Printer Friendly

[beta]-Asarone induces senescence in colorectal cancer cells by inducing lamin B1 expression.

ARTICLE INFO

Keywords: Asarone Colorectal cancer Lamins Cell senescence Oct-1

ABSTRACT

Colorectal cancer is a leading cause of cancer mortality with a complex carcinogenesis that includes reduced cellular senescence. Lamin proteins are decreased in senescing cells, and frequently decreased in malignancies. This study identified a new drug candidate for colorectal cancer that appears to target cell senescence via a lamin protein. [beta]-Asarone (1-propenyl-2, 4, 5-methoxybenzol) is a compound from the traditional medical herb Acorus calamus Linn. This study tested the in vitro and in vivo effects of I3-asarone on colorectal cancer cells by testing cell viability using human colorectal cell lines HT29 and SW480 in MTT assays; tumorigenesis using xenografts in nude mice and a mouse model of colorectal cancer; cell senescence using senescence-associated [beta]-galactosidase activity; and expression of cancer and senescence-related proteins, specifically lamins, Oct-1, p53, p21, and p15, by Western blot. [beta]-Asarone appeared to increase expression of lamin B1. p53. p21, but not lamin A/C. [beta]-Asarone regulates p15 expression by regulation of Oct-1 binding. Collectively, the results suggested that 13-asarone inhibits colon cancer formation in vivo and in vitro by inducing senescence. Since [beta]-asarone induced lamin B1 expression, a model is proposed in which 13-asarone inhibits colorectal cancer by inducing senescence through lamin B1.

[C] 2013 Published by Elsevier GmbH.

Introduction

Colorectal cancer is one of the most common cancers and a leading cause of cancer-related mortality in developed and developing countries. The carcinogenesis of colorectal cancer is complicated (Atreya and Neurath 2008). However, one of the cellular features of colorectal cancer is reduction of cellular senescence, which is a potent tumor-suppressing mechanism. Suppression of cellular senescence induces tumor cell growth and has been linked to aging (Finkel et al. 2007). Factors involved in cellular senescence include p53, p21, and p15 (Kolev etal. 2008).

Lamin proteins have also been implicated in senescence. Lamins are classified as type A or B based on isoelectric point (Goldman et al. 2002). In humans, one A-type and two B-type lamin genes have been identified. Lamin B1 is depressed in primary human and murine cell lines when they undergo senescence after DNA damage, replicative exhaustion, or oncogene expression (Shimi et al. 2011). Overexpression of Lamin B1 increased proliferation in fibroblast WI-38 cells. Moreover, lamin B1 is repressed in mouse tissue after senescence is induced by irradiation, indicating that loss of lamin B1 is a biomarker of senescence (Freund et al. 2012). Furthermore, lamin expression is frequently reduced in malignant tissue such as gastric dysplasia, esophageal carcinoma, and breast, prostate, and uterus cancer (Winawer et al. 2011). This suggests that reduction of lamin expression might be a malignancy biomarker. The effects of lamin B1 silencing on proliferation require the activation of p53 and upregulation of the transcription of p53 target genes such as p21. These results suggest that p53 is at least partially involved in lamin B1 functions in cellular processes (Shimi et al. 2011).

The nuclear lamina is suggested to be associated with and to regulate the activity of octamer transcription factor 1 (Oct-1). Oct-1 is a ubiquitous transcription factor expressed in the nuclei of LNCaP human prostate adenocarcinoma cells. Silencing of Oct-1 expression by small interfering RNA inhibits LNCaP cell proliferation, suggesting that Oct-1 might be a prognostic factor in prostate cancer (Obinata et al. 2012). Lamin B1 at the nuclear lamina directly sequesters Oct-1, resulting in the regulation of genes involved in processes including aging and response to oxidative stress (Malhas et al. 2009)

Traditional medicines with anticancer potential include a promising compound from the traditional medical herb Acorus calamus Linn (family: Araceae). [beta]-Asarone (1-propeny1-2, 4, 5-methoxybenzol) is one of the active components of ethanol extracts of A. calamus. [alpha]-Asarone and [beta]-asarone are the two major active components in volatile oils of A. calamus (Wang et al. 2011). [alpha]-Asarone shows radioprotective activity against lethal and sublethal closes of [gamma]-radiation by preventing radiation-induced production of free radicals and damage to DNA, membranes, and the hematopoi-etic system in animal models.

[beta]-Asarone has anticancer effects, inhibiting survival of the human hepatoma cell line HepG2 (Kevekordes et al. 2001). However, the effect of [beta]-asarone on colorectal cancer cell survival and the molecular mechanisms of its effects are still unclear. In this study, we found that [beta]-asarone affected colorectal carcinogenesis. It inhibited colorectal cell proliferation and tumor formation by induction of senescence. We propose that it acts through inducing expression of lamin B1 and activating p53.

Materials and methods

Chemicals

[beta]-Asarone (purity >99%) was from the Yurui Chemical Co., Ltd. (Shanghai, China). 1,2-Dimethyl hydrazine (DMH), dextran sodium sulfate (DSS) and MIT were from Sigma--Aldrich (St. Louis, MO). G418 was from GibcoBRL (Bethesda, MD). [beta]-Asarone was dissolved in dimethylsulfoxicle (DMSO) to make a stock solution of 100 mM, and was diluted to 1. 10, and 1001.1.M with ACSF.

Animals

The mouse colorectal cancer model was described previously (Wang et al. 2009). In brief, male Crj: CD-1 (ICR) mice were given a single intraperitoneal administration of the genotoxic colonic carcinogen DMH at 15 mg/kg body weight, followed by one week of oral exposure to the non-genotoxic carcinogen 2% DSS. Mice were sacrificed at week 20. Mice were divided into five groups: normal untreated, model, and [beta]-asarone-treated at 50, 100 or 200 [micro]/kg/day, orally administered for 20 weeks after a single DSS treatment. At the endpoint, mice were sacrificed and colons were carefully removed and inspected for macroscopic pathological lesions.

To establish xenografts of colorectal cancer cells in mice, SW480 or HT-29 cells were injected subcutaneously into the flanks of 5- to 6-week-old BABL/c nude mice, at 5 x [10.sup.6] cells/site, in 8 mice/group. After growing for 3 days, tumor xenografts reached approximately 100 m[m.sup.3]. Thereafter, p-asarone at 0, 50, 100 or 200 [micro]g/kg/day was administered through injection of tail vein. At the end of three weeks, mice were sacrificed, and tumor xenografts were removed and weighed.

Long-term toxicity test

Mice were randomly divided into 5 groups. Normal control group received distilled water. Mice in vehicle control group were received PBS water. Other mice were treated with [beta]-asarone at 10, 20 or 50 mg/kg/day for 90 days. At the endpoint, mice were anesthetized with ether and killed for hematological and biochemical test. Hematological test were performed using an automatic hematological analyzer (Medonic CA620, Boule Corp, Sweden). Biochemical test for serum sample was performed using automatic biochemical analyzer (Roche Integra 100 plus, Germany).

Mutagenicity experiments

Ames assay was used to test mutagenicity of [beta]-asarone. As Cassani-Galindo reported that the following cells and substances were added to sterile tubes: 0.1 ml of an overnight Salmonella typhimurium bacteria strain T100 culture and 0.5 ml of S9 mix (Moltox, NC, USA). Next, 0.1 ml of 0 [micro]/plate, 50 [micro]/plate, 100 [micro]g/plate and 200 [micro]/plate [beta]-asarone was added and incubated at 37 [degrees]C for 2 h. 2 ml molten top agar (45 [degrees]C) were added to each tube and poured onto minimal agar plates. After solidification, the top agar with the bacteria was incubated for 48 h, and the number of revertants was calculated. Three replicated plates were tested for each concentration.

Establishing the lethal dose (LD50)

BALB/C mice, aged 6-8 weeks, weighing 15-20g, were used to determine the percentage death of animals 24 h after a single administration of [beta]-asarone through injection from tail veins. Each group has 5 males and 5 females. The doses that animals received were 0.5, 0.75, 1, 1.25, 1.5, 1.75 and 2 g/kg respectively after starved for 12 h. The control group received 0.5 ml distilled water. The animal behaviors were observed for 12 h and the number of animals that died in 24 h was recorded.

Cell culturing and transfection

SW480, FIT29 and IEC-6 cells were cultured in RPM! 1640 supplemented with 10% heat-inactivated fetal bovine serum, 100 U/ml penicillin, 10 mg/ml streptomycin, and 2 mM glutamine (all from Sigma). Cells were incubated at 37 [degrees]C in a humidified atmosphere (5% C[O.sub.2]).

Transfections were carried out as described previously using lamin B1 plasmid (Addgene, plasmid #28108), small hairpin (sh)RNA against p53 (Addgene, plasmid #10671) and lamin Bl(Santa Cruz, sc-37332), or empty plasmid. Puromycin selection at 2.5 [micro]g/ml was applied 24 h after transfection.

MIT assay

Cell viability was determined by a 3-(4,5-dimethylthiazol-2-yl)-2,5-cliphenyl tetrazoliumbromide (MIT) assay. Briefly, cells were seeded at an initial density of 5 x [10.sup.4] cells/ml in a 96-well plate for 24 h. Cells were incubated with fresh medium containing [beta]-asarone at 0, 10,30, or 100 nM for 24 h, 48 h or 72 h. After incubation, MTT was added to each well. Insoluble formazan was collected, dissolved in DMSO and measured with an ELISA reader (Bio-Rad) at a wavelength of 570 nm.

BrdU incorporation assay

Cell proliferation was measured by the bromodeoxyuridine (BrdU) incorporation assay as described previously (Liu et at. 2012). In brief, SW480 and HT-29 cells were seeded for 24 h. After incubation with [beta]-asarone at 0, 10, 30, or 100 nM for 24h, 48h or 72h, 3 [micro]g/ml BrdU (Sigma, USA) was added, followed by incubation for 4 h at 37 [degrees]C. After fixing with 4% polyformaldehyde, cells were incubated with anti-BrdU monoclonal antibody (Cell Signal, USA) at 4 [degrees]C overnight. Cells were incubated with rhodamine (TRITC)-conjugated goat anti-mouse IgG (1:50 dilution, Jackson ImmunoResearch Laboratories, USA) secondary antibodies for 1 h at room temperature. Nuclei were stained with DAPI and evaluated by fluorescence microscopy (Olympus, Japan).

Senescence [beta]-galactosidase staining

Senescence [beta]-galactosidase (SA-[beta]-Gal) activity was assessed using a commercially available chromogenic assay kit (Cell Signaling). Assays for endogenous [beta]-galactosidase activity were conducted at a suboptimal pH (pH 6), which is thought to reflect increased lysosomal activity in senescent cells (Wu et al. 2010), in parallel with assays at optimal pH (pH 4), as a positive control for [beta]-galactosidase activity regardless of growing or senescent state.

Western blot and chromatin immunoprecipitation

Western blot was as described previously (Wang et al. 2009). Anti-lamin Bl, anti-lamin A/C, anti-Oct-1, anti-p53, anti-p21, and anti-p15 were from Cell Signaling. Anti-tubulin was from Sigma.

Chromatin immunoprecipitation (ChIP) was performed as described previously (Yu et al. 2008) using Oct-1 antibody (Cell Signaling). Each experiment was repeated at least twice independently. Immunoprecipitated DNA was analyzed by real-time PCR and compared to input DNA. The sequences of primers were forward primer: GGGAGGGTAATGAAGCTGAG: reverse primer: GGCCGTAAACTTAACGACACT.

Promoter activity

The promoter activity of p15 was analyzed using a dual luciferase assay (Promega, Madison, WI) using a firefly luciferase vector containing the p15 gene. For transient transfection, cells (5 x [10.sup.4] cells/well) were transfected with a total amount of 0.1 [micro]g DNA using Lipofectamine2000 (Invitrogen). Each transfection contained 0.06 [micro]g of LUC vector and pRL renilla luciferase vector (an internal control). These were co-transfected with p15 vector. Transfected cells were lysed after 48 h of cultivation. Luminescence was measured using a single-sample luminometer (TD/20, Turner Design, CA) according to the kit manufacturer's manual (Promega). The average of results from three separate experiments was used to obtain the relative luciferase activity.

Statistical analysis

Results were analyzed by Student's t-test, using Statistical SPSS software package (SPSS Inc., Chicago). Differences were considered statistically different at p < 0.05.

Results

Toxicity of [beta]-asarone in mice

It has reported that [beta]-asarone is a potential cancinogen (Goggelmann and Schimmer 1983; Abel 1987). Therefore, we performed a long-term safety evaluation experiment and a mutagenicity test. We treated mice with [beta]-asarone orally at the dosages of 10, 20, 50 mg/kg/day for 90 days. Results showed a dose-dependent toxicology. Mice treated with 13-asarone at 10, 20 mg/kg did not show any significant changes in hematological items, whereas number of red blood cells (RBC) was decreased and number of white blood cells (WBC) was increased in mice treated at 10 mg/kg (Supplementary Table 1). In blood biochemical items, concentration of total bilirubin (BIL-T) increased in 20, 50 mg/kg treated mice. K* concentration decreased in 20 mg/kg treated mice, and [Cl.sup.-] concentration decreased in 50 mg/kg treated mice (Supplementary Table 2). Moreover, after mice were orally administrated with [beta]-asarone at 200 [micro]g/kg for 20 weeks, no obvious toxicity was observed.

In mutagenicity test, although [beta]-asarone increased numbers of revertants statistically from the concentration of 50 [micro]g/plate, we considered the mutagenicity was observed at 200 [micro]g/plate. Therefore, we considered there was no mutagenicity when cells were treated with 13-asarone at 100 nM (Supplementary Table 3).

Above all, although P-asarone was reported as a potential can-cinogen, we believe it is a dose dependent toxicity. We next calculated LD50 to evaluate preliminary toxicity. The animals that received [beta]-asarone did not exhibit marked behavior change within 24 h. The ones that died just become weak and less active followed by gradual death. The LD50 of [beta]-asarone was 1.56 g/kg. Meanwhile, LD50 of 5-FU is 250 mg/kg: suggesting [beta]-asarone is relative safe for clinical use.

[beta]-Asarone reduces colorectal cancer and inhibits cultured cancer cells

To evaluate whether [beta]-asarone inhibited colorectal cancer, we used a DMH/DSS-induced mouse model of colonic carcinogenesis. Only 40% of the mice in DMH/DSS model group survived to the endpoint of experiments. Mice in the three treatment groups received [beta]-asarone at 50, 100 or 200 lig/kg/day for 20 weeks. No significant difference in body weight was observed for mice treated with [beta]-asarone at 20014/kg/day compared to the control untreated group. However, administration ofp-asarone dose-dependently increased survival rates up to 100% in the 200 [micro]g/kg/day dosage group. In the DMH/DSS-induced model group, 100% of mice formed tumors, whereas no tumors were observed in the control untreated mice. Incidences of tumors in the [beta]-asarone-treated groups were significantly lower than in the control group (Table 1).

Table 1 Effects of [beta]-asarone on DMH/DSS
induced colon cancer mice.

Croup                 n  Body weight  Survival  Incidence  Number
                                 (g)  rate (%)   of tumor      of
                                                            tumor

Control              10   44.3 [+ or       100          0       0
                              -] 3.5

DMH/DSS model        10   38.2 [+ or        40         10      17
                              -] 4.1

Asarone treated (50  10   39.4 [+ or        50          8      13
[micro]g/kg)+                 -] 3.7
DMH/DSS

Asarone treated      10   41.1 [+ or        80          6       7
(100 [micro]g/kg)             -] 3.9
+ DMH/DSS

Asarone treated      10   42.9 [+ or       100          2       3
(200 [micro]g/kg)             -] 4.8
+ DMH/DSS


To investigate the effect of [beta]-asarone on colorectal cancer cells in vitro, an MIT assay was used to test cell survival and a BrdU incorporation assay were used to evaluate cell proliferation. Human colorectal cell lines HT29 and SW480 were treated with [beta]-asarone from 10 to 100 nM for 24,48, or 72 h. The MIT assay (Fig. 1) demonstrated that [beta]-asarone had a time- and dose-dependent effect on viability. From 10 nM to 100 nM, [beta]-asarone markedly inhibited tumor cell survival (p < 0.01 vs. control of 0 nM [beta]-asarone) after 24 h. After treatment for 48 or 72 h, 10 nm [beta]-asarone significantly inhibited both SW480 and HT-29 cell survival (p < 0.01 vs. control 0 nM [beta]-asarone). However, in a BrdU incorporation assay to test active cell proliferation, [beta]-asarone showed no inhibitory effects on either SW480 cells or HT29 cells (data not shown).

[beta]-Asarone induces senescence in colorectal cancer cells in vivo and in vitro

Senescence restricts the tumorigenic potential of cells. Staining for SA-[beta]-Gal was used to test cell senescence in vivo and in vitro. We found significantly more cells undergoing senescence in tumors from [beta]-asarone-treated mice in both the DMH/DSS model and xenografts of nude mice (Fig. 2A and B). Similarly. HT29 cells exposed to [beta]-asarone at 100 nM showed significantly more senescent cells and increased SA-[beta]-Gal staining (Fig. 2C). These results indicated that [beta]-asarone induced senescence in colon cancer cells.

[beta]-Asarone treatment prohibits growth of primary tumors in nude mice

To better understand the molecular effects of [beta]-asarone, we used in vivo analysis. [beta]-asarone was administered to mice with established primary tumor xenografts. Fig. 3 shows that [beta]-asarone significantly inhibited tumor formation of both SW480 and HT-29 cells in nude mice in a dose-dependent manner.

[beta]-Asarone regulates lamin B1 expression in colorectal cancer cells

Lamins, including lamins A/C, and lamin B1 are suppressed in colon cancer, suggesting their pathogenic role in colorectal carcinogenesis (Atreya and Neurath 2008). We therefore evaluated the effects of 13-asarone on lamin family members. Cells were exposed to 0, 10, 30 or 100 nM [beta]-asarone for 24h. Levels of lamins A/C protein remained constant, but levels of lamin B1, as well as p53 and p21, were increased after [beta]-asarone treatment. Oct-1 expression appeared to remained constant, (Fig. 4A). Consistent with the in vitro results, in a mice xenograft tumor model, expression of lamin B1 was markedly elevated in a tumor lysate from [beta]-asarone-treated mice (Fig. 4B). Both p53 and p21 expression were also markedly elevated. These results suggested that [beta]-asarone might affect colon cancer formation through a lamin Bl-related pathway.

[beta]-Asarone induces colon cancer cell senescence by regulating lamin

We transfected HT29 cells with a lamin B1-overexpressing vector to elucidate the function of lamin B1 in colon cancer cells. Fig. 5 shows that overexpression of lamin B1 induced cell senescence in colorectal cancer cells. P53 and p21 expression were elevated when lamin B1 was overexpressed, but decreased when lamin B1 was repressed (Fig. 5A and B). Neither overexpression nor knockdown of p53 changed lamin B1 expression. Furthermore, suppression of p53 did not altered lamin expression in lamin B1 overexpressing cells, meanwhile, overexpressing p53 could partially compensate the repression of p53 induced by lamin B1 depletion. Date above indicated that p53 and p21 is molecule downstream of lamin Bl. We next knocked down lamin 81 in rat normal intestinal epithelial cells (IEC-6). Knockdown of lamin B1 resulted in reduction of cell senescence, enhancing cell survival (Fig. 5D and F) and correlating with repressed p53 and p21 expression (Fig. 5B). This effect is partially blocked by overexpression of p53. On the other hand, overexpression of lamin B1 induced cell senescence and inhibited cell survival, and this effect is partially abolished by knock down of p21.

[beta]-Asarone regulates Oct-1 translocation by regulation of lainin B1 direct binding

After treatment of [beta]-asarone at 100 nm for 12h, SW480 and HT29 cells were lysated and precipitated with lamin B1 antibody. Oct-1 was found in the lamin B1 complex, indicating the direct binding of laminB1 with Oct-1 (Fig. 6A). Oct-1 was expressed throughout nuclear of HT29 cells when lamin B1 expression was very low. However, after treatment with 13-asarone at 100 nm for 12 h, lamin Bl expression was increased, corresponding with the localization of Oct-1 in nuclear envelope (Fig. 6B).

[beta]-Asarone regulates p15 expression by regulation of Oct-1 binding

The p15-Ink4B protein induces cell senescence because it forms a complex with cyclin-dependent kinase (CDK) 4 or CDK6 and prevents the activation of CDK kinases by cyclin D (Schwarze et al. 2011). This leads to inhibition of the tumor cell cycle at the G1 to S phase progression, which induces senescence. We found that p15 was upregulated in colon cancer cells after [beta]-asarone treatment both in vitro and in vivo in a dose-dependent manner (Fig. 7).

Luciferase promoter activity assays showed that p15 promoter activity was enhanced by [beta]-asarone treatment. However, smad3, smad4, BML1, and Oct-1 expression were not altered when cells were exposed to [beta]-asarone (Fig. 4 and data not shown). Nevertheless, ChIP assay showed [beta]-asarone treatment prohibited Oct-1 binding to the p15 promoter (Fig. 7). This indicated that [beta]-asarone did not affect Oct-1 expression, but altered the binding of Oct-1 to the p15 gene promoter.

Discussion

We treated mice with [beta]-asarone, and found this significantly reduced DMH/DSS-induced colon cancer. Xenograft tumor models in mice showed similar results, with [beta]-asarone decreasing tumor size. Furthermore, survival of colorectal cancer cells in vitro was markedly inhibited by incubation with [beta]-asarone. We found [beta]-asarone treatment did not affect cell proliferation, but enhanced senescence. These results suggested that [beta]-asarone prohibited colorectal cancer formation by inducing cell senescence.

We propose a mechanism for [beta]-asarone action that involves lamin B1. The LMNA gene encodes A-type lamins, whereas the B-type lamins, Bl B2, and 83, are encoded by the LMNB1 and LMNB2 genes (Goldman et al. 2002). Nuclear shape and thus the nuclear lamina are associated with the normal aging process as well as with premature aging disorders (Righolt et al. 2011). Loss of lamins is reported as a risk marker for many cancers (Moss et al. 1999). Treatment with [beta]-asarone elevated levels of lamin B1 but not lamins A/C, suggesting that [beta]-asarone might reduce colon cancer by inducing lamin Bl.

Oct-1 is reported to colocalize with Lamin B1 on the nuclear periphery. Dissociation of Oct-1 into the nuclear plasma results in the upregulation of the collagenase gene (Imai et al. 1997). Malhas et al. showed that Oct-1 associates with lamin B1 and that loss of this interaction leads to elevated Oct-1 levels in the nucleoplasm, allowing released Oct-1 to bind to its consensus target sequences. When we investigated Oct-1 expression, we found that although [beta]-asarone treatment did not appear to alter Oct-1 expression, Oct-1 binding to p15 was markedly reduced. This might be clue to an increased amount of lamin Bi that is associated with Oct-1, resulting in less Oct-1 binding to p15 in the nucleoplasm. Incubation of HT29 cells with [beta]-asarone resulted in dose-dependent increases in p15 expression. This might affect cell senescence because P15-INK4b, a CDK inhibitor in the INK4 family of proteins, is a tumor suppressor (Thillainadesan et al. 2012). Upon binding directly to CDK4/6 and specific inhibitors of the cyclin D dependent kinases, p15-INK4b arrests cells in GI of the cell cycle, resulting in cellular senescence (Schwarze et al. 2011). Thus, 13-asarone might induce cellular senescence at least Partially by enhancing D15 expression.

P53 is another tumor suppressor that is known to be crucial in cellular senescence by leading to either cell cycle arrest and DNA repair, or to apoptosis. P21 Waf1/Cip1 is an inhibitor of cell cycle progression that is upregulated by p53. P21 inhibits kinase activity and blocks progression through G1 IS by association with CDK2 complexes (Lo et al. 2012). We found that treatment with [beta]-asarone led to upregulation of p53 and p21 in colorectal cancer cells in vivo and in vitro. Overexpression of lamin B1 resulted in elevated p53 and p21, but neither overexpression nor depletion of p53 affected lamin B1 expression, indicating that p53 functioned downstream of lamin Bl. [beta]-Asarone increased p53 and p21 expression by elevating lamin Bl.

Based on our results, we propose that [beta]-asarone inhibits colorectal carcinogenesis by inducing cellular senescence through lamin Bi. Elevated lamin B1 promotes p53 and p21 expression, and recruits Oct-1 onto nuclear envelope and prevents binding to the p15 promoter, upregulating p15 (Fig. 8). Although [beta]-asarone is reported to induce carcinogenetic toxicity, we found it is a dose-dependent phenomenon. It is relative safe in the dose of clinical use (Abel 1987; Cassani-Galindo et al. 2005). This research shows that [beta]-asarone is a potential lead compound for therapies that prevent colon cancer formation and inhibit its development. We propose a model for the molecular mechanism of [beta]-asarone action that will guide future research.

Conflict of interest statement

The authors declare that there are no conflicts of interest.

Acknowledgements

We thank Dr. Chris Tachibana for her language ed ition. This work was supported by The National Nature Science Foundation of China (No. 81073135).

Appendix A. Supplementary data

Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.phymed.2012.12.008.

References

Abel, G., 1987. Chromosome-damaging effect or beta-asaron on human lymphocytes. Planta Medica 53, 251-253.

Atreya, I., Neurath, M.F., 2008. Immune cells in colorectal cancer: prognostic relevance and therapeutic strategies. Expert Review or Anticancer Therapy 8, 561-572.

Cassani-Galindo, M., Madrigal-Bujaiclar. E., Chamorro, G., Diaz. F., Tamariz, J., Espinosa-Aguirre. JJ., 2005. In vitro genotoxic evaluation of three alpha-asarone analogues. Toxicology In Vitro 19.547-552.

Finkel. T., Serrano, M., Blasco. M.A., 2007. The common biology of cancer and ageing. Nature 448. 767-774.

Freund. A., Laberge. R.M., Demaria. M., Campisi. J., 2012. Lamin B1 loss is a senescence-associated biornarker. Molecular Biology of the Cell 23. 2066-2075.

Goldman. R.D., Gruenbaum, Y., Moir, R.D., Shumaker. D.K., Spann, T.P., 2002. Nuclear lamins: building blocks of nuclear architecture. Genes and Development 16, 533-547.

Goggelmann, W., Schimmer, O., 1983. Mutagenicity testing of beta-asarone and commercial calamus drugs with Salmonella typhimurium. Mutation Research 121,191-194.

Imai, S., Nishibayashi, S., Takao, K., Tomifuji, M., Fujino, T., Hasegawa, M., Takano, T., 1997. Dissociation of Oct-1 from the nuclear peripheral structure induces the cellular aging-associated collagenase gene expression. Molecular Biology of the Cell 8, 2407-2419.

Kevekordes, S., Spielberger, J., Burghaus. C.M., Birkenkamp, P., Zietz, B., Paufler, P., Diez, M., Bolten, C., Dunkelberg, H., 2001. Micronucleus formation in human lymphocytes and in the metabolically competent human hepatoma cell line Hep-G2: results with 15 naturally occurring substances. Anticancer Research 21,461-469.

Kolev, V., Mandinova, A., Guinea-Viniegra, J., Hu, B., Lefort, K., Lambertini, C., Neel, V., Dummer, R., Wagner, E.F., Dotto, G.P., 2008. EGFR signalling as a negative regulator of Notch] gene transcription and function in proliferating keratinocytes and cancer. Nature Cell Biology 10, 902-911.

Liu, J., Shen, M., Yue, Z., Yang, Z., Wang, M., Li, C., Xi n, C., Wang, Y., Mei, Q., Wang, Z., 2012. Triptolide inhibits colorectal cancer cells proliferation by induction of G1 phase arrest through upregulation of p21. Phytomedicine 19.756-762.

Lo. P.K., Lee. J.S., Sukumar, S., 2012. The p53-p21WAF1 checkpoint pathway plays a protective role in preventing DNA replication induced by abrogation of FOXF1 function. Cell Signalling 24.316-324.

Malhas, A.N., Lee, C.F., Vaux, D.J., 2009. Lamin 01 controls oxidative stress responses via Oct-1. Journal of Cell Biology 184,45-55.

Moss, S.F., Krivosheyev, V., de Souza, A., Chin, K., Gaetz, H.P., Chaudhary, N., Wor-man, H.J., Holt, P.R., 1999. Decreased and aberrant nuclear lamin expression in gastrointestinal tract neoplasms. Gut 45, 723-729.

Righolt. C.H., van't Hoff. M.L. Vermolen. B.J., Young, I.T., Raz. V., 2011. Robust nuclear Iamina-based cell classification of aging and senescent cells. Aging (Albany NY) 3, 1192-1201.

Obinata, D., Takayama, K., Urano, T., Murata, T., Kumagai, J., Fujimura, T., Ikeda, K., Horie-Inoue, K., Homma. Y., Ouchi, Y., Takahashi, S., Inoue, S., 2012. Oct1 regulates cell growth of LNCaP cells and is a prognostic factor for prostate cancer. International Journal of Cancer 130. 1021-1028.

Schwarze, S.R., Shi, Y., Fu, V.X., Watson, P.A., Jarrard, D.F., 2011. Role of cyclin-dependent kinase inhibitors in the growth arrest at senescence in human prostate epithelial and uroepithelial cells. Oncogene 20, 8184-8192.

Shimi, T., Butin-lsraeli, V., Adam, S.A., Hamanaka, R.B., Goldman, A.E., Lucas, CA., Shumaker, D.K., Kosak, S.T., Chandel, N.S., Goldman, R.D., 2011. The role of nuclear Lamin B1 in cell proliferation and senescence. Genes and Development 25, 2579-2593.

Thillainadesan, G., Chitilian, J.M., Isovic, M., Ablack, J.N., Mymryk, Tini, M., Torchia, J., 2012. TGF-13-dependent active demethylation and expression of the p15ink4b tumor suppressor are impaired by the ZNF217/CoREST complex. Molecular Cell 46, 636-469.

Wang. Z., Jin, H., Xu, R., Mei, Q., Fan, D., 2009. Triptolide downregulates Racl and the JAK/STAT3 pathway and inhibits colitis-related colon cancer progression. Experimental and Molecular Medicine 41, 717-727.

Wang, D., Geng, Y., Fang, L. Shu, X., Liu, J., Wang, X., Huang, L. 2011. An efficient combination of supercritical fluid extraction and high-speed counter-current chromatography to extract and purify (E)- and (Z)-diastereomers of a-asarone and 13-asarone from Acorus tatarinowii Schott. Journal of Separation Science 34, 3339-3343.

Winawer, S.J., Krabshuis, J., Lambert, R., O'Brien, M., Fried, M., World Gastroenterology Organization Guidelines Committee, 2011. Cascade colorectal cancer screening guidelines: a global conceptual model. Journal of Clinical Gastroenterology 45, 297-300.

Wu, X., Nguyen, B.C., Dziunycz, P., Chang, S., Brooks, Y., Lefort, K., Hofbauer, G.F., Dotto. C.F., 2010. Opposing roles for calcineurin and ATF3 in squamous skin cancer. Nature 465. 368-372.

Yu, W., Gius, D., Onyango, P., Muldoon-Jacobs, K., Karp, J., Feinberg, A.P., Cui, H., 2008. Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature 451,202-206.

Abbreviations: BrdU, bromodeoxyuridine; ChIP, chromatin immunoprecipitation: DMH. 1.2-dimethyl hydrazine; DMSO, dimethylsulfoxide; DSS, dextran sodium sulfate; MTT. 3-(4,5-dimethylthiazol-2-y1)-2,5-diphenyl tetrazoliumbromide; Oct-1, octamer transcription factor 1; SA-P-Gal. senescence [beta]-galactosidase.

* Corresponding author. Tel.: +8629 84777631; fax: +86 29 84777631. E-mail address: sunny77164@1 63.com (Y. Zhang).

1 These authors contributed equally to this work.

Linna Liu (a), (1), Jingjie (b), (1) Wang111, Lei Shi (a), Wenjuan Zhang (a), Xiaoyan Du (a), Zhipeng Wang (c), Yan Zhang (a), (*)

(a.) Department of Pharmaceutics, Tangdu Hospital. Fourth Military Medical University. Xi'an, China

(b.) Department of Gastroenterology. Tangdu Hospital. Fourth Military Medical University. Xi'an. China

(c.) Key Laboratory of Gastrointestinal Pharmacology of Chinese Materia Medico of the State Administration of Traditional Chinese Medicine, Department of Pharmacology, School Pharmacy, Fourth Military Medical University, Xi'an, China
COPYRIGHT 2013 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

 
Article Details
Printer friendly Cite/link Email Feedback
Author:Liu, Linna; Wang, Jingjie; Shi, Lei; Zhang, Wenjuan; Du, Xiaoyan; Wang, Zhipeng; Zhang, Yan
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Geographic Code:9CHIN
Date:Apr 15, 2013
Words:4979
Previous Article:Anti-secretory and cyto-protective effects of chebulinic acid isolated from the fruits of Terminalia chebula on gastric ulcers.
Next Article:New plant sources of the anti-cancer alkaloid, camptothecine from the Icacinaceae taxa, India.
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters