staining. Briefly, the cells were rinsed with cold phosphate buffered saline and fixed for 30 min in 10% paraformaldehyde. After washing the cells with 60% isopropanol, they were stained for at least 1 h in a freshly diluted Oil Red O solution (6 parts Oil Red O stock solution and 4 parts [H.sub.2]0; Oil Red O stock solution is 0.5% Oil Red O in isopropanol). The stain was removed, and the cells were washed with 60% isopropanol, after which each group was photographed. The stained lipid droplets were then extracted with isopropanol to be quantified by measuring absorbance at 490 nm.

Measurement of cholesterol and triglycerides in HepG2 cells

Cells were lysed in 1% Triton X-100 in PBS. The cellular cholesterol (Choi) and triglycerides (TG) levels were measured using enzymatic colorimetric assay kits. EnzyChrom[TM] AF cholesterol assay kit and EnzyChrom[TM] triglyceride assay kit were purchased from BioAssay Systems (CA, USA). Cellular protein concentration was determined using a Bio-Rad protein assay kit (Bio-Rad Laboratories, Japan), using bovine serum albumin as a standard. Cellular Choi and TG were normalized to cellular protein content.

Measurement of cytokines in HepG2 cells

Cell cultures were centrifuged at 10,000 x g for 10 min at 4[degrees]C, and the supernatants were stored at -20[degrees]C before analysis. Secretory levels of inflammatory cytokines, including monocyte chemoattractant protein-1 (MCP-1) (Cat. No. abl 00721), TNF-[alpha] (Cat. No. ab46070). IL-1[beta] (Cat. No. abl 00768), and 1L-6 (Cat. No. abl 00772), in cell-free culture supernatants were determined by commercial enzyme-linked immunosorbent assay (ELISA) (Abeam Inc., Cambridge, MA, USA). The color generated was determined by measuring the optical density (OD) at 450 nm on a spectrophotometric microtiter plate reader (Molecular Devices Corp., Sunnyvale, CA, USA). A standard curve was run on each assay plate using recombinant proteins in serial dilutions.

Animal and experimental protocols

Male Golden Syrian hamsters, 8 weeks old and weighing 90 [+ or -] 10 g, were obtained from the National Laboratory Animal Center (Taipei, Taiwan). They were maintained in a temperature-controlled room (25 [+ or -] 1[degrees]C) on a 12 h:12 h light-dark cycle (lights on at 06:00 h) in our animal center. Food and water were provided ad libitum. Normal diet (#D12450B, Research Diets, New Brunswick, NJ) containing 811 kcal protein, 2840 kcal carbohydrate, and 405 kcal fat from lard was used as the maintenance and control diet (CD). A purified ingredient HFD containing 811 kcal protein, 1420 kcal carbohydrate, and 1825 kcal fat primarily from lard (#D12451, Research Diets) was used to induce a rapid increase in body weight and obesity (Van Heek et al. 1997). All animal procedures were performed according to the Guidelines for the Care and Use of Laboratory Animals of the National Institutes of Health (United States), as well as the guidelines of the Taiwanese Animal Welfare Act These studies were conducted with the approval of the Institutional Animal Care and Use Committee (IACUC) at Tajen University (approval number, IACUC 102-16; approval date, December 24, 2013).

After being fed a HFD for 2 weeks, hamsters received treatment along with consuming the HFD during 8 week treatment period. [6]-Gingerol suspended in distilled water was administered to HFD-fed hamsters once daily via oral gavage at doses of 25,50, or 100 mg/kg in a volume of 2 ml/kg distilled water. The dosage regimen was selected based on a previous report demonstrating that [6]-gingerol was potentially effective in decreasing hyperlipidemia in diabetic db/db mice (Singh et al. 2009). Another group of HFD-fed hamsters was treated orally with Bezalip (10 mg/kg/day) dissolved in distilled water, a dose based on a study indicating that long-term treatment ameliorates hyperlipidemia and fatty liver in a rat model of NAFLD (Schmilovitz-Weiss et al. 2013). A third group of HFD-fed and CD-fed hamsters were treated similarly but with the same volume of vehicle (distilled water) as was used to prepare the test compounds solution during the same treatment period.

Following the 8-week treatment (total diet-fed period was 10 weeks), animals were weighed, fasted for 12 h, and anesthetized by intraperitoneal injection of a mixture of ketamine (100 mg/kg) and xylazine (20 mg/kg). Blood samples from the inferior vena cava were collected into heparinized syringe (15 U/ml blood). The left lobe of liver was removed, rinsed with physiological saline. One third of the left lobe of liver was used to hepatic lipids and cytokines determination, another part of the left liver was stored immediately at -80[degrees]C in liquid nitrogen until assayed. Right lobe of liver was fixed in 10% neutralized formalin for histology. The liver index was calculated as liver weight divided by body weight.

Determination of metabolic parameters

Blood samples were centrifuged at 2000 x g for 10 min at 4[degrees]C. The plasma was removed and placed into aliquots for analyses. Plasma glucose concentration was determined using kits from Cayman Chemical Company (Ann Arbor, MI; Cat. No. 10009582). Plasma insulin concentration was quantified using ELISA kits (L1NCO Research, Inc., St. Charles, MO; Cat. #EZRM1-13K). Whole-body insulin sensitivity was estimated using the homeostasis model assessment of insulin resistance (HOMA-IR) according to the formula: insulin sensitivity = [fasting plasma glucose (mmol) x fasting plasma insulin (mU/ml)]/22.5 (Matthews et al. 1985). Hamster leptin (Cat. # MBS043292) and adiponectin (Cat. # MBS023583) ELISA kits were purchased from MyBioSource, Inc. (San Diego, CA, USA). Diagnostic kits for determining plasma levels of total cholesterol (TC; Cat. # 10007640) and TG (Cat. # 10010303) were purchased from Cayman Chemical Company. Plasma high density lipoprotein cholesterol (HDL-C) was determined with a kit from Bio-Quant Diagnostics (Cat. # BQ019CR; San Diego, CA, USA), and plasma low density lipoprotein cholesterol (LDL-C) was determined using an ELISA kit from Antibodies-Online Inc. (Atlanta, GA, USA.; Cat. # ABIN416222). Plasma free fatty acid (FFA) levels were quantified using a kit obtained from Abeam pic (Cambridge, MA, USA; Cat. # ab65341). All experimental assays were carried out according to the manufacturers' instruction; all samples were analyzed in triplicate.

Measurement of hepatic lipids and cytokines

Hepatic lipid content was determined from fresh liver samples. Liver (1.25 g) was homogenized with chloroform/methanol (1:2, 3.75 ml) and mixed well with chloroform (1.25 ml) and distilled water (1.25 ml). After centrifuging for 10 min at 1500 x g, the lower clear organic phase was transferred into a new glass tube and then lyophilized. The lyophilized powder was dissolved in chloroform/methanol (1:2) and stored at -20[degrees]C for less than 3 days (Folch et al. 1957). Hepatic TC and TG levels in the lipid extracts were analyzed using the same diagnostic kits used for plasma analysis.

For hepatic cytokines measurement, liver samples were homogenized in 10 mmol/l Tris-HCl buffered solution (pH 7.4) containing 2 mol/1 NaCl, 1 mmol/l EDTA, 0.01% Tween 80,1 mmol/l PMSF, and centrifuged at 9000 x g for 30 min at 4[degrees]C. The resultant supernatant was used for cytokine determination using the same diagnostic kits used to measure cytokines in HepG2 cells.

Histological analysis of the liver

For histopathological analysis, liver specimens fixed in 10% neutral-buffered formalin were embedded in paraffin, sliced at 5-[micro]m thickness, and stained with hematoxylin and eosin to evaluate the degree of hepatic steatosis. Liver tissues were scored for hepatic steatosis: 0 (no steatosis), 1 (1-25%), 2 (26-50%), 3 (51-75%), and 4 (76-100%) of hepatocytes affected. The tissues were also scored for inflammation: 0 (no inflammation), 1 (mild lobular/portal inflammation), 2 (moderate lobular/portal inflammation), and 3 (severe lobular/portal inflammation) (Kleiner et al. 2005). All slides were scanned at a total magnification of 200 x using Image Pro Plus 7.0 software (Media Cybernetics) under a light microscope (Olympus BX51 microscope; Tokyo, Japan).

NF-[kappa]B activity measurement

Nuclear extracts of liver from the control and HFD animals were prepared using a nuclear extract kit (Active Motif, CA, USA; Cat. No. 40010). NF-[kappa]B activity was measured from nuclear extracts (20 [micro]g) using the TransAM NF-[kappa]B p65 transcription factor assay kit (Active Motif; Cat. No. 40096) according to the manufacturer's instruction.

Western blotting

Liver tissues were homogenized in 1 ml ice-cold hypotonic buffer A (10 mmol/l HEPES, 10 mmol/l KCl, 2 mmol/l Mg[Cl.sub.2], 1 mmol/l DTT, 0.1 mmol/l EDTA, 0.1 mmol/l phenylmethylsulfonylfluoride) at pH 7.8. The cells were then lysed with 12.5 [micro]l 10% Nonidet P-40. The homogenate was centrifuged at 800 x g for 5 min at 4[degrees]C, and supernatant containing the cytoplasmic extract was stored frozen at -80[degrees]C. The nuclear pellet was resuspended in 25 [micro]l ice-cold nuclear extraction buffer (20 mmol/l HEPES, 0.4 mmol/l NaCl, 1 mmol/l EDTA, 25% glycerol, protease inhibitors 1x). After 30 min of intermittent mixing, the extract was centrifuged at 14000 x g for 10 min at 4[degrees]C, and supernatants containing nuclear extracts were secured.

Before immunoblotting, the protein concentration of each tissue was determined using a Bio-Rad protein assay kit (Bio-Rad Laboratories, Japan), with BSA as a standard to ensure equal loading among lanes. Cytosolic (70 [micro]g total protein) and nuclear (50 [micro]g total protein) extracts were separated on a 7.5-15% polyacrilamide gel and transferred electophoretically to nitrocellulose membranes. Membranes were blocked with 5% non-fat dry milk in Tris-buffered saline Tween (20 mmol/l Tris, pH 7.6,137 mmol/l NaCl, and 0.1 % Tween 20) for 3 h at room temperature and incubated overnight at 4[degrees]C with inhibitory kappa B (I[kappa]B[alpha], Santa Cruz Biotechnology, Inc.; Cat. No. sc-371) and NF-[kappa]B p65 (Santa Cruz Biotechnology, Inc.; Cat. No. sc-109) primary antibodies. The level of [alpha]-tubulin (Santa Cruz Biotechnology Inc.; Cat. No. sc-31779) was estimated for equal loading of sample. Membranes were washed three times with Tris-buffered saline Tween 20 (TBST) and incubated for 1 h at room temperature with appropriate horseradish peroxidase-conjugated secondary antibodies. After three additional TBST washes, the immunoreactive bands were visualized by enhanced chemiluminescence (Amersham Biosciences, Buckinghamshire, UK) according to the manufacturer's instructions. Band densities were determined using ATTO Densitograph Software (ATTO Corporation, Tokyo, Japan). All experimental sample values were expressed relative to this adjusted mean value. Tissue sections were sampled from four independent experiments.

Analysis of mRNA expression of hepatic genes

To analyze gene expression, total RNA was extracted from 100-mg frozen liver samples using Trizol reagent (Invitrogen; Boston, MA, USA). RNA was quantified by A260, and its integrity verified by agarose gel electrophoresis using ethidium bromide for visualization. For the reverse transcriptase reaction, 1 [micro]g of total RNA per sample and 8.5 [micro]g/[micro]l random hexamer primers were heated to 65[degrees]C for 5 min, and then quenched on ice. This mixture was combined with 500 [micro]mol/l each of dATP, dTTP, dCTP, and dGTP, 10 mmol/l DTT, 20 mmol/l Tris-HCl (pH 8.4), 50 mmol/l KCl, 5 mmol/l Mg[Cl.sub.2], 40 U of RNaseOUT recombinant ribonuclease inhibitor (Invitrogen), and 100 U Superscript III reverse transcriptase (Invitrogen). Samples were treated with DNase (Promega; Madison, WI, USA) for 20 min at 37[degrees]C in a GeneAmp 9700 Thermal Cycler (Applied Biosystems; Foster City, CA, USA) and then held at 4[degrees]C. After aliquots were taken for immediate use in polymerase chain reaction (PCR), the remainder of the cDNA was stored at -20[degrees]C. mRNA expression was measured by quantitative real-time PCR (RT-PCR) in a fluorescent temperature Lightcycler 480 (Roche Diagnostics; Mannheim, Germany). Primers for amplification of each gene are listed in Table 1. The highly specific measurement of mRNA was carried out for MCP-1, TNF-[alpha], IL-1[beta], IL-6, sterol regulating element binding protein-1c (SREBP-1c), liver X receptor-[alpha] (LXR-[alpha]), acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), stearoylCoA desaturase 1 (SCD1), acyl-CoA:diacylglycerol acyltransferase 2 (DGAT-2), and [beta]-actin using the LightCyder system (Bio-Rad). Each sample was run and analyzed in duplicate. Primers were designed using Primer Express Software version 2.0 System (Applied Biosystems; Foster City, CA, USA). The PCR reaction was performed using the following cycling protocol: 95[degrees]C for 5 min, 45 cycles of 95[degrees]C for 5 s, 58[degrees]C for 15 s, and 72[degrees]C for 20 s. Dissociation curves were run after amplification to identify the specific PCR products. All mRNA levels were normalized to [beta]-actin mRNA values and the results expressed as fold changes of the threshold cycle (Ct) value relative to controls using the delta-delta Ct method (Livak and Schmittgen 2001). To ensure amplification specificity during RT-PCR, amplified products were subjected to agarose gel electrophoresis to visually confirm the presence of a single amplicon of the expected size.

Statistical analysis

Data are expressed as mean [+ or -] standard error mean (SEM). Statistical analyses were performed using one-way analysis of variance. Dunnett range post-hoc comparisons were used to determine the source of significant differences, where appropriate. For the histological study, a non-parametric Kruskal-Wallis test was performed and Mann-Whitney's U test was used to compare data within the groups. The SigmaPlot (Version 11.0) program was used for statistical analysis. Values of p < 0.05 were considered statistically significant.

Results

Effects of treatment on intracellular lipid accumulation and inflammatory cytokines in OA-treated HepC2 cells

HepG2 cells treated for 24 h with OA exhibited significant lipid droplet accumulation compared with untreated cells (Fig. 1A and B). Preincubation of cells with [6]-gingerol significantly reduced OA-induced lipid deposition, and the most effective inhibition of lipid accumulation was observed at a concentration of 100 [micro]mol/l [6]gingerol (Fig. 1B and C). Treatment with OA resulted in an obvious increase in Choi and TG content compared with untreated cells, and this was attenuated significantly by pretreatment with [6]-gingerol (100 [micro]mol/l; Fig. 1C). The deposition of lipid and increases in Choi and TG content in OA-treated HepG2 cells were also abolished by preincubation with Bezalip (Fig. 1A-C).

Fig. 1D shows that exposure of HepG2 cells to OA significantly increased the production of MCP-1, TNF-[alpha], 1L-1[beta], and IL-6 relative to non-OA treated cells. Pretreatment with [6]-gingerol (100 [micro]mol/l) for 24 h significantly attenuated the OA-induced production of all these inflammatory cytokines. Bezalip (100 [micro]mol/l) almost eliminated OA-evoked production of MCP-1, TNF-[alpha], IL-1[beta], and IL-6 in HepG2 cells.

Effects of treatment on body weight, liver weight index, and plasma biochemical parameters in hamsters

At the end of 8 weeks of treatment, high doses of [6]-gingerol (100 mg/kg/day) significantly reduced body weight gain and the liver weight index in HFD-fed hamsters (Table 2). Similar results were seen in HFD-fed hamsters treated with Bezalip (10 mg/kg/day) (Table 2).

[FIGURE 1 OMITTED]

Treatment of HFD-fed hamsters with [6]-gingerol (100 mg/kg/day) or Bezalip (10 mg/kg/day) decreased HOMA-IR and plasma leptin and insulin levels (Table 2). Plasma adiponectin was elevated in HFD-fed hamsters treated with [6]-gingerol (100 mg/kg/day) or Bezalip (10 mg/kg/day) (Table 2). Although the higher plasma glucose level in HFD-fed hamster tended to decrease with [6]-gingerol (100 mg/kg/day) or Bezalip (10 mg/kg/day) treatment, no significant differences were observed among the groups over the experimental period (Table 2).

Effects of treatment on plasma and hepatic lipids in hamsters

Oral administration of [6]-gingerol at a dose of 25, 50, or 100 mg/kg/day reduced plasma TC levels by 23.9%, 30.9%, and 38.9%, respectively, in HFD-fed hamsters (Table 2). The plasma levels of TG, LDL-C, and FFA in HFD-fed hamsters receiving 100 mg/kg/day [6]-gingerol treatment were decreased by 26.5%, 56.4%, and 32.1% respectively, compared to their vehicle-treated counterparts (Table 2). Plasma TC, TG, LDL-C, and FFA levels were reduced by 39.6%, 30.6%, 58.6%, and 38.3% respectively, in Bezalip (10 mg/kg/day)-treated HFD-fed hamsters compared to their vehicle-treated counterparts (Table 2). The plasma HDL-C concentrations in HFD-fed hamsters receiving [6]-gingerol (100 mg/kg/day) or Bezalip (10 mg/kg/day) were increased, approaching the levels in the CD-fed group (Table 2).

Hepatic TC and TG levels were significantly higher in HFD-fed hamsters compared with hamsters from the CD-fed group, and these were reduced by 29.1 % and 36.7%, respectively, in HFD-fed hamsters treated with [6]-gingerol (100 mg/kg/day; Table 2). Bezalip (10 mg/kg/day) treatment also reduced hepatic TC and TG levels to 32.6% and 39.9% of that in vehicle-treated HFD-fed hamsters, respectively (Table 2).

Effects of treatment on liver histology

Administration of the HFD diet to hamsters resulted in a classical pathophysiological picture of NAFLD, with microvesicular and macrovesicular steatosis and multiple foci of inflammatory cell accumulation in the liver (Fig. 2). Representative histological photomicrographs of liver specimens show the number of macrovascular fat droplets and mild inflammatory foci in the livers of HFD-fed hamsters were reduced after [6]-gingerol (100 mg/kg/day) treatment. Bezalip (10 mg/kg/day) treatment also improved hepatic steatosis and reduced hepatic inflammation in HFD-fed hamsters (Fig. 2). Histological grading of liver sections confirmed that both Bezalip and [6]-gingerol ameliorated both hepatic steatosis and inflammation (Table 3).

Effects of treatment on inflammatory cytokines in hamsters

HFD-fed hamsters had greater hepatic concentrations of MCP-1, TNF-[alpha], IL-1[beta], and 1L-6 protein and mRNA compared to the CD-fed group (Tables 2 and 4). Both the protein and mRNA levels of hepatic cytokines in [6]-gingerol (100 mg/kg/day)-treated HFD-fed hamsters were lower than those of vehicle-treated counterparts (Tables 2 and 4). In addition, Bezalip (10 mg/kg/day) treatment also reduced hepatic cytokine protein and mRNA levels to those of CD-fed animals (Tables 2 and 4).

Effects of treatment on hepatic expression of I[kappa]B[alpha] and NF-[kappa]B and NF-[kappa]B binding activity

Cytosolic I[kappa]B[alpha] in the liver of HFD-fed hamsters was reduced to 55.2% of that in the normal group, and [6]-gingerol (100 mg/kg/day) treatment reduced I[kappa]B[alpha] degradation in a dose-dependent manner (Fig. 3A). Treatment of HFD-fed hamsters with Bezalip (10 mg/kg/day) increased the cytosolic I[kappa]B[alpha] protein level to 95.2% of that in the CD-fed group (Fig. 3A).

The hepatic level of cytosolic NF-[kappa]B p65 protein in HFD-fed hamsters was clearly lower than that of CD-fed hamsters and was upregulated by treatment with [6]-gingerol (100 mg/kg/day) or Bezalip (10 mg/kg/day), which produced increases of 216.2% and 227.9%, respectively (Fig. 3A). The HFD-induced upregulation of nuclear NF-[kappa]B p65 protein was reduced by 39.1% and 58.4% relative to that in vehicle-treated HFD-fed hamsters after 8 weeks of treatment with [6]-gingerol (100 mg/kg/day) or Bezalip (10 mg/kg/day), respectively (Fig. 3A).

The DNA binding activity of NF-[kappa]B p65 was significantly greater in the livers of HFD-fed hamsters compared to the CD-fed group (Fig. 3B). [6]-Gingerol (100 mg/kg/day)-treated HFD-fed hamsters had 45.3% lower NF-[kappa]B p65 binding activity in liver than that of their vehicle-treated counterparts (Fig. 3B). Bezalip suppressed the hepatic NF-[kappa]B p65 binding activity of HFD-fed hamsters by 56.5% relative to that of their untreated counterparts (Fig. 3B).

[FIGURE 2 OMITTED]

Effects of treatment on hepatic mRNA expression of lipogenic genes

HFD feeding markedly increased the hepatic mRNA levels of SREBP-lc in hamsters to 2.8-fold that of the CD-fed group (Table 4). [6]-Gingerol (100 mg/kg/day) suppressed the HFD-induced increase in hepatic mRNA levels of SREBP-1 c by 33.5% relative to vehicle-treated counterparts (Table 4). Hepatic SREBP-lc mRNA levels were significantly reduced (by 38.9%) in Bezalip-treated HFD-fed hamsters compared to their vehicle-treated counterparts (Table 4).

HFD caused a 3.3-fold induction of hepatic LXR-a mRNA, and a 2.5-fold induction of hepatic ACC mRNA over those of the CD-fed group (Table 4). The HFD-induced mRNA levels of LXR-a and ACC in liver were reduced significantly (40.2% and 39.9% reduction, respectively) by treatment with [6]-gingerol (100 mg/kg/day) compared to those of vehicle-treated counterparts (Table 4). Administration of Bezalip to HFD-fed hamsters for 8 weeks caused a 55.4% and 57.3% down-regulation of hepatic LXR-a and ACC mRNA levels, respectively, relative to those in vehicle-treated hamsters, respectively (Table 4).

Hepatic mRNA levels of FAS, SCD-1, and DGAT-2 in HFD-fed hamsters were clearly higher than those of the CD-fed group and were down-regulated by (6]-gingerol (100 mg/kg/day) treatment (44.9%, 48.1%, and 43.8% decreases, respectively); similar results were obtained in the Bezalip-treated HFD-fed group (Table 4).

Discussion

Inflammation plays a pivotal role in NAFLD, and an important pharmacological objective in treating this disorder is the direct targeting of inflammatory activation (Braunersreuther et al. 2012). Our data demonstrate that exposure of HepG2 cells to OA results in lipid accumulation and the overproduction of inflammatory cytokines such as MCP-1, TNF-[alpha], IL-1[beta] and IL-6. This is in agreement with a previous study that showed plasma concentrations of FFAs were increased in patients with NAFLD and correlated with the development of more severe liver disease (Nehra et al. 2001). Our study demonstrates that preincubation with [6]-gingerol significantly attenuates the accumulation of lipids and alleviates the overproduction of cellular fatty drops and inflammatory cytokines in HepG2 cells exposed to excess OA. These data indicate that [6]-gingerol might be effective in preventing and reversing lipid accumulation and the inflammatory response, which may accelerate liver injuries in NAFLD/NASH. As [6]-gingerol inhibits the accumulation of lipids in HepG2 cells this may be the primary protective mechanism exerted by the compound which would prevent all following inflammatory reactions. To examine this further, we tested the effect of [6]-gingerol on hepatic steatosis and inflammation using an in vivo NAFLD model induced by a HFD in hamsters (Bhathena et al. 2011). We found that [6]-gingerol significantly decreased liver weight index and levels of TG, TC, and FFA in the plasma and livers of HFD-fed hamsters. In addition, [6]-gingerol attenuated the development of HFD-induced hepatic steatosis and injury as assessed by microscopic analysis, suggesting that [6]-gingerol has the beneficial effects of preventing lipid accumulation and reversing disrupted liver structure.

Overnutrition-induced chronic inflammation is a key contributor to the pathogenesis of insulin resistance and metabolic syndrome (Lionetti et al. 2009). Therefore, we investigated whether [6]-gingerol could improve fatty liver changes by decreasing inflammatory cytokines in the HFD-induced NAFLD hamsters. Administration of [6]-gingerol during NAFLD development significantly attenuated the expression of MCP-1, TNF-[alpha], IL-1[beta], and IL-6 in the livers of HFD-fed hamsters. These results support the idea that the therapeutic effect of [6]-gingerol on fatty liver may be associated with the regulation of the inflammatory cytokines. Actually, these inflammatory cytokines can induce insulin resistance (Kanda et al. 2006; Schwabe and Brenner 2006; Bhathena et al. 2011). Patients with type 2 diabetes are at a higher risk of NAFLD and other inflammatory processes (Marchesini et al. 2005). HFD-fed hamsters in the present study also showed significant increases in plasma insulin and leptin levels, as well as HOMA-IR, but a remarkable decrease in plasma adiponectin levels. These abnormalities were improved significantly by [6]-gingerol treatment, suggesting that [6]-gingerol may positively influence fatty liver changes in type 2 diabetes and in the insulin-resistant state.

An increasing number of studies have demonstrated that the activation of NF-[kappa]B and the subsequent coordinated expression of gene products may play important roles in the pathogenesis of NAFLD (Dela et al. 2005; Videla et al. 2009; Velayudham et al. 2009). The activation of cytosolic NF-[kappa]B is tightly regulated by inhibitory protein I[kappa]B and involves phosphorylation, ubiquitination, and proteolysis of I[kappa]B (DiDonato et al. 1997). Degradation of I[kappa]B allows nuclear translocation of NF-[kappa]B, where it binds to promoter sites for gene transcription (DiDonato et al. 1997). [6]-Gingerol has been reported to exert anti-inflammatory activity through inhibiting NF-[kappa]B (Li et al. 2013). The inhibition of NF-[kappa]B by [6]-gingerol might be a critical step in preventing a cascading inflammatory response during NAFLD development. In the present study, [6]-gingerol increased cytoplasmic I[kappa]B protein levels and significantly inhibited NF-[kappa]B nuclear translocation in livers of HFD-fed hamster. [6]-Gingerol also suppressed the upregulation of nuclear NF-[kappa]B DNA binding activity in the livers of HFD-fed hamster, implying that [6]-gingerol resists the activation of NF-[kappa]B induced by HFD. This provides convincing evidence that the anti-inflammatory activities of [6]-gingerol are mediated through NF-[kappa]B and that [6]-gingero! protects against NAFLD in an NF-/cB-dependent manner.

[FIGURE 3 OMITTED]

Chronic hyperinsulinemia promotes hepatic lipogenesis through upregulation of lipogenic transcription factors. One such nuclear transcription factor is LXR-a, which is highly expressed in the liver and acts to enhance transcription of several genes involved in lipogenesis, including SREBP-lc and its target genes ACC, FAS, SCD-1, and DGAT-2 (Browning and Horton 2004). HFD-induced hyperinsulinemia in hamsters was blocked by [6]-gingerol. We postulate that the improvement reduction of liver steatosis in [6]-gingerol-treated HFD-fed hamsters was associated with a reduction in expression of genes involved in lipogenesis. In this study, HFD-fed hamsters had increased levels of LXR-[alpha] and SREBP-1c mRNA and their downstream target genes. These alterations were significantly reversed by [6]-gingerol in HFD-fed hamsters. These data suggest that [6]-gingerol also exerts a protective effect on HFD-induced liver steatosis and injury in hamsters through the modulation of lipogenesis genes.

Bezalip, a fibric acid derivative, is a commercially available drug for the treatment of hyperlipidemia and is generally effective in lowering elevated plasma TG in coronary heart disease patients (Haim et al. 2006). Although the hepatoprotective effect of [6]-gingerol was less marked than that produced by Bezalip, [6]-gingerol may be a suitable therapeutic adjunct for patients who are particularly sensitive to fibrate-associated side effects (Wu et al. 2009).

Conclusion

These findings provide novel evidence that [6]-gingerol protects against HFD-induced hepatic inflammation and insulin resistance by decreasing the induction of inflammatory cytokines via an NF-[kappa]B-dependent pathway. Consequently, [6]-gingerol suppresses LXR-[alpha], SREBP-1c, and the expression of their downstream target genes, ultimately leading to inhibition of hepatic lipogenesis. These results suggest that [6]-gingerol is a potent food component that protects against HFD-induced hepatic steatosis and related metabolic disorders.
Abbreviations

ACC          acetyl-CoA carboxylase
CD           control diet
Choi         cholesterol
DGAT-2       acyl-CoA:diacylglycerol acyltransferase 2
DMSO         dimethyl sulfoxide
ELISA        enzyme-linked immunosorbent assay
FAS          fatty acid synthase
FFA          free fatty acid
GF           [6]-gingerol
HDL-C        high density lipoprotein cholesterol
HFD          high-fat diet
HOMA-IR      homeostasis model assessment of insulin      resistance
IACUC        Institutional Animal Care and Use Commi      ttee
IL           interleukin
I[kappa]B    [alpha]inhibitory kappaB
LDL-C        low density lipoprotein cholesterol
LXR-[alpha]  liver X receptor-[alpha]
MCP-1        monocyte chemoattractant protein-1
MTS          3-(4,5-dimethylthiazol-2-yl)-5-(3carboxymethoxyphenyl)-
             2-(4-sulfophenyl)-2H-tetrazolium
NAFLD        non-alcoholic fatty liver disease
NASH         nonalcoholic steatohepatitis
NF-[kappa]B  nuclear transcription factor-[kappa]B
OA           oleic acid
OD           optical density
RT-PCR       quantitative real-time PCR
SCD1         stearoyl-CoA desaturase 1
SEM          standard error mean
SREBP-1c     sterol regulating element binding protein-1c
TBST         Tris-buffered saline Tween 20
TC           total cholesterol
TG           triglyceride
TNF-[alpha]  tumor necrosis factor-[alpha]


ARTICLE INFO

Article history:

Received 8 July 2014

Revised 12 December 2014

Accepted 9 January 2015

Conflicts of interest

We wish to confirm that there are no known conflicts of interest associated with this publication.

Acknowledgments

The present study was supported by a grant from the National Science Council of Taiwan (grant no. NSC 102-2320-B-l 27-001-MY3).

References

Araya, J., Rodrigo, R., Videla, LA., Thielemann, L, Orellana, M., Pettinelli, R, Poniachik, J., 2004. Increase in long-chain polyunsaturated fatty acid n-6/n-3 ratio in relation to hepatic steatosis in patients with non-alcoholic fatty liver disease. Clin. Sci. 106, 635-643.

Bhathena, J., Kulamarva, A., Martoni, C., Urbanska, A.M., Malhotra, M., Paul, A., Prakash, S., 2011. Diet-induced metabolic hamster model of nonalcoholic fatty liver disease. Diabetes, Metab. Syndr. Obes. 4, 195-203.

Braunersreuther, V., Viviani, G.L., Mach, F., Montecucco, F., 2012. Role of cytokines and chemokines in non-alcoholic fatty liver disease. World J. Gastroenterol. 18, 727-735.

Browning, J.D., Horton, J.D., 2004. Molecular mediators of hepatic steatosis and liver injury. J. Clin. Invest. 114, 147-152.

Chang, C.J., Liou, S.S., Tzeng, T.F., Liu, I.M., 2014. The ethanol extract of Zingiber zerumbet Smith attenuates non-alcoholic fatty liver disease in hamsters fed on high-fat diet. Food Chem. Toxicol. 65, 33-42.

Chang, C.J., Tzeng, T.F., Liou, S.S., Chang, Y.S., Liu, I.M., 2012. Absence of genotoxic and mutagenic effects of Zingiber zerumbet (L) Smith (Zingiberaceae) extract. Evidence-Based Complementary Altern. Med. 2012, 406296.

Chang, W.S., Chang, Y.H., Lu, F.J., Chiang, H.C., 1994. Inhibitory effects of phenolics on xanthine oxidase. Anticancer Res. 14, 501-506. de Silva, P.P., Davis, P.J., Cheema, S.K., 2004. Hyperlipidaemic effect of fish oil in Bio F1B hamsters. Br. J. Nutr. 91, 341-349.

Dela Pena, A., Leclercq, L, Field, J., George, J., Jones, B., Farrell, G., 2005. NF-kappaB activation, rather than TNF, mediates hepatic inflammation in a murine dietary model of steatohepatitis. Gastroenterology 129, 1663-1674.

DiDonato, JA. Hayakawa, M., Rothwarf, D.M., Zandi, E., Karin, M., 1997. A cytokine-responsive IkappaB kinase that activates the transcription factor NF-kappaB. Nature 388, 548-554.

Folch, J., Lees, M., Sloane-Stanley, G.H., 1957. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226, 497-506.

Guh, J.H., Ko, F.N., Jong, T.T., Teng, C.M., 1995. Antiplatelet effect of gingerol isolated from Zingiber officinale. J. Pharm. Pharmacol. 47, 329-332.

Haim, M., Benderly, M., Boyko, V., Goldenberg, L, Tanne, D., Battler, A., Goldbourt, U, Behar, S., Bezafibrate Infarction Prevention (BIP) Study Group, 2006. Decrease in triglyceride level by bezafibrate is related to reduction of recurrent coronary events: a Bezafibrate Infarction Prevention substudy. Coron. Artery Dis. 17, 455-461.

Janorkar, A.V., King, K.R., Megeed, Z., Yarmush, M.L., 2009. Development of an in vitro cell culture model of hepatic steatosis using hepatocyte-derived reporter cells. Biotechnol. Bioeng. 102, 1466-1474.

Kanda, H.,Tateya, S., Tamori, Y., Kotani, K., Hiasa, K., Kitazawa, R., Miyachi, H., Maeda, S., Egashira, K., Kasuga, M., 2006. MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity. J. Clin. Invest. 116, 1494-1505.

Kim, J.K., Kim, Y., Na, K.M., Surh, Y.J., Kim, T.Y., 2007. [6]-Gingerol prevents UVB-induced ROS production and COX-2 expression in vitro and in vivo. Free Radie. Res. 41, 603-614.

Kleiner, D.E., Brunt, E.M., Van Natta, M., Behling, C., Contos, M.J., Cummings, O.W., Ferrell, LD., Liu, Y.C., Torbenson, M.S., Unalp-Arida, A., Yeh, M., McCullough, A.J., Sanyal, A.J., 2005. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 41, 1313-1321.

Li, X.H., McGrath, K.C., Tran, V.H., Li, Y.M., Duke, C.C., Roufogalis, B.D., Heather, A.K., 2013. Attenuation of proinflammatory responses by S-|6]-gingerol via inhibition of ROS/NF-kappa B/COX2 activation in HuH7 cells. Evidence-Based Complementary Altern. Med. 2013, 146142.

Lionetti, L, Mollica, M.P., Lombardi, A., Cavaliere, G., Gifuni, G., Barletta, A., 2009. From chronic overnutrition to insulin resistance: the role of fat-storing capacity and inflammation. Nutr., Metab., Cardiovasc. Dis. 19, 146-152.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-A ACT method. Methods 25, 402-408.

Marchesini, G., Marzocchi, R., Agostini, F., Bugianesi, E., 2005. Nonalcoholic fatty liver disease and the metabolic syndrome. Curr. Opin. Lipidol. 16, 421-427.

Matthews, D.R., Hosker, J.P., Rudenski, A.S., Naylor, B.A., Treacher, D.F., Turner, R.C., 1985. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 28, 412-419.

McCullough, A.J., 2006. Pathophysiology of nonalcoholic steatohepatitis. J. Clin. Gastroenterol. 40 (Suppl 1), S17-S29.

Nehra, V., Angulo. P., Buchman, A.L., Lindor, K.D., 2001. Nutritional and metabolic considerations in the etiology of nonalcoholic steatohepatitis. Dig. Dis. Sci. 46, 2347-2352.

Oakley, F., Mann, J., Nailard, S., Smart, D.E., Mungalsingh, N., Constandinou, C. Ali, S., Wilson, S.J., Millward-Sadler, H., Iredale, J.P., Mann, DA, 2005. Nuclear factor-kappaB1 (p50) limits the inflammatory and fibrogenic responses to chronic injury. Am.J. Pathol. 166, 695-708.

Schmilovitz-Weiss, H., Hochhauser, E., Cohen, M., Chepurko, Y., Yitzhaki, S., Grossman, E., Leibowitz, A, Ackerman, Z., Ben-Ari, Z., 2013. Rosiglitazone and bezafibrate modulate gene expression in a rat model of non-alcoholic fatty liver disease-a historical prospective. Lipids Health Dis. 12, 41.

Schuppan, D., Schattenberg, J.M., 2013. Non-alcoholic steatohepatitis: pathogenesis and novel therapeutic approaches. J. Gastroenterol. Hepatol. 28 (Suppl 1), 68-76.

Schwabe, R.F., Brenner, DA, 2006. Mechanisms of liver injury. I. TNF-alpha induced liver injury: role of 1KK.JNK, and ROS pathways. Am.J. Physiol.: Gastrointest. Liver Physiol. 290, G583-G589.

Singh, A.B., Akanksha, Singh, N., Maurya, R., Srivastava, A.K., 2009. Anti-hyperglycaemic, lipid lowering and anti-oxidant properties of [6]-gingerol in db/db mice. Int. J. Med. Med. Sci. 1, 536-544.

Van Heek, M., Compton, D.S., France, C.F., Tedesco, R.P., Fawzi, A.B., Graziano, M.P., Sybertz, E.J., Strader, C.D., Davis Jr., H.R., 1997. Diet-induced obese mice develop peripheral, but not central, resistance to leptin. J. Clin. Invest. 99, 385-390.

Velayudham, A., Dolganiuc, A., Ellis, M., Petrasek, J., Kodys, K., Mandrekar, P., Szabo, G., 2009. VSL#3 probiotic treatment attenuates fibrosis without changes in steatohepatitis in a diet-induced nonalcoholic steatohepatitis model in mice. Hepatology 49, 989-997.

Videla, LA, Tapia, G., Rodrigo, R., Pettinelli, P., Haim, D., Santibanez, C, Araya, A.V., Smok, G., Csendes, A., Gutierrez, L, Rojas, J., Castillo, J., Korn, O., Maluenda, F., Diaz, J.C., Rencoret, G., Poniachik, J., 2009. Liver NF-kappaB and AP-1 DNA binding in obese patients. Obesity 17, 973-979.

Wu, J., Song, Y., Li, H., Chen, J., 2009. Rhabdomyolysis associated with fibrate therapy: review of 76 published cases and a new case report. Eur. J. Clin. Pharmacol. 65, 1169-1174.

Xu, Z.J., Fan, J.G., Ding, X.D., Qiao, L., Wang, G.L., 2010. Characterization of high-fat, diet-induced, non-alcoholic steatohepatitis with fibrosis in rats. Dig. Dis. Sci. 55, 931-940.

Yob, N.J., Jofrry, S.M., Affandi, M.M., The, L.K., Salleh, M.Z., Zakaria, ZA, 2011. Zingiber zerumbet (L.) Smith: a review of its ethnomedicinal, chemical, and pharmacological uses. Evidence-Based Complementary Altern. Med. 2011, 543216.

Young, H.Y., Luo, Y.L., Cheng, H.Y., Hsieh, W.C., Liao, J.C., Peng, W.H., 2005. Analgesic and anti-inflammatory activities of [6]-gingerol. J. Ethnopharmacol. 96, 207-210.

Thing-Fong Tzeng Shorong-Shii Liou, Chia Ju Chang I-Min Liu *

Department of Pharmacy and Graduate Institute of Pharmaceutical Technology, Tajen University. Yanpu Township, Pingtung County, Taiwan, ROC

* Corresponding author. Tel.: +886 8 7624002x2713; fax: +886 8 7625308.

E-mail address: iml@tajen.edu.tw (I.-M. Liu).

http://dx.doi.org/10.1016/j.phymed.2015.01.015
Table 1.
Sequences of oligonucleotides used as primers.

Target gene     Primers           Sequence (5'-3')

MCP-1           Forward primer    TCTCTTCCTCCACCACTATGCA
                Reverse primer    GGCTGAGACAGCACGTGGAT
TNF-[alpha]     Forward primer    CCAGGAGAAAGTCAGCCTCCT
                Reverse primer    TCATACCAGGGCTTGAGCTCA
IL-1[beta]      Forward primer    GGTCAAAGGTTTGGAAGCAG
                Reverse primer    TGTGAAATGCCACCTTTTGA
IL-6            Forward primer    AAAAGTCCTGATCCAGTTC
                Reverse primer    GAGATGAGTTGTCATGTCC
SREBP-1c        Forward primer    CCCTACCGTTCCFCTATCAA
                Reverse primer    TTCGCAGGGTCAGGTTCTC
LXR-[alpha]     Forward primer    CGCTACCGTTCCTCTATCAA
                Reverse primer    TTCGCAGGGTCAGGTTCTC
ACC             Forward primer    GGACAGAC1GATCGCAGAGAAAG
                Reverse primer    TGGAGAGCCCCACACACA
FAS             Forward primer    GGAACTGAACGGCATTACTCG
                Reverse primer    CATGCCGTTATCAACTTGTCC
SCD1            Forward primer    CCTTAACCCTGAGATCCCGTAGA
                Reverse primer    AGCCCATAAAAGATTTC1GCAAA
DCAT2           Forward primer    CATGAAGACCCTCATCGCCG
                Reverse primer    GTGACAGAGAAGATGTCTTCG
[beta]-actin    Forward primer    TGTCATCGTGCGAATGGGTCAG
                Reverse primer    TTTCATGTCACGCACGAT TTCC

Table 2.
Effects of treatments on blood biochemistry and hepatic parameters in
HFD-fed hamsters.

                                      CD-fed

                                      Vehicle

Final body weight (BW) (g)            139.83 [+ or -] 9.14 (a)
Liver weight index (%)                  4.91 [+ or -] 0.27 (c)
Plasma glucose (mg/dl)                 90.38 [+ or -] 3.81 (d)
Plasma insulin (m/l)                   20.57 [+ or -] 1.83 (d)
HOMA-IR                                 4.62 [+ or -] 0.22
Plasma leptin (pg/ml)                 308.42 [+ or -] 13.64 (d)
Plasma adiponectin (pg/ml)            128.29 [+ or -] 8.75 (d)
Plasma TC (mg/dl)                     108.23 [+ or -] 4.17 (d)
Plasma TG (mg/dl)                      91.38 [+ or -] 3.18 (d)
Plasma LDL-C (mg/dl)                   48.73 [+ or -] 3.04 (d)
Plasma HDL-C (mg/dl)                   49.13 [+ or -] 3.41 (c)
Plasma FFA (mg/dl)                     28.69 [+ or -] 3.12 (d)
Hepatic TC ([micro]mol/g liver)        10.04 [+ or -] 0.98 (d)
Hepatic TG ([micro]mol/g liver)         8.72 [+ or -] 0.78 (d)
Hepatic MCP-1 (pg/mg protein)          33.37 [+ or -] 3.14 (d)
Hepatic TNF-[alpha] (pg/mg protein)    72.04 [+ or -] 8.23 (d)
Hepatic IL-1[beta] (pg/mg protein)     23.84 [+ or -] 5.01 (d)
Hepatic IL-6 (pg/mg protein)           54.72 [+ or -] 6.23 (d)

                                      HFD-fed

                                      Vehicle

Final body weight (BW) (g)            195.19 [+ or -] 9.92 (b)
Liver weight index (%)                  5.83 [+ or -] 0.31 (a)
Plasma glucose (mg/dl)                153.24 [+ or -] 4.61 (b)
Plasma insulin (m/l)                   41.59 [+ or -] 2.46 (b)
HOMA-IR                                15.71 [+ or -] 0.17 (b)
Plasma leptin (pg/ml)                 428.39 [+ or -] 15.83 (b)
Plasma adiponectin (pg/ml)             78.42 [+ or -] 6.23 (b)
Plasma TC (mg/dl)                     262.91 [+ or -] 5.23 (b)
Plasma TG (mg/dl)                     160.09 [+ or -] 3.27 (b)
Plasma LDL-C (mg/dl)                  191.26 [+ or -] 2.64 (b)
Plasma HDL-C (mg/dl)                   26.27 [+ or -] 3.71 (a)
Plasma FFA (mg/dl)                     57.82 [+ or -] 4.20 (b)
Hepatic TC ([micro]mol/g liver)        19.62 [+ or -] 1.23 (b)
Hepatic TG ([micro]mol/g liver)        17.73 [+ or -] 1.54 (b)
Hepatic MCP-1 (pg/mg protein)          82.78 [+ or -] 4.26  (b)
Hepatic TNF-[alpha] (pg/mg protein)   169.35 [+ or -] 12.34 (b)
Hepatic IL-1[beta] (pg/mg protein)     64.04 [+ or -] 6.08 (b)
Hepatic IL-6 (pg/mg protein)          165.28 [+ or -] 14.32 (b)

                                      HFD-fed

                                      [6]-Gingerol (mg/kg/day)

                                      25

Final body weight (BW) (g)            180.74 [+ or -] 7.85 (b)
Liver weight index (%)                  5.62 [+ or -] 0.28 (a)
Plasma glucose (mg/dl)                150.02 [+ or -] 4.05 (b)
Plasma insulin (m/l)                   37.31 [+ or -] 2.12  (b)
HOMA-IR                                13.81 [+ or -] 0.21 (b)
Plasma leptin (pg/ml)                 385.55 [+ or -] 16.l3 (b,c)
Plasma adiponectin (pg/ml)             91.10 [+ or -] 6.12 (b,c)
Plasma TC (mg/dl)                     200.13 [+ or -] 5.01 (b,c)
Plasma TG (mg/dl)                     143.97 [+ or -] 3.71 (b,c)
Plasma LDL-C (mg/dl)                  138.98 [+ or -] 3.29 (b,c)
Plasma HDL-C (mg/dl)                    3335 [+ or -] 3.54 (a,c)
Plasma FFA (mg/dl)                     51.58 [+ or -] 4.03 (b)
Hepatic TC ([micro]mol/g liver)        17.61 [+ or -] 1.16 (b)
Hepatic TG ([micro]mol/g liver)        16.05 [+ or -] 1.65 (b)
Hepatic MCP-1 (pg/mg protein)          67.42 [+ or -] 5.48 (b,c)
Hepatic TNF-[alpha] (pg/mg protein)   148.72 [+ or -] 15.78 (b,c)
Hepatic IL-1[beta] (pg/mg protein)     50.71 [+ or -] 3.56 (b,c)
Hepatic IL-6 (pg/mg protein)          131.25 [+ or -] 11.24 (b,c)

                                      HFD-fed

                                      [6]-Gingerol (mg/kg/day)

                                      50

Final body weight (BW) (g)            167.85 [+ or -] 8.53 (a,c)
Liver weight index (%)                  5.33 [+ or -] 0.22
Plasma glucose (mg/dl)                147.40 [+ or -] 3.97 (b)
Plasma insulin (m/l)                   32.83 [+ or -] 1.93 (b,c)
HOMA-IR                                11.94 [+ or -] 0.28 (b,c)
Plasma leptin (pg/ml)                 366.27 [+ or -] 14.32 (a,c)
Plasma adiponectin (pg/ml)            102.48 [+ or -] 7.47 (a,c)
Plasma TC (mg/dl)                     181.51 [+ or -] 4.72 (b,c)
Plasma TG (mg/dl)                     130.43 [+ or -] 4.17 (a)
Plasma LDL-C (mg/dl)                  110.32 [+ or -] 2.97  (b,d)
Plasma HDL-C (mg/dl)                   36.46 [+ or -] 4.59 (a,c)
Plasma FFA (mg/dl)                     46.09 [+ or -] 3.62 (a,c)
Hepatic TC ([micro]mol/g liver)        15.83 [+ or -] 1.09 (b,c)
Hepatic TG ([micro]mol/g liver)        12.55 [+ or -] 1.43 (b,c)
Hepatic MCP-1 (pg/mg protein)          52.26 [+ or -] 4.33 (b,d)
Hepatic TNF-[alpha] (pg/mg protein)   134.30 [+ or -] 13.72 (b,c)
Hepatic IL-1[beta] (pg/mg protein)     39.97 [+ or -] 4.57 (b,c)
Hepatic IL-6 (pg/mg protein)          109.08 [+ or -] 10.33 (b,d)

                                      HFD-fed

                                      [6]-Gingerol (mg/kg/day)

                                      100

Final body weight (BW) (g)            157.02 [+ or -] 7.13 (d)
Liver weight index (%)                  5.25 [+ or -] 0.24
Plasma glucose (mg/dl)                146.26 [+ or -] 4.27 (b)
Plasma insulin (m/l)                   26.97 [+ or -] 2.01 (a,d)
HOMA-IR                                 9.63 [+ or -] 0.25 (b,d)
Plasma leptin (pg/ml)                 330.56 [+ or -] 16.13 (d)
Plasma adiponectin (pg/ml)            112.73 [+ or -] 7.28 (d)
Plasma TC (mg/dl)                     160.46 [+ or -] 4.58 (a,d)
Plasma TG (mg/dl)                     118.41 [+ or -] 3.82 (a,d)
Plasma LDL-C (mg/dl)                   83.24 [+ or -] 3.17 (a,d)
Plasma HDL-C (mg/dl)                   41.35 [+ or -] 3.22 (a,c)
Plasma FFA (mg/dl)                     39.27 [+ or -] 2.72 (a), (d)
Hepatic TC ([micro]mol/g liver)        13.92 [+ or -] 1.35 (a,d)
Hepatic TG ([micro]mol/g liver)        11.21 [+ or -] 1.58 (a,c)
Hepatic MCP-1 (pg/mg protein)          43.21 [+ or -] 3.96 (a,d)
Hepatic TNF-[alpha] (pg/mg protein)   107.19 [+ or -] 9.24 (a,d)
Hepatic IL-1[beta] (pg/mg protein)     35.86 [+ or -] 4.49 (a,d)
Hepatic IL-6 (pg/mg protein)           86.48 [+ or -] 9.56 (a,d)

                                      Bezalip

                                      10 mg/kg/day

Final body weight (BW) (g)            151.28 [+ or -] 6.83 (d)
Liver weight index (%)                  5.18 [+ or -] 0.32
Plasma glucose (mg/dl)                144.78 [+ or -] 4.83 (b)
Plasma insulin (m/l)                   25.13 [+ or -] 1.87 (a,d)
HOMA-IR                                 8.90 [+ or -] 0.16 (b,d)
Plasma leptin (pg/ml)                 317.42 [+ or -] 17.26 (d)
Plasma adiponectin (pg/ml)            118.36 [+ or -] 6.65 (d)
Plasma TC (mg/dl)                     158.87 [+ or -] 4.34 (a,d)
Plasma TG (mg/dl)                     111.89 [+ or -] 3.16 (a,d)
Plasma LDL-C (mg/dl)                   79.11 [+ or -] 4.02 (a,d)
Plasma HDL-C (mg/dl)                    4237 [+ or -] 3.67 (a,c)
Plasma FFA (mg/dl)                     35.66 [+ or -] 3.38 (a,d)
Hepatic TC ([micro]mol/g liver)        13.22 [+ or -] 1.24 (a,d)
Hepatic TG ([micro]mol/g liver)        10.64 [+ or -] 1.38 (a,c)
Hepatic MCP-1 (pg/mg protein)          29.88 [+ or -] 3.01 (d)
Hepatic TNF-[alpha] (pg/mg protein)    96.47 [+ or -] 8.36 (a,d)
Hepatic IL-1[beta] (pg/mg protein)     28.68 [+ or -] 3.32 (d)
Hepatic IL-6 (pg/mg protein)           73.89 [+ or -] 8.74 (a,d)

The vehicle (distilled water) used to prepare the tested medication
solution was given at the same volume. Values (mean [+ or -] SEM) were
obtained from each group of 8 animals in each group after 8 weeks of
the experimental period. (a) p < 0.05 and (b) p < 0.01 compared to the
values of vehicle-treated CD-fed hamsters in each group, respectively.
(c) p < 0.05 and (d) p < 0.01 compared to the values of vehicle-
treated HFD-fed hamsters in each group, respectively.

Table 3.
Summary of steatosis and inflammation score of CD-or HFD-fed hamsters
receiving 8-weeks of treatments.

               CD-fed    HFD-fed

               Vehicle   Vehicle   [6]-Gingerol         Bezalip
                                   (mg/kg/day)

                                   25     50     100    (10 mg/kg/day)
Steatosis
0              8         0         0      0      0      0
1              0         0         1      2      3      4
2              0         4         4      5      5      4
3              0         4         3      1      0      0
4              0         0         0      0      0      0
Inflammation
0              8         0         0      0      0      0
1              0         3         4      5      6      7
2              0         3         3      2      2      1
3              0         2         1      1      0      0

There were 8 animals in each group. Data are expressed as the number
of hamsters exhibiting the grade of steatosis or inflammation
indicated.

Table 4.
Hepatic mRNA expression of cytokines and lipogenic genes in CD-or HFD-
fed hamsters receiving 8-weeks of treatments.

                                          CD-fed

                                          Vehicle

MCP-1 mRNA (relative expression)          1.00 [+ or -] 0.03 (d)
TNF-[alpha] mRNA (relative expression)    1.00 [+ or -] 0.05 (d)
IL-1[beta] mRNA (relative expression)     1.00 [+ or -] 0.06 (d)
IL-6 mRNA (relative expression)           1.00 [+ or -] 0.04 (d)
SREBP-1c (relative expression)            1.00 [+ or -] 0.07 (d)
LXR-[alpha] (relative expression)         1.00 [+ or -] 0.05 (d)
ACC (relative expression)                 1.00 [+ or -] 0.08 (d)
FAS (relative expression)                 1.00 [+ or -] 0.06 (d)
SCD-1 (relative expression)               1.00 [+ or -] 0.03 (d)
DGAT-2 (relative expression)              1.00 [+ or -] 0.05 (d)

                                          HFD-fed

                                          Vehicle

MCP-1 mRNA (relative expression)          2.48 [+ or -] 0.46 (b)
TNF-[alpha] mRNA (relative expression)    2.35 [+ or -] 0.27 (b)
IL-1[beta] mRNA (relative expression)     2.68 [+ or -] 0.23 (b)
IL-6 mRNA (relative expression)           3.02 [+ or -] 0.46 (b)
SREBP-1c (relative expression)            2.83 [+ or -] 0.18 (b)
LXR-[alpha] (relative expression)         3.28 [+ or -] 0.14 (b)
ACC (relative expression)                 2.53 [+ or -] 0.2l (b)
FAS (relative expression)                 3.03 [+ or -] 0.29 (b)
SCD-1 (relative expression)               2.97 [+ or -] 0.26 (b)
DGAT-2 (relative expression)              3.10 [+ or -] 0.31 (b)

                                          HFD-fed

                                          [6]-Cingerol (mg/kg/day)

                                          25

MCP-1 mRNA (relative expression)          2.02 [+ or -] 0.37 (b)
TNF-[alpha] mRNA (relative expression)    2.06 [+ or -] 0.21 (b)
IL-1[beta] mRNA (relative expression)     2.13 [+ or -] 0.38 (b)
IL-6 mRNA (relative expression)           2.39 [+ or -] 0.26 (b)
SREBP-1c (relative expression)            2.54 [+ or -] 0.14 (b)
LXR-[alpha] (relative expression)         2.62 [+ or -] 0.18 (b,c)
ACC (relative expression)                 2.03 [+ or -] 0.19 (b,c)
FAS (relative expression)                 2.42 [+ or -] 0.33 (b)
SCD-1 (relative expression)               2.38 [+ or -] 0.17 (b,c)
DGAT-2 (relative expression)              2.71 [+ or -] 0.23 (b)

                                          HFD-fed

                                          [6]-Cingerol (mg/kg/day)

                                          50

MCP-1 mRNA (relative expression)          1.57 [+ or -] 0.22 (a,c)
TNF-[alpha] mRNA (relative expression)    1.86 [+ or -] 0.28 (b,c)
IL-1[beta] mRNA (relative expression)     1.68 [+ or -] 0.17 (a,c)
IL-6 mRNA (relative expression)           1.99 [+ or -] 0.32 (b,c)
SREBP-1c (relative expression)            2.26 [+ or -] 0.20 (b,c)
LXR-[alpha] (relative expression)         2.29 [+ or -] 0.12 (b,c)
ACC (relative expression)                 1.77 [+ or -] 0.22 (b,c)
FAS (relative expression)                 2.18 [+ or -] 0.27 (b,c)
SCD-1 (relative expression)               1.90 [+ or -] 0.23 (a,c)
DGAT-2 (relative expression)              2.45 [+ or -] 0.27 (b,c)

                                          HFD-fed

                                          [6]-Cingerol (mg/kg/day)

                                          100

MCP-1 mRNA (relative expression)          1.29 [+ or -] 0.26 (a,d)
TNF-[alpha] mRNA (relative expression)    1.48 [+ or -] 0.25 (a,d)
IL-1[beta] mRNA (relative expression)     1.50 [+ or -] 0.28 (a,d)
IL-6 mRNA (relative expression)           1.58 [+ or -] 0.13 (a,d)
SREBP-1c (relative expression)            1.88 [+ or -] 0.23 (a,d)
LXR-[alpha] (relative expression)         1.96 [+ or -] 0.11 (a,d)
ACC (relative expression)                 1.52 [+ or -] 0.23 (a,d)
FAS (relative expression)                 1.85 [+ or -] 0.16 (a,d)
SCD-1 (relative expression)               1.72 [+ or -] 0.26 (a,d)
DGAT-2 (relative expression)              1.87 [+ or -] 0.18 (a,d)

                                          Bezalip

                                          10 mg/kg/day

MCP-1 mRNA (relative expression)          1.18 [+ or -] 0.32 (a,d)
TNF-[alpha] mRNA (relative expression)    1.33 [+ or -] 0.16 (a,d)
IL-1[beta] mRNA (relative expression)     1.20 [+ or -] 0.15 (a,d)
IL-6 mRNA (relative expression)           1.35 [+ or -] 0.17 (a,d)
SREBP-1c (relative expression)            1.73 [+ or -] 0.17 (a,d)
LXR-[alpha] (relative expression)         1.82 [+ or -] 0.16 (a,d)
ACC (relative expression)                 1.45 [+ or -] 0.12 (a,d)
FAS (relative expression)                 1.67 [+ or -] 0.14 (a,d)
SCD-1 (relative expression)               1.54 [+ or -] 0.3l (a,d)
DGAT-2 (relative expression)              1.74 [+ or -] 0.22 (a,d)

The vehicle (distilled water) used to prepare the tested medication
solution was given at the same volume. Values (mean [+ or -] SEM) were
obtained from each group of 8 animals in each group after 8 weeks of
the experimental period, (a) p < 0.05 and (b) p < 0.01 compared to the
values of vehicle-treated CD-fed hamsters in each group, respectively.
(c) p < 0.05 and (d) p < 0.01 compared to the values of vehicle-
treated HFD-fed hamsters in each group, respectively.
COPYRIGHT 2015 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Tzeng, Thing-Fong; Liou, Shorong-Shii; Chang, Chia Ju; Liu, I.-Min
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Geographic Code:9CHIN
Date:Apr 15, 2015
Words:9423
Previous Article:In vitro inhibitory effects of ethanol extract of Danshen (Salvia miltiorrhiza) and its components on the catalytic activity of soluble epoxide...
Next Article:Cell cycle arrest and induction of apoptosis by cajanin stilbene acid from Cajanus cajan in breast cancer cells.
Topics:

Terms of use | Copyright © 2017 Farlex, Inc. | Feedback | For webmasters