Printer Friendly
The Free Library
14,495,914 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Yellow pygmy rice rat (Oligoryzomys flavescens) and hantavirus pulmonary syndrome in Uruguay. (Research).


During 5,230 trapping nights, 672 small mammals were trapped in the areas where most hantavirus pulmonary syndrome hantavirus pulmonary syndrome An often fatal RTI caused by a hantavirus; the first cluster occurred in the Four Corners region of Southwestern US Epidemiology Mean age 32, 61% ♀, 72% Native American Case definition Unexplained bilateral interstitial  (HPS See Seer*HPS. ) cases occur in Uruguay. Yellow pygmy rice rats (Oligoryzomys flavescens) were the only rodents that showed evidence of antibodies to hantavirus hantavirus, any of a genus (Hantavirus) of single-stranded RNA viruses that are carried by rodents and transmitted to humans when they inhale vapors from contaminated rodent urine, saliva, or feces. There are many strains of hantavirus. , with a seroprevalence seroprevalence Immunology The proportion of a population that is seropositive–ie, has been exposed to a particular pathogen or immunogen; the seropositivity of a population is calculated as the number of individuals who produce a particular antibody divided  of 2.6%. The rodents were trapped in all the explored environments, and most of the seropositive seropositive /se·ro·pos·i·tive/ (-poz´i-tiv) showing positive results on serological examination; showing a high level of antibody.

se·ro·pos·i·tive
adj.
 rodents were found in habitats frequented by humans. Nucleotide sequences were obtained from four HPS case-patients and four yellow pygmy rice rats of the M genome segment. Sequence comparison and phylogenetic analysis showed that rodent-borne viruses and viruses from three HPS case-patients form a well-supported clade clade Cladus, subtype Genetics A branch of biological taxa or species that share features inherited from a common ancestor; a single phylogenetic group or line. See Inheritance, Species.  and share a 96.4% identity with the previously characterized Central Plata hantavirus. These results suggest that yellow pygmy rice rat (O. flavescens) may be the host for Central Plata, a hantavirus associated with HPS in the southern area of Uruguay.

**********

The family Bunyaviridae consists of five genera. Viruses in the Hantavirus genus are unique among them because all members (except Thottapalayam virus) are rodent-borne. Viruses in the other four genera are arthropod-borne. Hantavirus pulmonary syndrome (HPS) was first identified in the United States in 1993. The discovery of the outbreak was followed by the identification of Sin Nombre virus The Sin Nombre virus (literally "unnamed virus" in Spanish) (SNV) is the prototypical etiologic agent of hantavirus cardiopulmonary syndrome (HCPS). It was first isolated from rodents collected near the home of one of the initial patients with hantavirus pulmonary syndrome  (SNV SNV Synovus Financial Corp. (stock symbol)
SNV Schweizerische Normenvereinigung (Swiss standards body)
SNV Stichting Nederlandse Vrijwilligers (Netherlands Development Organization) 
) as the primary etiologic agent of HPS (1). Since these findings, many countries in the Americas have identified cases and outbreaks of this syndrome, and several other related viruses (New World hantaviruses) have been recognized (2-9).

New World hantaviruses are carried by different species of sigmodontine and arvicoline rodents (Muridae). Indeed, genetic diversity and geographic distribution of these viruses are related to the genetic diversity, geographic distribution, and phylogenetic history of their rodent hosts. In South America, studies of the correlation between rodent hosts and indigenous hantaviruses are complicated by the great diversity of sigmodontine rodents in this area. Also, the sympatric sym·pat·ric  
adj. Ecology
Occupying the same or overlapping geographic areas without interbreeding. Used of populations of closely related species.
 distributions between the different species of sigmodontine rodents in South America provide opportunities for spillover infections and host-switching events (10).

In Uruguay, the first evidence of the circulation of these viruses came from a study of serum specimens collected from blood donors between 1985 and 1987 that showed a seroprevalence of 1%, as measured by indirect fluorescent antibody (IFA Immunofluorescent assay (IFA)
A blood test sometimes used to confirm ELISA results instead of using the Western blotting. In an IFA test, HIV antigen is mixed with a fluorescent compound and then with a sample of the patient's blood.
) test using Hantaan and Seoul antigens (11). Since 1997, the Ministerio de Salud Publica, through the Departamento de Laboratorios, began the surveillance and diagnosis of HPS. In 2000 Padula et al. (12) reported partial sequences (G1 and G2 glycoprotein glycoprotein (glī'kōprō`tēn), organic compound composed of both a protein and a carbohydrate joined together in covalent chemical linkage. ) derived from two HPS cases that occurred in Uruguay in 1997 and 1999. These viruses clustered within a previously reported lineage named Central Plata.

Knowledge about small mammal communities and habitat preferences is limited in Uruguay. However, some studies about systematic distribution, reproduction, and cytogenetic cytogenetic /cy·to·ge·net·ic/ (-je-net´ik)
1. pertaining to chromosomes.

2. pertaining to cytogenetics.


cytogenetic

pertaining to or originating from the origin and development of the cell.
 aspects have been published (13-17). Research regarding the distribution and habitat preferences of the Muridae family in Uruguay is currently being conducted (18-20).

The purpose of this study was to identify the carrier rodents of hantavirus in Uruguay and their potential association with HPS cases, to determine the prevalence of infection in different habitats, and to begin to genetically characterize the hantaviruses recovered from these rodents.

Material and Methods

HPS Case Identification

National surveillance for HPS was reinforced when a case definition was established by the Ministerio de Salud Publica in 1997. An HPS case was suspected in a previous healthy person with an acute febrile illness acute febrile illness A nonspecific term for an illness of sudden onset accompanied by fever  (temperature >38[degrees]C), associated with dyspnea dyspnea /dysp·nea/ (disp-ne´ah) labored or difficult breathing.dyspne´ic

paroxysmal nocturnal dyspnea
, acute respiratory distress syndrome acute respiratory distress syndrome
n.
See adult respiratory distress syndrome.
 with pulmonary noncardiogenic edema edema (ĭdē`mə), abnormal accumulation of fluid in the body tissues or in the body cavities causing swelling or distention of the affected parts. , or interstitial bilateral infiltrates, hypotension hypotension
 or low blood pressure

Condition in which blood pressure is abnormally low. It may result from reduced blood volume (e.g., from heavy bleeding or plasma loss after severe burns) or increased blood-vessel capacity (e.g., in syncope).
 or shock, elevated leukocyte count, and thrombocytopenia Thrombocytopenia Definition

Thrombocytopenia is an abnormal drop in the number of blood cells involved in forming blood clots. These cells are called platelets.
 (21). A case of HPS was confirmed when, in addition to clinical illness, circulating specific hantavirus immunoglobulin (Ig) M was detected.

Human serum samples were tested for the presence of IgM and IgG antibodies with an enzyme-linked immunosorbent assay enzyme-linked immunosorbent assay
n.
ELISA.


Enzyme-linked immunosorbent assay (ELISA)
A diagnostic blood test used to screen patients for AIDS or other viruses.
 (ELISA ELISA (e-li´sah) Enzyme-Linked Immuno-Sorbent Assay; any enzyme immunoassay using an enzyme-labeled immunoreactant and an immunosorbent.

ELISA
n.
) developed by MRL MRL Medical Record Librarian; now called Medical Record Administrator.

MRL

maximum residue limit.
 (Hantavirus ELISA IgM and Hantavirus ELISA IgG, MRL Diagnostics, Cypress, CA). The test was used to screen patients, and in every case, the results were confirmed by retesting the specimens by an in-house enzyme immunoassay Immunoassay

An assay that quantifies antigen or antibody by immunochemical means. The antigen can be a relatively simple substance such as a drug, or a complex one such as a protein or a virus.
 with a recombinant nucleocapsid nucleocapsid /nu·cleo·cap·sid/ (noo?kle-o-kap´sid) a unit of viral structure, consisting of a capsid with the enclosed nucleic acid.

nu·cle·o·cap·sid
n.
 antigen specific to Andes virus, according to the procedure developed by Padula et al. (12).

Site Selection

Rodent sampling was conducted at the most likely sites of infection for known HPS case-patients and included the places where the person had lived or worked in the 6 weeks before onset of symptoms and nearby natural habitats. The trapping sites were classified as 1) domestic and peridomestic, including all sites in the immediate vicinity of houses, sheds, gardens, road borders, and fence lines, and 2) rural natural ecosystems and agro-ecosystems, including representative habitats of each area such as open fields, cultivated areas, wetlands, shrublands, brook borders, natural forests, and artificial woods (planted by humans) (Table 1).

The trapping expeditions were performed in the following areas: Puntas de Valdez (34[degrees]32'S/56[degrees]36'W) and Piedritas (34[degrees]20'S/55[degrees]39'W) (one expedition each); Cerrillos (34[degrees]38'S/56[degrees] 19'W), Melilla (34[degrees]44'S/56[degrees] 16'W), and Sauce (34[degrees]35'S/56[degrees]08'W) (two expeditions each) (Figure 1). The geographic area covered by the trapping expeditions corresponded to areas where 16 HPS cases occurred in Montevideo and Canelones, two cases occurred in San Jose, and one case occurred in Florida. The other 19 cases were dispersed in the southern half of Uruguay, and for some of them, the probable site of infection was not clearly identified.

[FIGURE 1 OMITTED]

The landscape of Canelones, rural Montevideo, Florida, and San Jose shows cultivated areas, stubble areas, shrublands in the territories abandoned by rural people, range lands, natural and artificial woodlands, small wetlands, and small brooks. In recent years, many rural inhabitants
:This article is about the video game. For Inhabitants of housing, see Residency
Inhabitants is an independently developed commercial puzzle game created by S+F Software. Details
The game is based loosely on the concepts from SameGame.
 have migrated to the cities; abandoned farmlands have thus been transformed into shrublands.

Small-Mammal Trapping and Processing

Small mammals were trapped in six expeditions in the above-mentioned areas from May 1997 until September 2001. Each trapping site was sampled with Sherman live-capture traps (model LFATDG 23 cm x 8 cm x 8.5 cm) (Sherman Traps Inc., Tallahassee, FL). The number of traps depended on the available area for trap placement at each trapping site. The traps were placed at 5-m intervals in line transects, along the different environments at the trapping site. The traps were set out in the late afternoon and checked in the early morning for the next two mornings. The animals were trapped and sampled according to established biosafety guidelines (22). Each animal was anesthetized a·nes·the·tize also a·naes·the·tize  
tr.v. a·nes·the·tized, a·nes·the·tiz·ing, a·nes·the·tiz·es
To induce anesthesia in.



a·nes
, and blood was collected from the retroorbital sinus. The animals were humanely killed, and their size, mass, sex, and reproductive status were recorded. Samples of liver, kidney, lung, and brain were extracted and stored in liquid nitrogen for further processing. The individual animals were tentatively identified in the field by external characteristics, and the carcasses were kept in 10% formalin formalin /for·ma·lin/ (for´mah-lin) formaldehyde solution.

for·ma·lin
n.
An aqueous solution of formaldehyde that is 37 percent by weight.
. Identification was confirmed by cranial measurements and dental examination at the laboratory. All specimens were deposited at the collection of the Seccion Zoologia Vertebrados, Facultad de Ciencias, Universidad de la Republica, Montevideo, Uruguay.

ELISA

Serologic testing of rodents was performed by IgG ELISA. Briefly, the IgG ELISAs were performed by coating polyvinyl chloride microtiter plates (Dynex Technologies, Chantilly, VA) overnight at 4[degrees]C with a Lechiguanas virus (LECV) antigen (inactivated inactivated

rendered inactive; the activity is destroyed.


inactivated viruses
treated so that they are no longer able to produce evidence of growth or damaging effect on tissue.
, 3 M rad gamma-ray irradiation detergent-extracted lysate ly·sate
n.
The cellular debris and fluid produced by lysis.
 of Vero-E6 infected cells, with a 100% infection index controlled by indirect immunofluorescence). An uninfected Vero E6 cell culture antigen was used to determine the specificity of mouse antibodies. Unbound unbound

said of electrolytes, e.g. iron and calcium, and other substances which are circulating in the bloodstream and are not bound to plasma proteins so that they are available immediately for metabolic processes. See also calcium, iron.
 antigen was removed by washing three times with phosphate-buffered saline (PBS PBS
 in full Public Broadcasting Service

Private, nonprofit U.S. corporation of public television stations. PBS provides its member stations, which are supported by public funds and private contributions rather than by commercials, with educational, cultural,
)-Tween 20, 0.1% (Sigma-Aldrich, St. Louis, MO). After blocking with PBS-Tween 20, 0.1%-dry milk 5% (37[degrees]C, 1 h), sera diluted fourfold, beginning with 1:100, were added to react with the antigen-coated wells. Bound antigen was measured by the use of a hyperimmune hyperimmune /hy·per·im·mune/ (hi?per-i-mun´) possessing very large quantities of specific antibodies in the serum.

hyperimmune

possessing very large quantities of specific antibodies in the serum.
 mouse ascitic as·ci·tes  
n. pl. ascites
An abnormal accumulation of serous fluid in the abdominal cavity.



[Middle English aschites, from Late Latin asc
 fluid and by using goat anti-Peromyscus leucopus IgG (H+L) and goat-anti rat IgG (heavy- and light-chain--specific; Kirkegaard & Perry Laboratories, Gaithersburg, MD) conjugated conjugated
adj.
Conjugate.


estrogens, conjugated Warning - Hazardous drug!

C.E.S.
 to horseradish peroxidase. Optical densities (ODs) at 405 nm were recorded on a microplate spectrophotometer spectrophotometer, instrument for measuring and comparing the intensities of common spectral lines in the spectra of two different sources of light. See photometry; spectroscope; spectrum.  (Labsystems Multiskan EX; Thermo Labsystems, Finland, Vartaa, Finland), and the ODs of the uninfected antigen-coated well were subtracted from that of its corresponding viral antigen to yield the adjusted OD. A serum dilution was considered positive if OD was >0.2 U after adjustment. A serum titer [greater than or equal to] 400 was considered positive.

Total RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 Extraction and RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.


Total RNA was extracted from lung tissue of seropositive rodents and from blood clots from HPS case-patients. Approximately 100 mg of tissue was treated with 1 mL of TRIzol reagent (GIBCO GIBCO Grand Island Biological Company (tissue culture media enterprise)  BRL BRL

In currencies, this is the abbreviation for the Brazilian Real.

Notes:
The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion.
, Life Technologies, Rockville, MD), according to manufacturer's instructions. An M genome segment of the G2 glycoprotein encoding region was amplified by using reverse transcription-polymerase chain reaction (RT-PCR) and specific oligonucleotides as previously described by Levis et al. (4).

RT was carried out using MMLV MMLV Moloney Murine Leukemia Virus  reverse transcriptase (GIBCO BRL) and the oligonucleotide 3348(-) (5'CTGTCCAGATTTAGTGTTCCA 3'). cDNA was then precipitated with NaAc (ICN ICN International Council of Nurses.  Biomedicals, Costa Mesa, CA) 3 M pH 5.6, ethanol (Merck Quimica Argentina, Buenos Aires, Argentina), and lineal That which comes in a line, particularly a direct line, as from parent to child or grandparent to grandchild.


LINEAL. That which comes in a line. Lineal consanguinity is that which subsists between persons, one of whom is descended in a direct line from the other.
 polyacrylamide pol·y·a·cryl·a·mide  
n.
A white polyamide, (-CH2CHCONH2-), related to acrylic acid.



[poly- + acryl(ic acid) + amide.
 2.5 [micro]g/[micro]L (ICN Biomedicals), and resuspended in 20 [micro]L of double distilled water Double distilled water (abbreviated "ddH2O" or "Bidest. water") is prepared by double distillation of water. It is used, among other things, when single distillation does not lead to sufficiently pure water for some applications in biochemistry. . Two microliters of first-strand cDNA was used in the PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 reaction. Two rounds of PCR were performed by using Taq DNA polymerase (GIBCO BRL). The first round was performed with oligonucleotides 3348 (-) and 2765 (+) (5'CTGTATGTGAGTACCAAG 3'), and the second round (heminested) was performed with 1 [micro]L of first-round reaction and oligonucleotides 3221 (-) (5'TCAGAAGAGCAGTCAGTGTCATG 3') and 2765 (+), giving a 456-nucleotide (nt) fragment. PCR fragments were visualized on ethidium bromide 1.5% agarose gels.

Sequencing and Phylogenetic Analysis

The PCR fragments obtained from rodent and HPS case-patient samples were purified for further sequencing by using the Concert rapid gel extraction system (GIBCO BRL) or QIAquick gel extraction kit (QIAGEN Inc., Valencia, CA). Nucleotide sequencing was conducted by using the oligonucleotide 2765(+) and an ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 377 Genetic Analyser (PE Applied Biosystems, Inc., Foster City, CA).

Alignment of sequences was done by using CLUSTALX (1.5) (23). Phylogenetic analyses and sequence comparison were carried out with PAUP PAUP Phylogenetic Analysis Using Parsimony * 4.0b10 (24) and MEGA version 2.1 (25). Maximum parsimony analysis was carried out by using the heuristic search option. Maximum parsimony trees were searched by applying the tree bisection bisection /bi·sec·tion/ (bi-sek´shun) division into two parts by cutting.

bisection

division into two parts by cutting.
 reconnection branch-swapping algorithm. A consensus tree was obtained through 50% majority rule consensus. For the distance-based approach, MODELTEST 3.06 (26) was used to establish the most suitable model of DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 substitution that best fitted our dataset, and a phylogenetic tree was obtained by using the neighbor-joining algorithm. Bootstrap See boot.

(operating system, compiler) bootstrap - To load and initialise the operating system on a computer. Normally abbreviated to "boot". From the curious expression "to pull oneself up by one's bootstraps", one of the legendary feats of Baron von Munchhausen.
 analysis (27) was performed to estimate topologic accuracy of the trees (500 replicates), and only values >70% were considered significant.

For comparison, existing sequence data from GenBank were used: hantavirus sequences from Argentina (GenBank accession nos. AF028023 to AF028027, AF028029 to AF028063), Central Plata genotype from Uruguay (GenBank accession nos. AY101184 and AY101185), and Sin Nombre virus (L37903, isolate NMR NMR: see magnetic resonance. 11); the last one was used as outgroup.

Results

HPS Cases

From April 1997 to August 2002, 38 cases of liPS were confirmed by ELISA, with a fatality rate of 21.0%. Twenty-four (63.2%) of these cases occurred in rural or suburban areas of Montevideo and Canelones, 6 (15.7%) in Colonia, 3 in Soriano (7.9%), 2 in San Jose (5.3%), 2 in Rocha (5.35%), and 1 in Florida (2.6%) (Figure 1). As of August 2002, HPS cases in Uruguay had occurred in the southern half of the country.

Distribution of Rodents by Species and Capture Site

During 5,230 trap-nights, 672 small mammals were collected (trap success = 12.8%). The trapped small mammals belonged to two families (Muridae and Caviidae) within the order Rodentia and one family (Didelphidae) in the order Didelphimorphia. The mammals belonged to 11 species, 75.1% of the captured animals corresponded to the Sigmodontinae subfamily subfamily /sub·fam·i·ly/ (sub´fam-i-le) a taxonomic division between a family and a tribe.

sub·fam·i·ly
n.
A taxonomic category ranking between a family and a genus.
, 23.7 % to the Murinae subfamily, 0.6% to the Caviidae family, and 0.6% to the Didelphidae family (Table 1).

Captures and percentage of trap success by habitats were as follows: natural woodlands, 27 (9.4%) of 288; road borders, 172 (17.0%) of 1,010, peridomestic areas, 44 (3.1%) of 1,420; wetlands, 14 (5.2%) of 65; brook borders, 57 (8.4%) of 680; agroecosystems, 50 (26.3% of 190; shrublands, 268 (22.4%) of 1,198; and in artificial woodlands, 40 (22.3%) of 179 (Table 1). The most common captured small mammals were the following: swamp rats (Scapteromys tumidus), 198 (29.5%); yellow pygmy rice rats (Oligoryzomys flavescens), 194 (28.9%); and house mice (Mus musculus), 157 (23.4%) (Table 1). No sigmodontine rodents were found inside the houses, where only house mice and black rats (Rattus rattus) were found. Yellow pygmy rice rats were found in areas of human disturbance such as peridomestic areas, agroecosystems, road borders, and shrublands. We found that the trapping success in these sites was higher than in natural areas. As shown in Table 1, yellow pygmy rice rats were found in all of the habitats where traps were set.

Screening for Hantavirus Infection of Rodents

Serum specimens collected from rodents were screened for IgG antibodies to LECV by ELISA. As mentioned above, 672 small mammals were trapped in six areas where HPS cases occurred between 1997 and 2001. Anti-LECV antibodies were detected in five rodents (O. flavescens) from four different locations. Absorbances with LECV antigen of positive samples screened at 1:400 dilution were at least fourfold the absorbance absorbance /ab·sor·bance/ (-sor´bans)
1. in analytical chemistry, a measure of the light that a solution does not transmit compared to a pure solution. Symbol .

2.
 of the negative control. Further titration titration (tītrā`shən), gradual addition of an acidic solution to a basic solution or vice versa (see acids and bases); titrations are used to determine the concentration of acids or bases in solution.  showed that three samples had titers >1:1,600, and one had a titer >1:6,400 (Table 2). The proportion of positive rodents in the different localities ranged from 2.1% to 2.9%. Piedritas was the only locality where no antibody-positive rodents were recorded (Table 3).

Total RNA Isolation, RT-PCR, and Sequence Analysis

Total viral RNA was extracted from the lungs of the five seropositive yellow pygmy rice rats and blood clots from four case-patients. RT of viral RNA and PCR amplification of a 456-nt fragment of the G2 glycoprotein--encoding region of the virus M genome segment (bases corresponding to LECV 2,805-3,215) and nucleotide sequences were obtained from four rodent samples and four human blood clots. Amplified DNA was not recovered from the rodent sample CE155, which had the lower antibody titer (Table 3). A 292-nt segment (LECV 2,815-3,106 G2 glycoprotein-encoding region) was used for further comparison and phylogenetic analysis.

Sequence Comparison and Phylogenetic Analysis

For phylogenetic comparisons, a 292-nt fragment of the M gene from lung RNA of four yellow pygmy rice rats (GenBank accession nos. AY204677 to AY204680), as well as clot RNA from four HPS case-patients (GenBank accession nos. AF283896 to AF283899) was used. These nucleotide sequences were compared with the equivalent region of published hantavirus sequences. Phylogenetic analysis indicated that two previously known hantavirus genotypes are circulating in Uruguay: Central Plata and LEC (1) (LAN Emulation Client) A software driver that provides LAN emulation (LANE) in an ATM network. It resides in an ATM end station or in a computer system that provides the LAN to ATM conversion, often known as a LAN access device. See LANE.  (Figure 2).

[FIGURE 2 OMITTED]

By both maximum parsimony and distance-based analysis, the four sequences recovered from Uruguayan yellow pygmy rice rats were closely related to each other and formed a monophyletic monophyletic /mono·phy·let·ic/ (mon?o-fi-let´ik) descended from a common ancestor or stem cell.

mon·o·phy·let·ic
adj.
1. Descended or derived from one original stock or source.
 group with the hantavirus sequences derived from three HPS case-patients from Canelones and Montevideo and two HPS case-patients from the same geographic area, previously characterized as Central Plata. This clade was supported by high bootstrap values (Figure 2A,B). Comparison of these sequences at the nucleotide level showed 96.4% identity. The most closely related genotype was LEC, with 87.9% identity, followed by Bermejo (85.0%), Oran (83.1%), Andes (82.5%), and Hu39694 (82.1%). The less-related genotypes of the Argentinean hantaviruses were Maciel (79.3%) and Pergamino (78.6%). One viral sequence from an HPS case-patient in Soriano clustered into LEC genotype.

Conclusion

Most HPS cases were in rural and suburban areas of Montevideo and Canelones (24 of 38 cases) (Figure 1) in southern Uruguay. Rodent sampling was conducted at the most likely sites of infection for known HPS case-patients.

The trapping success rate was higher in the environments influenced by humans (agroecosystems, road borders, shrublands, artificial woods, peridomestic areas) than in the natural areas (natural woods, wetlands, brook borders): 574 (85.4%) of trapped individual animals were captured in environments influenced by humans, and 98 (14.6%) were captured in natural environments. Swamp rats, yellow pygmy rice rats, and house mice were the most frequently trapped species. Of 44 (3.1%) rodents trapped in peridomestic environments, 19 (43.2%) were yellow pygmy rice rats (Table 1). Five seropositive yellow pygmy rice rats were captured in modified environments: one was captured along a road border, two were captured in peridomestic environments, and two were captured in shrublands, at [less than or equal to] 150 m from homes. Three of five seropositive rodents were therefore trapped in environments frequented by humans (road borders and peridomestic environments). These findings could indicate an increased risk for infection for human inhabitants.

Yellow pygmy rice rats were the only rodents that showed evidence of antibodies to hantavirus, with a prevalence of 2.6%. Researchers have found that hantavirus seroprevalence in rodents may vary widely, according to the season, geographic area, altitude, and rodent species analyzed (29-33). We found that the percentage of seropositive rodents (2.6%) is the same as encountered in the central zone of Argentina (2.6%) (32), although the habitats are not similar to the southern area of Uruguay. In Uruguay, we found that only yellow pygmy rice rats were antibody positive, while in central Argentina seropositive yellow pygmy rice rats, Azara's field mice (Akodon azarae), dark mice (Necromys benefactus), and small water rats (Holochilus brasiliensis) were found (2-4). In the different locations in Uruguay, seroprevalence was similar, ranging from 2.1% to 2.9%. In Piedritas, where no positive rodents were found, only four yellow pygmy rice rats were trapped. All seropositive rodents in Uruguay were adult males, which is consistent with horizontal transmission and in accordance with the findings of several authors (30-32).

The phylogenetic analysis on a 292-nt region of the M segment showed that these rodent sequences clustered together with those from five Uruguayan HPS case-patients from the same geographic area (Canelones and Montevideo); these data suggest that the yellow pygmy rice rat can be considered as the putative reservoir host for Central Plata hantavirus in this region of Uruguay. This study also showed the circulation of LEC genotype in the western location of Soriano, 250 km from Montevideo, separated from the Argentinean central HPS-endemic area by the Uruguay River. This virus shared a 99% identity at the nucleotide level with LEC genotype.

Phylogenetic analysis shows that the genotype Central Plata recovered from rodents and HPS case-patient from Canelones, San Jose, and Melilla is phylogenetically phy·lo·ge·net·ic  
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history: a phylogenetic classification of species.
 distinct from (although related to) the previously described LEC genotype, whose reservoir host in Argentina is also the yellow pygmy rice rat. Hantaviruses have been associated with subspecies subspecies, also called race, a genetically distinct geographical subunit of a species. See also classification.  of closely related rodents: Sin Nombre-like hantaviruses with mice from the genus Peromyscus (34) and Andes virus recovered in southwestern Argentina and Oran virus in northwestern Argentina, both recovered from long tailed pygmy rice rats (O. longicaudatus) (4). Recent studies have shown that these two rodent populations differ with respect to their mitochondrial DNA (10). This fact raises the question of whether rodents morphologically identified as O. flavescens in Uruguay are indeed a different subspecies of O. flavescens in Argentina. Further experiments will be needed to identify both the interspecific in·ter·spe·cif·ic  
adj.
Arising or occurring between species.



interspecific also interspecies  

Arising or occurring between species.

Adj. 1.
 and intraspecific in·tra·spe·cif·ic   also in·tra·spe·cies
adj.
Arising or occurring within a species: intraspecific competition.
 phylogenetic relationships of O. flavescens in these regions.
Table 1. Trapping effficiency/environment/species in the total of
captures (a)

Env     TN     C     E%    Md      Of    Od     St    Aa    No    Hb

NW      288    27    9.4    --      1     7     10     6     2    --
RB    1,010   172   17.0    --     55     4     24    11    14    --
PD    1,420    44    3.1     1     19     1      7    --     2    --
WE      265    14    5.2    --      2    --      8    --     2     2
BB      680    57    8.4     1     11     1     23     4    10    --
AG      190    50   26.3    --      9     6      9     2     6    --
SH    1,198   268   22.4     1     93     2    117    11    13    --
AW      179    40   22.3     1      4     1     --    --     3    --
T     5,230   672   12.8     4    194    22    198    34    52     2
Sp%                        0.6   28.9   3.3   29.5   5.1   7.7   0.3

Env    Cl     Mm    Rr    Ca

NW      1     --    --    --
RB      1     63    --    --
PD     --     11    --     3
WE     --     --    --    --
BB     --      7    --    --
AG      1     17    --    --
SH     --     30    --     1
AW     --     29     2    --
T       3    157     2     4
Sp%   0.4   23.4   0.3   0.6

(a) Env, environments; TN, trapping nights; C, captures; E, efficiency;
NW, natural woods; RB, road borders; PD, peridomestic; WE, wetlands;
BB, brook borders; AG, agroecosystems; SH, shrublands; AW, artificial
woods; T, totals; Sp%, species %; Mid, Monodelphis dimidiate;
Of, Oligoryzomys flavescens; Od, O. delticola; St, Scapteromys tumidus;
Aa, Akodon azarae; No, Necromys obscurus; Hb, Holochilus brasiliensis;
Cl, Calomys laucha; Mm, Mus musculus; Rr, Rattus rattus: Ca, Cavia

Table 2. Hantavirus-seropositive rodents found in the different
geographic areas where captures were performed

Sample      Rodent species   Geographic area           Habitat

U89 (a)     Oligoryzomys     Puntas de Valdez        Road border
            flavescens       (San Jose)
SA63 (a)    O. flavescens    Sauce (Canelones)       Peridomestic
Ce20 (a)    O. flavescens    Melilla (Montevideo)    Peridomestic
Ce22 (a)    O. flavescens    Melilla (Montevideo)    Shrublands
Ce155 (a)   O. flavescens    Cerrillos (Canelones)   Shrublands

Sample      Antibody titer (arbitrary units)

U89 (a)                  1,600
SA63 (a)                 1,600
Ce20 (a)                >6,400
Ce22 (a)                 1,600
Ce155 (a)                  400

(a) Specimens deposited at the Specimen Collection of the Seccion
Zoologia Vertebrados, Facultad de Ciencias, Universidad de la
Republica, Montevideo, Uruguay with the following numbers:
U89=ZVC-M2154, SA63=ZVC-M2155, Ce20=ZVC-M2156, Ce22=ZVC-M2157, and
Ce155=ZVC-M2158.

Table 3. Small mammals trapped in the different sites, number and % of
positives Monodelphis dimidiate

Area    Md   +/%    Of   +/%     Od   +/%    St   +/%   Aa   +/%

PV      --   -/-    38   1/2.6   --   -/-    --   -/-   10   0/0
Ce      --   -/-    47   1/2.1    9   0/0    52   0/0    4   0/0
Me      --   -/-    67   2/2.9    8   0/0    37   0/0   --   -/-
Pi      --   -/-     4   0/0     --   -/-     8   0/0   14   0/0
Sa       3   0/0    42   1/2.4    1   0/0    92   0/0    5   0/0
Ca       1   0/0    --   -/-     --   -/-     9   0/0    1   0/0
Total    4   0/0   194   5/2.6   22   0/0   198   0/0   34   0/0

Area    No   +/%   Hb   +/%   Cl   +/%    Mn   +/%   Rr   +/%

PV      --   -/-   --   -/-    2   0/0    81   0/0   --   -/-
Ce      17   0/0    2   0/0   --   -/-    23   0/0   --   -/-
Me      17   0/0   --   -/-    1   0/0    10   0/0   --   -/-
Pi      --   -/-   --   -/-   --   -/-     2   0/0   --   -/-
Sa      18   0/0   --   -/-   --   -/-    12   0/0   --   -/-
Ca      --   -/-   --   -/-   --   -/-    29   0/0    2   0/0
Total   52   0/0    2   0/0    3   0/0   157   0/0    2   0/0

Area    Ca   +/%   Total

PV      --   -/-     131
Ce      --   -/-     153
Me       3   0/0     297
Pi      --   -/-      28
Sa      --   -/-     173
Ca       1   0/0      43
Total    4   0/0     672

(a) Md, Monodelphis dimidiate. Of, Oligoryzomys flavescens Od, O.
delticola; St, Scapteromys tumidus, Aa. Akodon azarae; No Necromys
obscurus; Hb, Holochillus brasiliensis; Cl; Calomys laucha; Mm; Mus
musculus; Rr,Rattus rattus; Ca, Cavia aperea; PV, Puntas de Valdez;
Ce, Cerrillos; Me, Melilla; Pi, Piedritas; Sa, Sauce; Ca, Canelones,
O. flavescens, S tumidus, and M musculus were the most frequently
captured rodents.


Acknowledgments

We thank Noemi Pini and Juan Cristina for critical reading and useful suggestions; Raul Maneyro, Juan Jose Porta, and Ana Linares for rodent trapping; W. Slenczka for contributing biosafety equipment; Leandro Jones, Monica Galiano, and Guillermo D'Elia for help in Modeltest implementation.

This research was supported in part by grant no. 37/2000 from the Pan American Health Organization/Red Latinoamericana de Ciencias Biologicas (Silvana Levis, Mario Lozano, Juan Arbiza, and Mario Clara). Mario E. Lozano is a research career member of Consejo Nacional de Investigaciones Cientificas y Tecnicas, Argentina. A. Delfraro received a predoctoral pre·doc·tor·al  
adj.
Of, relating to, or engaged in advanced academic study in preparation for a doctorate: predoctoral course work; a predoctoral student. 
 training fellowship from Programa de desarrollo de las Ciencias Basicas. L. Tome was supported by a grant from Laboratorio Santa Elena.

References

(1.) Nichol ST, Spiropoulou C, Morzunov S, Rollin P, Ksiazek G, Feldman H, et al. Genetic identification of a Hantavirus associated with an outbreak of acute respiratory illness. Science 1993;262:914-7.

(2.) Lopez N, Padula P, Rossi C, Lazaro ME, Franze-Fernandez MT. Genetic identification of a new hantavirus causing severe pulmonary syndrome in Argentina. Virology virology, study of viruses and their role in disease. Many viruses, such as animal RNA viruses and viruses that infect bacteria, or bacteriophages, have become useful laboratory tools in genetic studies and in work on the cellular metabolic control of gene expression  1996;220:223-6.

(3.) Lopez N, Padula P, Rossi C, Miguel S, Edelstein A, Ramirez E, et al. Genetic characterization and phylogeny of Andes virus and variants from Argentina and Chile. Virus Res 1997;50:77-84.

(4.) Levis S, Morzunov S, Rowe J, Enria D, Pini N, Calderon G, et al. Genetic diversity and epidemiology of hantaviruses in Argentina. J Infect Dis 1998;177:529-38.

(5.) Vasconcelos M, Lima V, Iversson L, Rosa M, Travassos da Rosa E, Travassos da Rosa A, et al. Hantavirus pulmonary syndrome in the rural area of Juquitiba, Sao Paulo, Metropolitan Area, Brasil. Rev Inst Med Trop (S. Paulo) 1997;39:237-8.

(6.) Johnson AM, Bowen MD, Ksiazek TG, Williams RJ, Bryan RT, Mills J, et al. Laguna Negra virus associated with HPS in western Paraguay and Bolivia. Virology 1997;238:115-27.

(7.) Johnson AM, de Souza LTM LTM
abbr.
long-term memory
, Ferreira IB, Pereira LE, Ksiazek G, Rollin P, et al. Genetic investigation of novel hantaviruses causing fatal HPS in Brazil. J Med Virol 1999;59:527-35.

(8.) Vincent MJ, Quiroz E, Gracia F, Sanchez AJ, Ksiazek TG, Kitsutani PT, et al. Hantavirus pulmonary syndrome in Panama: identification of novel hantaviruses and their likely reservoirs. Virology 2000;277:14-9.

(9.) Padula P, Gonzalez Della Valle M, Garcia Alai M, Cortada P, Villagra M, Gianella A. Andes virus and first case report of Bermejo virus causing fatal pulmonary syndrome. Emerg Infect Dis 2002 8:437-9.

(10.) Plyusnin A, Morzunov SP. Virus evolution and genetic diversity of hantaviruses and their rodent hosts. In: Schmaljohn CS, Nichol ST, editors. Hantaviruses. Berlin: Springer-Verlag; 2001. p. 47-75.

(11.) Weissenbacher M, Cura CURA Community-University Research Alliance
CURA Centre Universitaire de Recherche en Astrologie
CURA Cambridge University Rifle Association
 E, Segura E, Hortal M, Baek L, Kyu Chu Y, et al. Serological serological

pertaining to or emanating from serology.


serological test
one involving examination of blood serum usually for antibody.
 evidence of human hantavirus infection in Argentina, Bolivia and Uruguay. Medicina (Buenos Aires) 1996;56:17-22.

(12.) Padula P, Colavecchia S, Martinez P, Gonzalez Della Valle M, Edelstein A, Miguel S, et al. Genetic diversity, distribution and serological features of hantavirus infection in five countries in South America. J Clin Microbiol 2000;38:3029-35.

(13.) Devicenzi GJ. Mamiferos del Uruguay. Anales del Museo de Historia Natural de Montevideo 1935;4:1-96.

(14.) Langguth A. Contribucion al conocimiento de los Cricetinae del Uruguay (Especies halladas en los regurgitos de buho). Anais do Segundo Congresso Latino-Americano de Zoologia (Sao Paulo, 16-21/7/1962). 1965;2:327-35. San Pablo, Brasil: Sociedad Latinoamericana de Zoologia. Secretaria de Agricultura de San Pablo.

(15.) Barlow JC. Observations on the biology of rodents in Uruguay. Life Sciences Contributions of Royal Ontario Museum The Royal Ontario Museum, commonly known as the ROM (rhyming with Tom), is a major museum for world culture and natural history in the city of Toronto, Ontario, Canada. , 1969. Toronto: The Museum, 1969. p. 75.

(16.) Brum-Zorrilla N. Investigaciones citogeneticas sobre algunas especies de Cricetinae (Rodentia) del Uruguay. Anais do Segundo Congresso Latino-Americano de Zoologia (Sao Paulo, 16-21/7/1962), 1965, 2:315-20. San Pablo, Brasil: Sociedad Latinoamericana de Zoologia. Secretaria de Agricultura de San Pablo.

(17.) Brum-Zorrilla N, Degiovanangelo C, Di Tomaso MV. Estado actual de los estudios cromosomicos en mamiferos del Uruguay. Actas de las Jornadas de Zoologia del Uruguay (Montevideo, 23-28/9/1985); 1985:77-8. Montevideo, Uruguay: Sociedad Zoologica del Uruguay; 1985.

(18.) Clara M, Achaval F. Datos preliminares sobre reservorios de Hantavirus en Uruguay. Bol. Soc. Zool. Uruguay ([2.sup.a] epoca). Act. V. Jorn Zool Uruguay 1999; 11:12.

(19.) Clara M, Achaval F. Preferencia de habitat de algunas especies de Muridae (Rodentia) del Uruguay. Act. VI. Jorn Zool Uruguay 2001; 33.

(20.) Clara M, Achaval F, Arbiza J, Delfraro A, Tome L, Lozano M, Enria D. Caracterizacion de Hantavirus y Arenavirus arenavirus /are·na·vi·rus/ (ah-re´nah-vi?rus) any virus of the family Arenaviridae.
Arenavirus /Are·na·vi·rus/ (ah-re´nah-vi?rus 
 en sus reservorios naturales en Uruguay. Act. VI. Join Zool Uruguay 2001;34.

(21.) Aguila J, Roucco G, Curto S, Willat G, Russi J, Gaye G, Salvatella R. Guia para la vigilancia epidemiologica de los casos de Sindrome Pulmonar por Hantavirus. Montevideo, Uruguay: Ministerio de Salud Publica; 1998.

(22.) Mills J, Childs J, Thomas G, Ksiazek G, Peters CJ. Methods for trapping and sampling small mammals for virologic testing, editors. Atlanta: Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center. ; 1995.

(23.) Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The ClustalX windows interface: flexible strategies for multiple sequence alignment A multiple sequence alignment (MSA) is a sequence alignment of three or more biological sequences, generally protein, DNA, or RNA. In general, the input set of query sequences are assumed to have an evolutionary relationship by which they share a lineage and are descended from a  aided by quality analysis tools. Nucleic Acids Res 1997;24:4876-82.

(24.) Swofford, DL. PAUP*: Phylogenetic analysis using parsimony par·si·mo·ny  
n.
1. Unusual or excessive frugality; extreme economy or stinginess.

2. Adoption of the simplest assumption in the formulation of a theory or in the interpretation of data, especially in accordance with the rule of
 (and other methods), v. 4.0b4a. 2000. Sunderland (MA): Sinauer Associates, Inc. Publishers; 2000.

(25.) Kumar S, Tamura K, Jakobsen IB, Nei M. MEGA2: Molecular evolutionary genetics analysis software. Tempe (AZ): Arizona State University Arizona State University, at Tempe; coeducational; opened 1886 as a normal school, became 1925 Tempe State Teachers College, renamed 1945 Arizona State College at Tempe. Its present name was adopted in 1958. ; 2001.

(26.) Posada po·sa·da  
n.
A Christmas festival originating in Latin America that dramatizes the search of Joseph and Mary for lodging.



[American Spanish, from Spanish, lodging, from posar,
 D, Crandall KA. MODELTEST: testing the model of DNA substitution. Bioinformatics Application Note 1998;14:817-8.

(27.) Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. 1985. Evolution 1985;39:783-91.

(28.) Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 1993;10:512-26.

(29.) Childs JE, Ksiazek TG, Spiropoulou CF, Krebs JW, Morzunov S, Maupin GO, et al. Serologic se·rol·o·gy  
n. pl. se·rol·o·gies
1. The science that deals with the properties and reactions of serums, especially blood serum.

2.
 and genetic identification of Peromyscus maniculatus as the primary rodent reservoir for a new hantavirus in the southwestern United States. J Infect Dis 1994; 169:1271-80.

(30.) Kuenzi AJ, Morrison ML, Swann DE, Hardy PC, Downard GT. A longitudinal study of Sin Nombre virus prevalence in rodents, southeastern Arizona. Emerg Infect Dis 1999;5:113-7.

(31.) Mills JN, Ksiazek TG, Peters C J, Childs JE. Long-term studies of Hantavirus reservoir populations in the southwestern United States: a synthesis. Emerg Infect Dis 1999;5:135-41.

(32.) Calderon G, Pini N, Bolpe J, Levis S, Mills, J, Segura E, et al. Hantavirus reservoir hosts associated with peridomestic habitats in Argentina. Emerg Infect Dis 1999;5:792-7.

(33.) Kuenzi A J, Douglass RJ, White Jr D, Bond CW, Mills JN. Antibody to Sin Nombre virus in rodents associated with peridomestic habitats in west central Montana. Am J Trop Med Hyg 2001;64:137-46.

(34.) Morzunov SP, Rowe JE, Ksiazek TG, Peters CJ, St Jeor SC, Nichol, ST. Genetic analysis of the diversity and origin of hantaviruses in Peromvscus leucopus mice in North America. J Virol 1998;72:57-64.

Address for correspondence: Juan Arbiza, Seccion Virologia, Facultad de Ciencias. Igua 4225. CP 11400; fax: 5982-5258617; email:jarbiza@fcien.edu.uy

Adriana Delfraro, * Mario Clara, * Lorena Tome, * Federico Achaval, * Silvana Levis, ([dagger]) Gladys Calderon, ([dagger]) Delia Enria, ([dagger]) Mario Lozano, ([double dagger]) Jose Russi, ([section]) and Juan Arbiza *

* Facultad de Ciencias de la Universidad de la Republica, Montevideo, Uruguay; ([dagger]) Instituto Nacional de Enfermedades Virales Humanas "Dr. Julio I. Maiztegui," Pergamino, Buenos Aires Pergamino is a city in the province of Buenos Aires, Argentina. It has a population of about 99,000 inhabitants as per the 2001 census INDEC], and it is the head town of the partido of the same name. Its UN/LOCODE is ARPGO. , Argentina; ([double dagger]) Universidad Nacional de Quilmes, Bernal, Argentina; and ([section]) Ministerio de Salud Publica, Montevideo, Uruguay

Adriana Delfraro is a doctoral student in microbiology and assistant professor in the Seccion Virologia of the Facultad de Ciencias, Universidad de la Republica. She also worked in the Hantavirus Program of Uruguay in the Departamento de Laboratorios of the Ministerio de Salud Publica, Montevideo, Uruguay, from its beginning in 1997 until 2002.
COPYRIGHT 2003 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2003, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Arbiza, Juan
Publication:Emerging Infectious Diseases
Geographic Code:3URUG
Date:Jul 1, 2003
Words:5174
Previous Article:Mutations in putative mutator genes of Mycobacterium tuberculosis strains of the W-Beijing family. (Research).
Next Article:Serologic evidence of West Nile virus infection in horses, Coahuila State, Mexico. (Dispatches).
Topics:



Related Articles
Hantavirus reservoir hosts associated with peridomestic habitats in Argentina.(Statistical Data Included)
Statistical Sensitivity for Detection of Spatial and Temporal Patterns in Rodent Population Densities.(Statistical Data Included)
Andes virus and first case report of Bermejo virus causing fatal pulmonary syndrome. (Dispatches).
First Human Isolate of hantavirus (Andes virus) in the Americas. (Research).
Hantavirus prevalence in the IX Region of Chile. (Research).
Hantavirus infection in humans and rodents, northwestern Argentina.(Research)
Human hantavirus infections, Sweden.(Research)
Hantavirus pulmonary syndrome, Southern Chile.(Research)
Hantavirus infection in Anajatuba, Maranhao, Brazil.(Dispatches)
Outbreak of hantavirus pulmonary syndrome, Los Santos, Panama, 1999-2000.(Research)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles