Printer Friendly

?PUEDE EL ADN MITOCONDRIAL PROPORCIONAR INFORMACION SOBRE LA ETNOGENESIS DE LOS PUEBLOS ORIGINARIOS CHILENOS?

CAN MITOCHONDRIAL DNA PROVIDE INFORMATION ON THE ETHNOGENESIS OF CHILEAN NATIVE POPULATIONS?

Si bien la ley indigena chilena (Ley No 19.253) que fue promulgada el 28.09.1993 y publicada el 05.10.1993 especificamente se refiere a los indigenas, sus culturas y sus comunidades y reconoce como principales etnias indigenas de Chile a las comunidades mapuche, aimara, rapa nui o pascuense, atacamena, quechua, colla, diaguita, kawashkar, alacalufe y yamana o yagan, existe incertidumbre acerca del origen y los lazos de parentesco existentes entre estos pueblos originarios. Llama la atencion que incluso con respecto al grupo originario americano mas numeroso de Chile, el pueblo mapuche, no exista claridad de sus origenes. Oswald Menghin, antropologo austriaco, sustentando su hipotesis en rasgos culturales, propuso en 1909 que los mapuches tuvieron su origen en la Amazonia, desde donde habrian migrado a Chile pasando por Argentina y luego cruzando la cordillera de Los Andes (Menghin 1962). Ricardo E. Latcham postulo en 1921 un modelo algo mas complejo que incluia migraciones costeras del norte de Chile, coincidiendo sin embargo con Menghin en el origen amazonico, el paso por Argentina y el cruce de la cordillera de Los Andes (Latcham 1928). Posteriormente, las ideas de Latcham serian apoyadas por el historiador Francisco Antonio Encina. Tomas Guevara en 1925, propuso tambien un desplazamiento de norte a sur de grupos mariscadores y pescadores que manifestaban, segun este autor, diferencias culturales explicables por el contacto con pueblos extranjeros invasores (Guevara 1929). La arqueologa Grete Mostny sostuvo en su libro Prehistoria de Chile que las primeras manifestaciones agroalfareras descubiertas en la region meridional estaban vinculadas con hallazgos arqueologicos realizados en la zona de los valles transversales relacionados con la cultura El Molle y a traves de esta ultima con las culturas tempranas del noroeste argentino (Mostny 1954). A mediados de los anos ochenta nuestro grupo de trabajo postulo una hipotesis provisional sobre el poblamiento de Chile basada esta vez en medidas craneometricas, que confirmaba la existencia de corrientes migratorias de norte a sur planteadas con anterioridad (Rothhammer et al. 1986). Posteriormente, el historiador Roberto E. Porcel sostuvo que los mapuches eran grupos descendientes de aimaras que se desplazaron desde Peru al sur de Chile como consecuencia de las guerras entre el Antisuyo y el Contisuyo, siendo los pehuenches y los tehuelches originariamente argentinos (Porcel 2007). Por ultimo, aplicando un enfoque multidisciplinara que incluyo informacion genetica y cultural, Dillehay y Rothhammer (2013) resumieron recientemente el estado del conocimiento acerca de los origenes de la etnia mapuche. A pesar del esfuerzo realizado por todos estos investigadores, el conocimiento existente del origen de la mayoria de los pueblos originarios continua siendo parcialmente fragmentario y en parte contradictorio. En consecuencia, nos hemos propuesto contribuir al esclarecimiento de este importante aspecto de la historia del pueblo chileno ofreciendo un enfoque desde la perspectiva de la genetica historica.

Como es sabido, el ADNmt fue descubierto en 1963 (Nass y Nass 1963) y secuenciado en 1981 (Anderson et al. 1981). Es una molecula circular, caracterizada por presentar altas tasas de mutacion y ser heredada por linea materna. El ADNmt ha sido utilizado en diferentes areas de investigacion cientifica tales como la composicion genetica de poblaciones humanas actuales, el analisis genetico de restos esqueletales, las migraciones humanas e importantes aplicaciones medico-forenses como la identificacion de personas, entre otras (Catelli et al. 2011). Debido a que el ADNmt solo se transmite por linea materna, ha sido posible trazar la ascendencia matrilineal hasta los origenes de la especie humana en Africa y desde alli su correspondiente division y dispersion por toda la superficie de la tierra, lo cual ha servido de base para la elaboracion de teorias sobre migracion y poblamiento del planeta. Se han encontrado variantes de ADNmt humano que son caracteristicas de algunas poblaciones llamados haplogrupos. Estudios realizados en poblaciones americanas revelaron la existencia de variantes denominados haplogrupos pan-americanos representadas por las letras A, B, C, D y X. Centraremos nuestra atencion en los cuatro mas frecuentes que presentan en diferentes grupos etnicos chilenos frecuencias significativamente diferentes.

Materiales y Metodos

Se obtuvo una muestra de 421 individuos, que incluye en forma proporcional a individuos nacidos en las 15 Regiones de Chile. Las y los voluntarios fueron invitados a participar en este estudio mediante charlas, folletos y afiches. Se informo detalladamente a cada voluntario de los objetivos y procedimientos del estudio y se le invito a firmar un consentimiento informado aprobado por el Comite de Etica/Bioetica de la Universidad de Tarapaca.

Despues de solicitar informacion sobre el nombre completo, lugar de nacimiento, nivel educacional, ancestria e informacion medica, se obtuvo una muestra de 10 cc de sangre venosa de la cual se extrajo ADN genomico mediante el protocolo de extraccion de Lahiri y Nurnberger. Este es un metodo de extraccion por salting out, que a partir de sangre completa consigue eliminar proteinas celulares mediante la deshidratacion y precipitacion con buffers y soluciones saturadas de cloruro de sodio (Lahiri et al. 1991). Los polimorfismos presentes en el ADNmt, que corresponden a los haplogrupos pan-americanos, fueron amplificados mediante la tecnica de PCR (Polymerase Chain Reaction) en un volumen final de 50 ul, utilizando Platinum PCR SuperMix (Invitrogen), 300 ng de ADN genomico y los siguientes partidores especificos:

Haplogroupo A:L604

GTAGCTTACCTCCTCAAAGCAAH708 AGGGTGAACTCACTGGAACG

Haplogroupo B:L8214

CACAGTTTCATGCCCATCGTH8294 ATGCTAAGTTAGCTTTACAGTGG

Haplogroupo C:L13232

CGCCCTTACACAAAATGACATCAAH13344 GGAGCACATAAATAGTATGGC

Haplogroupo D:L5120

CCTAACTACTACCGAATTCCTAH5255 ATTCTTCGATAATGGCCCATTTG

El PCR fue realizado bajo las siguientes condiciones: 1 ciclo a 95[grados]C por 5 minutos, seguido por 35 ciclos a 95[grados]C por 45 segundos, 55[grados]C por 1 minuto y 72[grados]C por 1 minuto y finalmente un ciclo a 72[grados]C por 5 minutos). Los haplogrupos A, C y D fueron obtenidos utilizando enzimas de restriccion especificas para cada haplogrupo: Hae III para haplogrupo A, Hinc II para haplogrupo C y Alu I para el haplogrupo D. El haplotipo B se detecto mediante la observacion directa del producto de la amplificacion, ya que este haplogrupo presenta una delecion de nueve pares de bases en la region intergenica COII/tRNALYs. Las digestiones como la determinacion del haplogrupo B se analizaron mediante electroforesis en gel de agarosa al 2% (TAExl).

Debido a que para algunas regiones geopoliticas el numero de individuos resulto ser reducido, la muestra obtenida fue reagrupada en cinco regiones naturales (RN) de Chile continental: Norte Grande, Norte Chico, Zona Central, Zona Sur y Zona Austral, utilizando criterios de la Corporacion de Fomento de la Produccion (CORFO), con el proposito de obtener la distribucion de las frecuencias de haplogrupos pan-americanos de la poblacion chilena.

Cabe recordar que debido a que el ADNmt es un marcador genetico uniparental, el aporte genetico femenino y masculino varia para cada RN de Chile. Con base en los haplogrupos de ADNmt pan-americanos, que permiten cuantificar el aporte femenino y un conjunto de marcadores informativos de ancestria (en ingles ancestry informative markers o AIM's) que inicialmente fueron seleccionados de un conjunto de mas de 750.000 polimorfismos uninucleotidicos (en ingles single nucleotide polymorphisms o SNP's), con el objeto de calcular los porcentajes de ancestria americana y europea de la poblacion chilena (Fuentes et al. 2014).

Posibles rutas migratorias utilizadas por los ancestros de los grupos originarios chilenos se reconstruyeron calculando distancias geneticas (Fst) entre quechuas, aimaras, atacamenos, changos, pehuenches, mapuches, huilliches, tehuelches, alacalufes, yaganes y onas, que fueron obtenidas con base en frecuencias de haplogrupos publicadas en su mayoria como resultado de numerosos trabajos de terreno, analisis de laboratorio y evaluaciones estadisticas en que participaron activamente Eugenio Aspillaga, Monica Acuna, Pilar Carvallo, Zury Harb, Elena Llop, Mauricio Moraga, Rodrigo Moreno y Hernan Palomino, todos en algun momento integrantes del grupo de genetica de poblaciones del Programa de Genetica Humana de la Facultad de Medicina de la Universidad de Chile. En una segunda etapa el analisis se amplio incluyendo las RN de Chile y haplogrupos publicados de poblaciones mixtas de regiones naturales de Brasil, Bolivia, Peru y Argentina, que podrian eventualmente ser consideradas como lugares de origen de los grupos etnicos chilenos. Las frecuencias de haplogrupos se obtuvieron de Alves-Silva et al. 2000; Bisso-Machado et al. 2012; Cabana et al. 2014; Catelli et al. 2011; de la Fuente et al. 2015; Garcia-Bour, et al. 2004; Lalueza et al. 1995; Moraga et al. 2000; Moraga et al. 2016; Merriwether et al. 1995; Rocco et al. 2002 y Taboada-Echalar et al. 2013.

Las distancias geneticas Fst y el analisis de varianza molecular (AMOVA), para determinar la significacion estadistica de la variacion observada, fueron obtenidos utilizando el programa computacional Arlequin 3.5 (Excoffier y Lischer 2010).

Resultados

En terminos generales la distribucion de haplogrupos pan-americanos en Chile presenta un patron de variacion que indica un poblamiento inicial de norte a sur. El haplogrupo A se encuentra en porcentajes marginalmente bajos en la mayor parte del territorio nacional con excepcion del Norte Chico. En el extremo norte se evidencia un predominio de los haplogrupos B y C. El haplogrupo B disminuye de norte a sur y ausente en la Zona Austral. El haplogrupo C muestra bastante variabilidad a lo largo del territorio y el haplogrupo D aumenta de frecuencia de norte a sur, siendo el haplogrupo dominante en las RN Sur y Austral (Tabla 1).

La reconstruccion aproximada de los aportes geneticos femeninos y masculinos de origen americano y europeo a la poblacion chilena indica que al evaluar la contribucion americana se observa una predominancia femenina. En contraste, al analizar el aporte europeo, se observa consistentemente predominancia masculina en todas las RN de Chile (Tabla 2).

Estos resultados (chi-cuadrado 21,66; P=0,0415) demuestran que gran parte de la composicion genetica de la poblacion chilena proviene de la mezcla de mujeres de origen americano con hombres de origen europeo. Al comparar los promedios de mezcla americana de las RN de Chile calculadas con base en ADNmt y AIM's se observan diferencias que promedian un 38%. El Norte Grande presenta un porcentaje de 27% demostrando menor asimetria con respecto al origen americano y europeo de hombres y mujeres. En resumen, las diferencias indican que en promedio un 86% de los chilenos podria tener una madre americana y un padre de origen europeo.

Con el objeto de definir posibles vias migratorias utilizadas durante la colonizacion de America del Sur que guarden relacion con el origen de los grupos etnicos chilenos, se realizaron calculos de distancias geneticas (Fst) entre grupos originarios del cono sur definidos con base en caracteristicas culturales, fundamentalmente linguisticas (Tabla 3). Se observan valores bajos entre los pueblos quechua, atacameno y chango, observandose distancias algo mayores entre quechuas y aimaras. Los atacamenos ocupan una posicion intermedia presentando distancias geneticas bajas con quechuas y aimaras. Por otra parte, pehuenches, mapuches, huilliches, tehuelches, yaganes y onas exhiben distancias pequenas alejandose los alacalufes. Los huilliches son geneticamente indistinguibles de los tehuelches.

Resulta igualmente interesante analizar las distancias que los pueblos originarios presentan con las poblaciones de las RN de Chile y con individuos que habitan regiones geograficas de America del Sur, que pueden ser consideradas como posibles lugares de origen de los grupos etnicos chilenos tales como Brasil (noroeste), Brasil (noreste), Bolivia (tierras altas), Bolivia (tierras bajas), Peru, Argentina (norte) y Argentina (Sur) (Tabla 4).

El pueblo quechua presenta distancias bajas con Brasil (noroeste), Bolivia (tierras altas y tierras bajas), Peru, Chile (Norte Grande, Norte Chico y Zona Central). A su vez, los aimaras presentan distancias bajas con Bolivia (tierras altas) y los atacamenos con Bolivia (tierras altas), Peru y Chile (Norte Grande). Los changos a su vez son indistinguibles de Chile (Norte Grande) y pehuenches, mapuches y huilliches presentan distancias pequenas con Chile (Zona Sur) y Argentina (Sur) y tambien distancias moderadas con Brasil (noreste), Bolivia (tierras bajas), Argentina (norte) y Chile (Zona central). Los tehuelches presentan distancias bajas con Argentina (Sur) y Chile (Zona sur) y moderadas con Chile (Zona central). Los yaganes exhiben distancias moderadas con Argentina (sur) y Chile (Zona sur). Los alacalufes aparecen geneticamente distanciados de las regiones geograficas y de los pueblos originarios incluidos en el analisis. No seria de extranar que el pequeno tamano al que fue reducido este grupo por los invasores europeos produjo variaciones aleatorias de las frecuencias de haplogrupos que constituyen la base de los valores de distancia genetica Fst.

Discusion

Informacion recientemente publicada acerca de la distribucion de marcadores del cromosoma Y en la poblacion chilena (Moraga et al. 2016; Toscanini et al. 2015) validan nuestra reconstruccion de las diferencias de genero que caracteriza a los componentes ancestrales americano y europeo para el Norte Grande y Norte Chico. Posiblemente el tamano pequeno de las muestras, el diferente lugar de muestreo y el flujo genico europeo que afecto a las zonas meridionales en forma diferencial, pueden explicar las discrepancias menores observables para las Zonas sur y austral.

Si bien la comparacion entre las RN de Chile entre si y con las poblaciones mixtas sudamericanas se basa en haplogrupos pan-americanos, vale decir haplogrupos que no se encuentran en poblaciones europeas o africanas, la reconstruccion de rutas migratorias que ocurrieron hace miles de anos, deberia ser consideradas tentativa, ya que el desplazamiento de individuos y poblaciones, asi como los cambios demograficos y la disrupcion social creada por la invasion europea, podrian haber afectado la distribucion de las poblaciones originarias a lo largo del pais. No obstante, llama la atencion el hecho que el haplogrupo B, que es caracteristico de los grupos quechuas, aimara y atacameno disminuya gradualmente desde el Norte Grande a la Zona sur y los haplogrupos C y D, frecuentes en los grupos mapuche, pehuenche, huilliche, alacalufe y yagan aumenten proporcionalmente, indicando que la presencia fisica de estos pueblos dejo una impronta genetica claramente reconocible (Tabla 1). Hace excepcion la distancia genetica relativamente alta de aimaras y mapuches con Chile (Norte Chico) que contrasta con el valor bajo que presentan quechuas. Este ultimo grupo originario, a su vez presenta valores de Fst bajos con Brasil (noreste), Bolivia (tierras bajas) y Argentina (norte) sugiriendo la ocurrencia de migracion desde Brasil (noreste) a traves del Gran Chaco y Bolivia (tierras bajas) y Argentina (norte) hacia Chile (Norte Chico) (Tabla 4). Recordemos que Mostny (1954) ya planteo la posible relacion de los mapuches con la cultura Molle. Desde el punto de vista genetico no seria sorprendente que el origen de esta cultura podria estar vinculada con desarrollos culturales que ocurrieron en la region de los valles Calchaquies. El hecho que los quechuas se vinculan sustancialmente mas a la Amazonia (Fst = 0,034) que los aimaras (Fst = 0,256), plantea la hipotesis que estos ultimos descienden de los primeros. Informacion genetica publicada (Reich et al. 2012; Wang et al. 2007; Wang et al. 2008) apoya esta hipotesis. La cercania de los huilliches a Argentina sur indicaria un posible origen transandino de esta etnia. Esta hipotesis tambien es avalada por la proximidad genetica de huilliches con la etnia tehuelche. Resulta interesante senalar que huilliches conocidos como "huiliches serranos" y luego como "manzaneros" en Argentina habitaron la region de Neuquen desde el rio Agrio al rio Limay. Luego, supuestamente ocuparon territorios ubicados al sur de la Provincia de Mendoza, desplazando a los pehuenches. Sin embargo, tambien se sostiene que estos huilliches surgieron parcial o totalmente de un proceso de miscegenacion con grupos tehuelches o que, al igual que los pehuenches, habrian sido originalmente huarpidos relacionados con los puelches algarroberos de Cuyo (Benchis 2000). El origen de los huilliches es un buen ejemplo de como se puede complicar el estudio de los origenes de los pueblos originarios al no borrar mentalmente la existencia de los limites nacionales actuales. Lo mas probable es que todo el "complejo araucano", en su sentido mas amplio, ocupara una vasta region a ambos lados de la Cordillera de los Andes y se movilizara dentro de esa region, cruzando por cierto la cordillera de acuerdo con las conveniencias del momento y experimentando paralelamente un proceso gradual de microdiferenciacion genetica y por cierto tambien, cultural.

Sorprende descubrir que los datos del ultimo censo oficial de Chile (Censo 2002) no concuerdan con los resultados obtenidos en este trabajo. Por ejemplo, en la antigua region de Tarapaca (actualmente Region de Arica y Parinacota y Region de Tarapaca) del total de habitantes, 48.665 se declararon pertenecientes a un grupo etnico, de los cuales 83% aproximadamente declararon ser aimara, 11% mapuche, 2% atacameno y 2% quechua. No obstante y en concordancia con los hechos historicos, la distancia genetica de la poblacion del Norte Grande a los grupos quechua es muy pequena (Fst = 0,005) y al grupo aimara casi 20 veces superior (Fst = 0,097). Nos encontramos entonces en el norte frente a una discordancia entre la cultura, incluyendo el idioma, con la cual se identifican muchas personas y su real patrimonio genetico. No obstante, en la Zona sur se observa predominio de personas que se declaran pertenecientes al grupo etnico mapuche. Por ejemplo en la region de la Araucania, de acuerdo al Censo 2002, del total de habitantes, 204.195 se declararon pertenecientes a algun grupo etnico y 203.221 (99,5%) se declararon mapuches, probablemente incluyendo a los representes de los pueblos pehuenche y huilliche.

Conclusiones

Actualmente conviven en la region andina meridional de America del Sur numerosos grupos de pueblos originarios moderadamente divergentes desde el punto de vista genetico. En el norte quechuas, aimaras, atacamenos y en la costa descendientes de changos. En el sur pehuenches, mapuches, huilliches y tehuelches y en el extremo sur alacalufes, yaganes y onas. El analisis de varianza molecular (AMOVA) indica que los tres grupos (norte, sur y extremo sur) difieren en su composicion genetica en un 27% y los pueblos incluidos dentro de cada grupo en un 4%, alcanzando el total de genes compartidos un 69%. Estos resultados son estadisticamente significativos.

Cabe senalar que ademas los resultados obtenidos concuerdan bien con hipotesis previas sobre el origen de los grupos etnicos chilenos. Llamamos especialmente la atencion sobre el hecho que varias hipotesis sobre el origen de los grupos mapuches incluyen un posible aporte genetico amazonico.

Analizando mas detenidamente esta posibilidad, estamos ahora en condiciones de proponer que efectivamente existio flujo genico de la Amazonia a la poblacion mapuche a traves de al menos dos vias migratorias, una utilizando los territorios que actualmente ocupan Peru y Bolivia (tierras altas) y la otra en forma independientemente a traves de Bolivia (tierras bajas) y Argentina (norte). Desde luego, siendo un hecho que la importancia de la Amazonia en el desarrollo de complejidad cultural andina ha sido previamente destacada por numerosos investigadores desde principios del siglo pasado (Lathrap 1970; Rivera y Rothhammer 1991; Rothhammer y Silva 1992; Rothhammer et al. 2009; Sauer 1952; Tello 1929; von Hagen [citado por Zerries 1985]; Zerries 1985) nuestra propuesta no constituye una novedad. Sin embargo resulta interesante destacar que entre los grupos amazonicos que aun viven en la Alta Amazonia (Pozzi-Escot 1998) y que de acuerdo con nuestros resultados comparten un conjunto significativo de genes con los quechuas, se encuentran los caribes y arahuacos. Grupos como estos, de acuerdo a Lathrap (1970), se podrian haber movilizado a la Alta Amazonia utilizando como via de transito el sistema fluvial amazonico en busca de nuevo fondo aluvial para la practica de agricultura de roza. Los desplazamientos poblacionales mencionados, de acuerdo al autor de la hipotesis, probablemente ocurrieron durante el Formativo, cerca de 5.000 a.p., coincidiendo con la llamada transicion demografica neolitica (TDN) gatillada posiblemente por profundos cambios climaticos (Bocquet-Appel 2011). Resulta interesante agregar que importantes investigaciones recientes han destacado el hallazgo de marcadas similitudes geneticas entre los grupos originarios maya y quechua (Reich et al. 2012; Wang et al. 2007; Wang et al. 2008), de modo que los grupos caribes y arahuacos de la Alta Amazonia podrian constituir eslabones microevolutivos intermedios entre mayas y quechuas.

En este trabajo hemos dado respaldo y/o en parte reformulado hipotesis previamente planteadas con base en informacion arqueologica recurriendo a evidencia genetica. Los resultados obtenidos utilizando ADNmt, refuerzan la importancia de la aplicacion de disenos metodologicos multidisciplinarios, que si bien frecuentemente son de ejecucion mas compleja, pueden entregan resultados mas concluyentes.

Agradecimientos: Agradecemos el aporte desinteresado de varios revisores que contribuyeron significativamente a mejorar este manuscrito. Investigacion financiada por el proyecto Fondecyt 1150031.

Referencias Citadas

Alves-Silva, J., M. Da Silva-Santos, P.E.M. Guimaraes, A.C.S. Ferreira, H.J. Bandelt, S.D.J. Pena y V. Ferreira-Prado 2000. The ancestry of Brazilian mtDNA lineages. American Journal of Human Genetics 67:444-461.

Anderson, S., A.T. Bankier, B.G. Barrell, M.H.L. Bruijn, A.R. Coulson, J. Drouin, I.C. Eperon, D.P. Nierlich, B.A. Roe, F. Sanger, P.H. Schreier, A.J. Smith, R. Staden e I.G. Young 1981. Sequence and organization of the human mitochondrial genome. Nature 290:457-465.

Benchis, M. 2000. Piezas de Etnohistoria del Sur Sudamericano. Consejo Superior de Investigaciones Cientificas, Madrid.

Bisso-Machado, R., M.C. Bortolini y F.M. Salzano 2012. Uniparental genetic markers in South Amerindians. Genetics and Molecular Biology 35:365-387.

Bocquet-Appel, J.P. 2011. When the world's population took off: he springboard of the Neolithic Demographic Transition. Science 333:560-561.

Cabana, G.S., C.M. Lewis Jr., R.Y. Tito, R.A. Covey, A.M. Caceres, A.F.D.L. Cruz, D. Durand, G. Housman, B.I. Hulsey, G.C. Iannacone, P.W. Lopez, R. Martinez, A. Medina, O.O. Davila, K.P. Pinto, S.I. Santillan, P.R. Dominguez, M. Rubel,

H.F. Smith, V.R. Massa, B. Lizarraga y A.C. Stone 2014. Population genetic structure of traditional populations in the Peruvian Central Andes and implications for South American population history, Human Biology 86:147-165.

Catelli, M.L., V. Alvarez-Iglesias, A. Gomez-Carballa, A. Mosquera-Miguel, C. Romanini, A. Borosky, J. Amigo, A. Carracedo, C. Vullo y A. Salas 2011. The impact of modern migration on present-day multi-ethnic Argentina as recode don the mitochondrial DNA genome. BioMed Central Genetics 12:77.

Corporacion de Fomento de la Produccion (CORFO) (1950-1962). Geografia Economica de Chile. 3 vols. Editorial Universitaria, Santiago.

De la Fuente, C., J. Galimany, B.M. Kemp, K. Judd, O. Reyes y M. Moraga 2015. Ancient marine hunter-gatherers from Patagonia and Tierra del Fuego: Diversity and differentiation using uniparentally inherited genetic markers. American Journal of Physical Anthropology 158:719-729.

Dillehay, T.D. y F. Rothhammer 2013. Quest for the origins and implications for social rights of the Mapuche in the southern cone of South America. Latin American Antiquity 24:149-163.

Excoffier, L. y H.E.L. Lischer 2010. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources 10:564-567.

Fuentes, M., I. Pulgar, C. Gallo, M.C. Bortolini, S. Canizales-Quinteros, G. Bedoya, R. Gonzalez-Jose, A. Ruiz-Linares y F. Rothhammer 2014. Geografia genica de Chile. Distribucion regional de los aportes geneticos americanos, europeos y africanos. Revista Medica de Chile 142:281-289.

Garcia-Bour, J., A. Perez-Perez, S. Alvarez, E. Fernandez, A.M. Lopez-Parra, E. Arrollo-Pardo y D. Turbon 2004. Early Population differentiation in extinct aborigines from Tierra del Fuego-Patagonia: Ancient mtDNA sequences and Y-chromosome DTR characterization. American Journal of Physical Anthropology 123:361-370.

Guevara, T. 1929. Historia de Chile. Chile Prehispanico. Tomo I, Universidad de Chile, Santiago.

Lahiri, D.K. y J.I. Nurnberger 1991. A Rapid non-enzymatic method for preparation of HMW DNA from blood for RFLP studies. Nucleic Acid Research 19 (19):5444.

Lalueza, C. 1995. Recuperacion de DNA Mitochondrial y Caracterizacion de Variabilidad en Poblaciones Antiguas, PhD Tesis, Universidad de Barcelona, Barcelona.

Latcham, R. 1928. La Prehistoria Chilena. Soc. Imp. y Lit. Universo. Santiago.

Lathrap, D.W. 1970. The Upper Amazon. Thames & Hudson Ltd., Southampton.

Menghin, O. 1962. Estudios de Prehistoria Araucana. Centro Argentino de Estudios Prehistoricos, Buenos Aires.

Merriwether, D.A., F. Rothhammer y R.E. Ferrel 1995. Distribution of the four founding lineage haplotypes in Native Americans suggests a single wave of migration for the New World. American Journal of Physical Anthropology 98: 411-430.

Moraga, M., P. Pezo y M. de Sant Pierre 2016. El genoma de herencia uniparental en el estudio de las poblaciones fundadoras. En El ADN de los Chilenos y sus Origenes Geneticos, editado por S. Berrios del Solar, pp. 63-90. Editorial Universitaria, Santiago.

Moraga, M., P. Rocco, J.F. Miquel, F. Nervi, E. Llop, R. Chakraborty, F. Rothhammer y P. Carvallo 2000. Mitochondrial DNA polymosphisms in Chilean Aboriginal populations: Implications for the peopling of the Southern cone of the continent. American Journal of Physical Anthropology 113:19-29.

Mostny, G. 1954. Prehistoria de Chile. Editorial Universitaria, Santiago.

Nass, M. y S. Nass 1963. Intramitochondrial fibers with DNA characteristics I. fixation and electron staining reactions. The Journal of Cell Biology 19:593-611.

Porcel, R.E. 2007. La Araucanizacion de Nuestra Pampa. Los Tehuelches y Pehuenches. Los Mapuches Invasores. Porcel, R.E., Buenos Aires.

Possi-Escot, I. 1998. El Multilinguismo en el Peru. Centro de Estudios Regionales y Andinos "Bartolome de Las Casas", Cusco.

Reich, D., N. Patterson, D. Campbell, A. Tandon, S. Mazieres, N. Ray, M.V. Parra, W. Rojas, C. Dique, N. Mesa, L.F. Garcia, O. Triana, S. Blair, A. Maestre, J.C. Dib, C.M. Bravi, G. Bailliet, D. Corach, T. Hunemeier, M.C. Bortolini, F.M. Salzano, M.L. Petzl-Erler, V. Acuna-Alonzo, C. Aguilar-Salinas y S. Canizales-Quinteros 2012. A reconstructing Native American population History. Nature 488:370-374.

Rivera, M. y F. Rothhammer 1991. The Chinchorro people of Northern Chile 5000 BC-500 BC. A review of their culture and relationships. International Journal of Anthropology 3:243-255.

Rocco, P., C. Morales, M. Moraga, J.F. Miquel, F. Nervi, E. Llop, P. Carvallo, F. Rothhammer 2002. Composicion genetica de la poblacion chilena. Distribucion de polimorfismos de DNA mitocondrial en grupos originarios y en la poblacion mixta de Santiago. Revista Medica de Chile 130 (2):125-131.

Rothhammer, F., C. Santoro, E. Poulin, M. Moraga y V. Standen 2009. Archeological and mtDNA evidence for tropical lowland migrations during the late archaic/formative in northern Chile. Revista Chilena de Historia Natural 82:543-552.

Rothhammer, F. y C. Silva 1992. Gene Geography of South America: Testing models of population displacements based on archaeological evidence. American Journal of Physical Anthropology 89:441-446.

Rothhammer, F., C. Silva, J.A. Cocilovo y S. Quevedo 1986. Una hipotesis provisional sobre el poblamiento de Chile basada en el analisis multivariado de medidas craneometricas. Chungara 16-17:295-306.

Sauer, C.O. 1952. Agricultural Origins and Dispersals. The American Geographical Society, New York.

Taboada-Echalar, P., V. Alvarez-Iglesias, T. Heinz, L. Vidal-Bralo, A. Gomez-Carballa, L. Catelli, J. Pardo-Seco, A. Pastoriza, A. Carracedo, A. Torrez-Balanza, O. Rocabado, C. Vullo y A. Salas 2013. The genetic legacy of the pre-colonial period in contemporary Bolivians. Plos One 8:1-14.

Tello, J.C. 1929. Antiguo Peru. I Epoca. Empresa Editora Excelsior, Lima.

Toscanini, U., F. Moreno, J.A. Pantoja-Astudillo, E.A. Morales, P. Bustos y A. Salas 2015. A reference frecuency database of 15 autosomal STRs in Chile. Forensic Science International Genetics 19:35-36.

Wang, S., C.M. Lewis, M. Jabobsson, S. Ramachandran, N. Ray, G. Bedoya, W. Rojas, M.V. Parra, J. Molina, C. Gallo, G. Mazzotti, G. Poletti, K. Hill, A.M. Hurtado, D. Labuda, W. Klitz, R. Barrantes, M.C. Bortolini, F.M. Salzano, M. Petzl-Erler, L.T. Tsuneto, E. Llop, F. Rothhammer, L. Excoffier, M. Feldman, N. Rosenberg y A. Ruiz-Linares 2007. Genetic variation and population structure in native Americans. Plos Genetics 3 (11): 2049-2067.

Wang, S., N. Ray, W. Rojas, M.V. Parra, G. Bedoya, C. Gallo, G. Poletti, G. Mazzotti, K. Hill, A.M. Hurtado, B. Camrena, H. Nicolini, W. Klitz, R. Barrantes, J.A. Molina, N.B. Freimer, M.C. Bortolini, F.M. Salzano, M.L. Petzl-Erler, L.T. Tsuneto, J.E. Dipierri, E.L. Alfaro, G. Bailliet, N.O. Bianchi, E. Llop, F. Rothhammer, L. Ecoffier y A. Ruiz-Linares 2008. Geographic patterns of genome admixture in Latin American mestizos. Plos Genetics 4:1-9.

Zerries O. 1985. Morteros para Parica, Tabletas para Aspirar y Bancos Zoomorfos. Indiana 10 (2):421-441.

Francisco Rothhammer (1), Giannina Puddu (1), Macarena Fuentes-Guajardo (2,3)

(1) Instituto de Alta Investigacion, Universidad de Tarapaca, Antofagasta 1520 Arica, Chile. franciscorothhammer@gmail.com; ninapuddu@gmail.com

(2) Department of Genetics, Evolution and Environment, and Genetics Institute, University College London, London, WC1E 6BT, United Kingdom. Macarena.fuentes.guajardo@gmail.com

(3) Departamento de Tecnologia Medica, Facultad de Ciencias de la Salud, Universidad de Tarapaca, Arica, Chile.

Recibido: noviembre 2016. Aceptado: julio 2017.

http://dx.doi.org/10.4067/S0717-73562017005000028. Publicado en linea: 08-agosto-2017.
Tabla 1. Distribucion de haplogrupos panamericanos de ADNmt en cinco
regiones naturales de Chile.

Distribution of pan-American mtDNA
haplogroups in five natural regions of Chile.

Region natural   N           Haplogrupos
                       A %   B %   C %   D %

Norte Grande     32    0     53    28    19
Norte Chico      19    16    32    47    5
Zona Central     206   7     33    34    25
Zona Sur         157   4     25    41    31
Zona Austral     7     0     14    29    57

Tabla 2. Aporte femenino y masculino de origen americano y
europeo a la poblacion chilena.

American and European female and male
contribution to the Chilean population.

               Origen ancestral       Origen ancestral
Region         americano              europeo
natural        Femenino   Masculino   Femenino   Masculino
               %          %           %          %

Norte Grande   39         12          9          36
Norte Chico    45         7           4          41
Zona Central   41         1           6          48
Zona Sur       45         3           4          46
Zona Austral   45         4           5          44
Total          43         5           6          43

Tabla 3. Distancias Fst entre pueblos originarios de Chile y
Argentina.

Fst distances between native populations from Chile and Argentina.

            Quechua   Aimara   Atacameno   Chango   Pehu-   Mapuche
                                                    enche

Quechua     0
Aimara      0,081     0
Atacameno   0,019     0,017    0
Chango      0,025     0,105    0,059       0
Pehuenche   0,214     0,425    0,328       0,163    0
Mapuche     0,236     0,468    0,365       0,197    0       0
Huilliche   0,126     0,302    0,215       0,042    0,050   0,076
Alacalufe   0,384     0,592    0,544       0,356    0,122   0,149
Yagane      0,271     0,531    0,424       0,236    0       0
Ona         0,262     0,537    0,419       0,254    0,016   0
Tehuelche   0,179     0,395    0,298       0,092    0,011   0,031

            Huilliche   Alacalufe   Yagan   Ona     Tehuelche

Quechua
Aimara
Atacameno
Chango
Pehuenche
Mapuche
Huilliche   0
Alacalufe   0,145       0
Yagane      0,095       0,118       0
Ona         0,143       0,318       0       0
Tehuelche   0           0,099       0,043   0,104   0

Tabla 4. Distancias Fst entre poblaciones actuales mixtas
sudamericanas y originaras de Chile y Argentina.

Fst distances between contemporary mixed South American and native
Chilean and Argentinian populations.

                        Quechua   Aimara   Atacameno   Chango

Amazonia                0,034     0,256    0,122       0,061
Brasil Noreste          0,095     0,304    0,179       0,096
Bolivia Tierras Altas   0,026     0,015    0           0,053
Bolivia Tierras Bajas   0,038     0,222    0,110       0,075
Peru                    0         0,084    0,025       0,013
Argentina Norte         0,089     0,293    0,175       0,120
Argentina Sur           0,085     0,303    0,182       0,054
Norte Grande            0,005     0,097    0,035       0
Norte Chico             0,048     0,300    0,150       0,109
Zona Central            0,045     0,215    0,118       0,033
Zona Sur                0,097     0,296    0,189       0,064

                        Pehuenche   Mapuche   Huilliche   Yagan

Amazonia                0,115       0,129     0,091       0,146
Brasil Noreste          0,175       0,206     0,092       0,216
Bolivia Tierras Altas   0,335       0,367     0,217       0,416
Bolivia Tierras Bajas   0,136       0,148     0,108       0,167
Peru                    0,193       0,216     0,105       0,250
Argentina Norte         0,124       0,136     0,114       0,146
Argentina Sur           0,036       0,053     0,018       0,064
Norte Grande            0,179       0,206     0,088       0,248
Norte Chico             0,156       0,168     0,151       0,192
Zona Central            0,077       0,091     0,047       0,1125
Zona Sur                0,031       0,039     0,034       0,0543

                        Alacalufe   Ona     Tehuelche

Amazonia                0,358       0,115   0,116
Brasil Noreste          0,311       0,235   0,128
Bolivia Tierras Altas   0,499       0,415   0,293
Bolivia Tierras Bajas   0,326       0,141   0,136
Peru                    0,361       0,244   0,155
Argentina Norte         0,291       0,129   0,132
Argentina Sur           0,203       0,073   0,023
Norte Grande            0,429       0,239   0,138
Norte Chico             0,478       0,134   0,181
Zona Central            0,264       0,101   0,065
Zona Sur                0,215       0,049   0,032
COPYRIGHT 2017 Universidad de Tarapaca
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Rothhammer, Francisco; Puddu, Giannina; Fuentes-Guajardo, Macarena
Publication:Revista Chungara. Revista de Antropologia Chilena
Date:Oct 1, 2017
Words:5718
Previous Article:EVALUACION DE LA VARIACION FENOTIPICA DEL PESO, LA FORMA Y LA MASA CORPORAL EN GRUPOS CAZADORES-RECOLECTORES PREHISTORICOS DE PATAGONIA Y TIERRA DEL...
Next Article:MUSEO ARQUEOLOGICO SAN MIGUEL DE AZAPA: 50 ANOS DE INVESTIGACION, PROTECCION Y DIFUSION DEL PATRIMONIO CULTURAL DE LA REGION DE ARICA Y PARINACOTA.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters