Vibrio cholerae O139 in Calcutta, 1992-1998: incidence, antibiograms, and genotypes.We report results of surveillance for cholera caused by Vibrio cholerae Vibrio chol·er·ae n. A bacterium that causes Asiatic cholera in humans; Koch's bacillus. Vibrio cholerae Infectious disease The Vibrio O139 from September 1992, when it was first identified, to December 1998. V. cholerae O139 dominated as the causative agent of cholera in Calcutta during 1992-93 and 1996-97, while the O1 strains dominated during the rest of the period. Dramatic shifts in patterns of resistance to cotrimoxazole, neomycin neomycin (nē'ōmī`sĭn), broad spectrum antibiotic effective against both gram positive and gram negative bacteria (see Gram's stain). , and streptomycin streptomycin (strĕp'tōmī`sĭn), antibiotic produced by soil bacteria of the genus Streptomyces and active against both gram-positive and gram-negative bacteria (see Gram's stain), including species resistant to other were observed. Molecular epidemiologic studies showed clonal diversity among the O139 strains and continuous emergence of new epidemic clones, reflected by changes in the structure, organization, and location of the CTX CTX Context (Management; Tandem) CTX Centex Corporation (stock symbol) CTX Centrex CTX Cyclophosphamide CTX Corporate Trade Exchange CTX Cytoxan CTX Cholera Toxin CTX Clinical Trial Exemption prophages in the V. cholerae O139 chromosome. Vibrio cholerae, the gram-negative organism that causes cholera, is well defined on the basis of biochemical tests and DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. homology studies (1), but the serogroups of the species differ in their pathogenic potential. Of the 193 recognized "O" serogroups of V. cholerae (2), only O1 and O139 cause epidemic and pandemic pandemic /pan·dem·ic/ (pan-dem´ik) 1. a widespread epidemic of a disease. 2. widely epidemic. pan·dem·ic adj. Epidemic over a wide geographic area. n. cholera. V. cholerae 0139 was first identified in September 1992 in southern India (3) and rapidly spread to all choleraendemic areas in India (4) and neighboring countries (5). In February 1994, a new clone of V. cholerae O1 El Tor biotype biotype /bio·type/ (bi´o-tip) 1. a group of individuals having the same genotype. 2. any of a number of strains of a species of microorganisms having differentiable physiologic characteristics. (6) replaced the O139 serogroup as the dominant serogroup causing cholera in Calcutta (7). After a 33-month quiescent period, a new clone of V. cholerae 0139 (8,9) appeared in August 1996 in Calcutta (10) and was the dominant serogroup until September 1997. This new clone has also spread to other parts of India (11). The National Institute of Cholera and Enteric enteric /en·ter·ic/ (en-ter´ik) within or pertaining to the small intestine. en·ter·ic adj. 1. Of, relating to, or within the intestine. 2. Diseases, Calcutta, conducts continuous surveillance for cholera in Calcutta in particular, and in India in general. During September-October 1998, we observed an increase in the incidence of O139 cholera, prompting study of these O139 strains. We report the findings of surveillance performed from September 1992 to December 1998 in India, which enabled us to track and catalog changes in the O139 strains since its identification. The Study Hospital Surveillance and Bacteriology bacteriology Study of bacteria. Modern understanding of bacterial forms dates from Ferdinand Cohn's classifications. Other researchers, such as Louis Pasteur, established the connection between bacteria and fermentation and disease. Stool specimens were obtained from patients admitted to the Infectious Diseases Hospital, Calcutta, the only hospital that admits cholera patients from the city and its suburbs. Since 1995, on two randomly selected days per week, every fifth patient has been enrolled from all patients with diarrhea or dysentery dysentery (dĭs`əntĕr'ē), inflammation of the intestine characterized by the frequent passage of feces, usually with blood and mucus. , with or without other complaints, visiting the emergency department of the Infectious Diseases Hospital, Calcutta. Before 1995, only patients with diarrhea admitted to the Infectious Diseases Hospital, Calcutta, from Monday to Friday between 9 a.m. and 1 p.m. were enrolled. Methods of collection, transport, and bacteriologic bac·te·ri·ol·o·gy n. The study of bacteria, especially in relation to medicine and agriculture. bac·te examination of stool samples and identification and serotyping of V. cholerae have been described (7). The National Institute of Cholera and Enteric Diseases, Calcutta, is India's national reference laboratory for cholera, and strains from throughout the country are sent here for confirmation and phage phage: see bacteriophage. phage - A program that modifies other programs or databases in unauthorised ways; especially one that propagates a virus or Trojan horse. See also worm, mockingbird. The analogy, of course, is with phage viruses in biology. typing. Strains received are characterized by an array of tests (4). In this study, representative strains of V. cholerae 0139 isolated from hospitalized patients in Calcutta from 1992 to 1998 and 15 V. cholerae O139 strains from other parts of India (eastern, central, northern, and southern India) isolated in 1998 were randomly selected for molecular characterization. Antimicrobial Susceptibility The V. cholerae O139 strains were examined for resistance to ampicillin ampicillin (ăm'pĭsĭl`ĭn), a penicillin-type antibiotic that is effective against both gram-negative microorganisms and gram-positive microorganisms such as Escherichia coli. (10 [micro]g), chloramphenicol chloramphenicol (klōr'ămfĕn`əkŏl'), antibiotic effective against a wide range of gram-negative and gram-positive bacteria (see Gram's stain). It was originally isolated from a species of Streptomyces bacteria. (30 [micro]g), cotrimoxazole (25 [micro]g), ciprofloxacin ciprofloxacin /cip·ro·flox·a·cin/ (sip?ro-flok´sah-sin) a synthetic antibacterial effective against many gram-positive and gram-negative bacteria; used as the hydrochloride salt. cip·ro·flox·a·cin n. (5 [micro]g), furazolidone (100 [micro]g), gentamycin (10 [micro]g), neomycin (30 [micro]g), nalidixic acid nalidixic acid /nal·i·dix·ic ac·id/ (nal-i-dik´sik) a synthetic antibacterial agent used in the treatment of genitourinary infections caused by gram-negative organisms. na·li·dix·ic acid n. (30 [micro]g), norfloxacin (10 [micro]g), streptomycin (10 [micro]g), and tetracycline tetracycline (tĕ'trəsī`klēn), any of a group of antibiotics produced by bacteria of the genus Streptomyces. They are effective against a wide range of Gram positive and Gram negative bacteria, interfering with protein (30 [micro]g) by using antibiotic-impregnated commercial disks (Hi Media, Mumbai, India). Characterization of the strains as susceptible or resistant was based on the size of inhibition zones around each disk, according to the manufacturer's instructions, which followed World Health Organization recommendations (12). Strains showing an intermediate zone of inhibition were interpreted as resistant on the basis of previous minimum inhibitory concentration minimum inhibitory concentration Lab medicine The minimum antibiotic concentration needed to inhibit bacterial growth from a clinical isolate–eg, a bloodborne infection, which is a form of antimicrobial susceptibility testing. Cf Minimum bactericidal concentration. studies conducted with V. cholerae (13). Polymerase Chain Reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is (PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) ) Assay PCR assays (both multiple and single) were used to screen the O139 strains for five important virulence genes. The first PCR assay used three pairs of oligonucleotide primers for virulence genes ctxA (301 bp), tcpA (classical; 617 bp), and tcpA (El Tor; 471 bp), and the second and third PCR assays used primer pairs for the virulence genes zot and ace, respectively (Table 1) (15). The composition of the reaction mix and cycling conditions for amplification have been described (16). Table 1. Oligonucleotide primer sequences used in polymerase chain reaction assays of Vibrio cholerae O139
Amplicon
Gene Primer sequence (5'-3') size Ref.
ctxA CTCAGACGGGATTTGTTAGGCACG 301 14
TCTATCTCTGTAGCCCCTATTACG
tcpA GAAGAAGTTTGTAAAAGAAGAACAC 471 14
(El Tor) GAAGGACCTTCTTTCACGTTG
tcpA GATTGTGCGTCTTGCATTTAGG 2200 16
(classical) GTGAATAAATCAGGTGTAATGTCG
ace GCTTATGATGGACACCCTTTA 284 15,(a)
TTTGCCCTGCGAGCGTTAAAC
zot CACTGTTGGTGAGCGTTATCG 243 (a)
CAAGCGCTGTGGGTAGAAGTGAAA
(a) This study. Amplification was done by using an automated thermal cycler (Biometra Gottingen, Germany). V. cholerae strain VC20 (El Tor, Ogawa), 569B (classical, Inaba) and Escherichia coli Escherichia coli (ĕsh'ərĭk`ēə kō`lī), common bacterium that normally inhabits the intestinal tracts of humans and animals, but can cause infection in other parts of the body, especially the urinary tract. DH5-[Alpha] strains were used as positive and negative controls. Amplified products were electrophoresed in a 2% agarose agarose more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments. gel (SRL 1. SRL - Bharat Jayaraman. ["Towards a Broader Basis for Logic Programming", B. Jayaraman, TR CS Dept, SUNY Buffalo, 1990]. 2. SRL - Schema Representation language. 3. SRL - Structured Robot Language. C. Blume & W. Jacob, U Karlsruhe. , Bombay, India) in 1x TAE buffer along with standard molecular weight (MWM MWM, n See mobilization with movement. ), markers, stained with ethidium bromide (Sigma), and recorded with a video documentation system (Pharmacia Biotech, San Francisco, CA). Pulsed-Field Gel Electrophoresis (PFGE PFGE Pulsed-Field Gel Electrophoresis ) Genomic DNA of various strains of V. cholerae was prepared in agarose plugs (17). For complete digestion of the DNA, 50U of NotI enzyme was used. PFGE of inserts was done by the contour-clamped homogeneous electric field method on a CHEF-mapper (Bio-Rad) with 0.5x TBE Buffer [44.5 mM Tris, 44.5 mM boric acid boric acid, any one of the three chemical compounds, orthoboric (or boracic) acid, metaboric acid, and tetraboric (or pyroboric) acid; the term often refers simply to orthoboric acid. The acids may be thought of as hydrates of boric oxide, B2O3. , 1 mM EDTA EDTA: see chelating agents. (pH 8.0)] for 40.24 hours. A DNA size standard [Lambda]-ladder; Bio-Rad) was used as molecular weight standard. A model 1,000 minichiller (Bio-Rad) was used to maintain the temperature of buffer at 14 [degrees] C. Run conditions were generated by the autoalgorithm mode of a CHEF Mapper PFGE system with a size range of 20300 kb. Gels were stained in distilled water containing 1.0 [micro]g ethidium bromide per ml for 30 minutes, rinsed several times, and photographed. After electrophoresis, ethidium bromide staining and photography, transfer of DNA from gel to Hybond [N.sup.+] membrane (Amersham International PLC, Buckinghamshire, England) and Southern blot hybridization Southern blot hybridization Southern blotting Molecular biology A method delineated by EM Southern for detecting and manipulating specific DNA sequences previously separated by gel electrophoresis. with an O139-specific probe were done as described (17). The DNA adjacent to Tn5lac insertion in MO10 (a O139 strain from the Madras outbreak) rendered the strain O139 negative in agglutinability with O139-specific antiserum antiserum /an·ti·se·rum/ (an´ti-se?rum) a serum containing antibody(ies), obtained from an animal immunized either by injection of antigen or by infection with microorganisms containing antigen. (18). Restriction Fragment Length Polymorphism restriction fragment length polymorphism n. Abbr. RFLP Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing (RFLP RFLP abbr. restriction fragment length polymorphism RFLP restriction fragment length polymorphism. RFLP ) of ctxA Gene and O139 Specific Gene A ctxA probe consisting of a 540-bp XbaI-ClaI fragment of ctxA cloned in pKTN901 with EcoRI linkers was used (19). A modification of the method of Murray and Thompson (20) was used for DNA extraction for ctxA RFLP (16). The transfer of DNA from gel to Hybond [N.sup.+] membrane (Amersham) and hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun) 1. crossbreeding; the act or process of producing hybrids. 2. molecular hybridization 3. with probes was done (16) with the ECL (Emitter-Coupled Logic) A digital circuit composed of bipolar transistors in which the emitter ends are wired together. ECL gates switch faster than TTL gates, but consume more power. See TTL, I2L and bipolar. 1. Nucleic Acid nucleic acid, any of a group of organic substances found in the chromosomes of living cells and viruses that play a central role in the storage and replication of hereditary information and in the expression of this information through protein synthesis. Detection System (Amersham). The membranes were then washed and exposed to Kodak Biomax film (Eastman Kodak Co., Rochester, NY) and developed according to the manufacturer's instruction. Results The O139 serogroup dominated as the major cholera-causing serogroup in 1993 and from September 1996 to September 1997, while the O1 serogroup dominated during the remaining part of the study period (Figures 1, 2). The rate of isolation of O139 serogroup was lower in 1998 than in any other year since 1992, the year it was identified (Table 2). The seasonality in incidence of the O139 serogroup showed an interesting trend: apart from 1993 and 1994, more O139 cholera cases were recorded during the latter half of the year, coinciding with the second peak of cholera cases (Figures 1, 2). However, the peak incidence of cholera caused by the O1 serogroup was generally observed during June-July, except for 1993 and 1997, when the O1 peak occurred during October and September, respectively (Figures 1, 2). The O139 strains were the dominant cholera-causing serogroup during these years (Table 2; Figures 1, 2). [Figures 1-2 ILLUSTRATION OMITTED] [TABULAR DATA 2 NOT REPRODUCIBLE IN ASCII ASCII or American Standard Code for Information Interchange, a set of codes used to represent letters, numbers, a few symbols, and control characters. Originally designed for teletype operations, it has found wide application in computers. ] The antibiotic resistance antibiotic resistance, n the ability of certain strains of microorganisms to develop resistance to antibiotics. antibiotic resistance patterns of randomly selected O139 strains isolated from Calcutta during 1992-1998 (Figure 3) showed dramatic changes in resistance to cotrimoxazole, with all the 1992, 1993, and 1994 O139 strains being resistant, while most of the strains isolated during 1997 and 1998 were sensitive. Likewise, resistance to neomycin and streptomycin also increased until 1996, then declined. O139 strains isolated throughout the study were resistant to furazolidone and most were resistant to ampicillin. The dominant drug-resistance patterns among O139 strains isolated in Calcutta from 1993 to 1998 were A C Co Fz S (30%), A C Co Fz S (48.1%), A Co Fz S (49.1%), A Fz N S (96%), A Fz N S (32%), and A Fz (98.3%). [Figure 3 ILLUSTRATION OMITTED] PCR studies with 106 representative O139 strains showed that all but one strain (CO853) were positive for the 471-bp tcpA (El Tor) amplicon, indicating that almost all have the organelle organelle /or·ga·nelle/ (or?gah-nel´) a specialized structure of a cell, such as a mitochondrion, Golgi complex, lysosome, endoplasmic reticulum, ribosome, centriole, chloroplast, cilium, or flagellum. required for intestinal colonization. The presence of 301-bp ctxA, 843-bp zot, and 282-bp ace genes in all strains except CO853 indicates that all the tcpA-positive strains have indicates that all the tcpA-positive strains have an intact CTX prophage prophage /pro·phage/ (pro´faj) the latent stage of a phage in a lysogenic bacterium, in which the viral genome becomes inserted into a specific portion of the host chromosome and is duplicated in each cell generation. . The PFGE profile of three randomly selected O139 strains, sharing the unique [CTX.sup.ImmCalcutta] prophage and isolated from Calcutta during 1996 and 1997, has a banding pattern similar to that of the reference strain MO45 (ATCC ATCC American Type Culture Collection, see there 51394) isolated during 1992 in Madras (Figure 4A). The band patterns exhibited by all the O139 strains differed from that of the classical and El Tor biotype representative strains of V. cholerae O1, 569B, 2164-88, and CO840. However, the pattern of the reference O139 strain MO45 was identical to that of the O1 strain MO1, which was described as the progenitor pro·gen·i·tor n. 1. A direct ancestor. 2. An originator of a line of descent. progenitor ancestor, including parent. progenitor cell stem cells. strain of the O139 serogroup (21). The Southern blot Southern blot a technique for detecting specific DNA sequences following agar gel electrophoresis of a set of DNA restriction enzyme digestion fragments. The fragments after electrophoresis are transferred to a nitrocellulose or nylon membrane by applying the membrane to the gel; of the PFGE DNA fragments with O139-specific probe showed that the probe hybridized at the same position in all the O139 strains. However, the control O1 strains and the progenitor strain MO1 did not hybridize hy·brid·ize intr. & tr.v. hy·brid·ized, hy·brid·iz·ing, hy·brid·iz·es 1. To produce or cause to produce hybrids; crossbreed. 2. with the probe (Figure 4B). [Figure 4 ILLUSTRATION OMITTED] RFLP was then conducted to determine any differences in number, location, and arrangement of the CTX prophage in the genome of O139 strains. As the CTX prophage of the 1992-93 and 1996 O139 strains is well characterized (8,11,16,22), we took only one representative strain from 1992 (SG24) and 1996 (AM258) (8,11,22). Five O139 strains (PG265, PG269, PG316, PG337, and PG351) isolated during September 1998 (when an upsurge in O139 strains was observed) were included in the study. RFLP of the CTX prophage with HindIII showed one band with SG24, PG265, PG269, PG316, and PG351; AM258 and PG337 had three bands of 14, 9.2, and 7.0 kb (Table 3). As HindIII has no site in the CTX prophage (23), four of the five 1998 O139 strains (PG265, PG269, PG316, and PG351), like the 1992 O139 strain (SG24), have the CTX prophage at only one site in the chromosome. RFLP with PstI and BglII showed only one band each of 5.6 kb and 8 kb, respectively, in four of the 1998 O139 strains (PG265, PG269, PG316, and PG351), while the 1992 O139 strain (SG24) exhibited two bands of sizes 7.0 and 5.6 and 8.0 and 7.0 kb, respectively (Table 3). As PstI and BglII have only a single site in the CTX prophage but not within the ctxA gene, these results indicate that most of the 1998 O139 strains have only one CTX prophage, unlike the 1992 O139 strain, which has two CTX prophages arranged in tandem (Figure 5). Further, as both the 8- and 5.6-kb bands are shared by the 1992 and 1998 V. cholerae O139 strains, the downstream regions cholerae O139 strains, the, downstream regions of the CTX prophage in the 1992 and 1998 V. cholerae O139 strains are similar, suggesting that they may share the identical location in the V. cholerae genome. Southern blot of HindIII-digested genomic DNA, using a ctxA probe of the 1996 O139 strain (AM258), showed three bands, and the Southern blots of the PstI- and BglII-digested genomic DNA, also using the ctxA probe, showed only two bands. As discussed (8,16), the strain has the same organization of the CTX prophage as the 199697 O139 strains isolated from Calcutta. It has three tandemly duplicated CTX prophages, with the second and third CTX prophages being new and differing from the first in having an altered restriction endonuclease restriction endonuclease one of over 200 enzymes isolated from bacteria that cleave any DNA molecule at specific sites which are usually palindromes of 4 to 10 or so nucleotides to yield a collection of restriction DNA fragments that can be separated, usually by electrophoresis in site (8,9) (Figure 5). The Southern blots of the 1998 O139 strain PG337 exactly match those of the 1996-97 representative strain AM258 (Table 3), indicating that its structure resembles that of the 1996-97 O139 strains. [Figure 5 ILLUSTRATION OMITTED] Table 3. Fragment sizes of restriction enzyme-digested genomic DNA of Vibrio cholerae O139 strains, isolated by ctxA probe, Calcutta, 1992-1998
Fragment (kb) hybridized
Yr. iso- Anti- with the probe
Strain lated biogram HindIII BglII PstI
SG24 1992 CoFzS 23 8.0, 9.3,
7.0 5.6
AM258 1996 ACCfFzNS 14.0, 23.00 7.0,
9.2, 5.6
7.0
PG265 1998 AFz 18.0 8.0 5.6
PG269 1998 AFz 18.0 8.0 5.6
PG316 1998 AFz 18.0 8.0 5.6
PG337 1998 AFzNS 14.0, 23 7.0,
9.2, 5.6
7.0
PG351 1998 AFz 16.0 8.0 5.6
Southern blot analysis South·ern blot analysis n. An electrophoretic procedure used to separate and identify DNA sequences. of HindIII-digested genomic DNA of the 15 O139 strains isolated from different parts of India in 1998 showed four variations when probed with ctxA. Of the 15 strains examined, eight (designated group I strains) showed three bands of size 14, 9.2, and 7.0 kb (the pattern displayed by the 1996-97 O139 strains); two strains had three fragments of sizes 14, 12, and 7.0 kb (designated group II strains); and four had two fragments of sizes 23 and 7.0 kb (designated group III strains); only one had two bands of 14 and 7.0 kb (designated group IV strains) (Table 4). All group I and group II strains showed a single band of about 23 kb in the blot when digested with BglII and probed with ctxA (Table 4), indicating that in these strains the BglII site resides outside the CTX prophage, as described (8). Thus, group I and group II strains have the same unique organization of the CTX prophage as that of the 1996-97 O139 strains (8). The group III and group IV strains also showed a single band when digested with BglII and probed with ctxA, indicating that in these strains the BglII site may also be outside the CTX prophage (Table 4). Representative strains of the four types showed a common band of approximately 7 kb when digested with BglI, AvaI, and PstI and probed with the ctxA probe (Table 4). Since all these enzymes have a single restriction site restriction site n. A site in a DNA segment in which the bordering bases are vulnerable to restriction enzymes. Also called cleavage site. in the CTX prophage but not within the ctxA gene (23) and the size of an intact CTX prophage is approximately 7 kb, the 7-kb band in all these enzymes indicates a tandem duplication in all strains. All the group I strains have three CTX prophages in tandem (8,16), with the second and third prophages having a HindIII site instead of the BglII site in the RS region of the CTX prophage, like the 1996-97 O139 strains (Figure 5). The group II strains differ from the group I strains by the position of the second band in the blots (Table 4). Thus, the group II strains have exactly the same arrangement of the CTX prophage in their genome as the group I strains; the difference in the size of the second band could be due to the integration of the prophage at a different site in the genome (Figure 5). Table 4. Restriction enzyme-digested fragments of genomic DNA of Vibrio cholerae O139 strai ctxA probe, India, 1998
Place (Region)
Strain no. of isolation Anti-biogram
NPO600 Nagpur (Central) ACFzNaS
NPO701 Nagpur (Central) ACNaS
NPO702 Nagpur (Central) AFzNaS
NPO706 Nagpur (Central) ACFzNaS
NPO708 Nagpur (Central) AFzNaS
NPO709 Nagpur (Central) AFzNaS
MUO7 Murshidabad (Eastern) CFzS
LHO359 Ludhiana (Northern) AFzNaS
LHO469 Ludhiana (Northern) AFzNS
LHO477 Ludhiana (Northern) FzNaS
ALO53 Alleppey (Southern) FzS
ALO58 Alleppey (Southern) ACFz
ALO59 Alleppey (Southern) AFzNaS
ALO62 Alleppey (Southern) FzS
ALO64 Alleppey (Southern) ACFzS
Fragment size (kb) using
Strain no. HindIII BglII BglI
NPO600 14, 12,7 23 23, 7
NPO701 14, 9.2, 7 23 12, 7
NPO702 14, 12, 7 23 23, 7
NPO706 14, 9.2, 7 23 12, 7
NPO708 14, 9.2, 7 23 12, 7
NPO709 14, 9.2, 7 23 12, 7
MUO7 14, 9.2, 7 23 12, 7
LHO359 14, 9.2, 7 23 12, 7
LHO469 14, 9.2, 7 23 12, 7
LHO477 14, 9.2, 7 23 12, 7
ALO53 23, 7 23 23, 7
ALO58 23, 7 23 23, 7
ALO59 23, 7 23 23, 7
ALO62 23, 7 23 23, 7
ALO64 14, 7 23 23, 7
The group III and group IV strains showed two bands in HindIII, BglI, and AvaI blots when probed with ctxA. There is no HindIII restriction site in the CTX prophage of El Tor and classical strains (23), while AvaI, BglII and BglI have only one site within the CTX prophage (23). In the [CTX.sup.Immcalcutta] prophage, present in the 1996-97 O139 strains, the positions of the HindIII and the BglII enzymes have been interchanged (8,9). The presence of two bands in the blots with a common 7.0 kb in HindIII, AvaI, and BglI blots with ctxA and one band in the BglII blot (Table 4) with same probe indicates that group III and group IV have two copies of the CTX prophage in tandem, with both the CTX prophages in these strains being the new type of the O139 CTX prophage, [CTX.sup.ImmCalcutta] prophage (Figure 5). Thus, these O139 strains (all isolated in southern India) may derive from the 1996-97 O139 strains but lack the El Tor CTX prophage of the three CTX prophages that they have in tandem. Alternatively, these group III and group IV strains may be a new type of O139 that lacks the E1 Tor CTX prophage. The only difference between the group III and group IV strains is in the HindIII blot, which may be due to polymorphism polymorphism, of minerals, property of crystallizing in two or more distinct forms. Calcium carbonate is dimorphous (two forms), crystallizing as calcite or aragonite. Titanium dioxide is trimorphous; its three forms are brookite, anatase (or octahedrite), and rutile. in the HindIII site (Table 4; Figure 5). Discussion The emergence of V. cholerae O139 is a puzzling event in the history of cholera. The sudden appearance of the O139 serogroup in late 1992, its rapid spread through Southeast Asia in 1993 followed by a quiescent period during 1994-95 and its subsequent emergence in 1996 and 1997 are inadequately understood, but characterize the unpredictable nature of the epidemiology of cholera. However, the reemergence of O139 in 1996 indicates that its appearance was not a one-time event and the serogroup has the potential to persist and spread to other continents. Comparison of the O139 strains isolated during the 7-year study period revealed interesting patterns of antibiotic resistance to various common antibiotics. While the strains remained largely susceptible to ciprofloxacin, tetracycline, and gentamycin, resistance to ampicillin and susceptibility to cotrimoxazole (sulphamethoxazole, trimethoprim trimethoprim /tri·meth·o·prim/ (-meth´o-prim) an antibacterial closely related to pyrimethamine; almost always used in combination with a sulfonamide, primarily for the treatment of urinary tract infections. ), chloramphenicol, and streptomycin increased during the period of the study. Resistance to cotrimoxazole (sulphamethoxazole and trimethoprim) and streptomycin is encoded by a 62-kb self-transmissible chromosomally integrated transposon transposon /trans·po·son/ (trans-po´zon) a small mobile genetic (DNA) element that moves around the genome or to other genomes within the same cell, usually by copying itself to a second site but sometimes by splicing itself out of its termed the SXT SXT Soft X-Ray Telescope SXT Sensient Technologies Corp (stock symbol) SXT Sulfamethoxazole-Trimethoprim SXT Solar X-Ray Telescope (Launched in 1991 as a part of the Japanese Yokoh satellite) element, which is not apparently linked to genes encoding O139 antigen (24). The SXT element was present in 1992-93 O139 strains and is probably silent or ;absent in 1998 O139 strains, which were sensitive to cotrimoxazole and streptomycin. The presence of this novel region in 1996 O139 strains is difficult to predict because these strains are susceptible to cotrimoxazole (sulphamethoxazole and trimethoprim) but resistant to streptomycin. However, this pattern of rapid shift is consistent with recent reports indicating an enhanced mobility in genetic elements, which confers resistance to antibiotics (25) and has also been observed in V. cholerae O1 strains (7). A multiple-antibiotic resistance plasmid resistance plasmid n. Any of the conjugative or nonconjugative plasmids carrying genes responsible for antibiotic or antibacterial drug resistance among bacteria. Also called resistance factor, R factor, R plasmid. belonging to incompatibility group incompatibility group Molecular biology A number of different types of plasmid, often related to each other, that are unable to stably coexist in the same cell C has been associated with drug-resistance plasmid of V. cholerae O139 (17). Since the multidrug-resistance plasmid is self-transmissible by conjugation conjugation, in genetics conjugation, in genetics: see recombination. conjugation, in grammar conjugation: see inflection. , the incidence of plasmid-carrying strains and hence drug resistance may change, depending on the presence of these plasmids in O139 strains. Molecular studies show continuous change in the structure and organization of CTX prophage during the study period, along with evolution of a new type of CTX prophage. The 1992-93 strains have two CTX prophages connected by an RS1 element, while the 1996 O139 strains have three CTX prophages arranged in tandem (8,22). Most of the 1998 O139 strains from Calcutta have only one CTX prophage, while those isolated from other parts of India have either the arrangement of the 1996-97 O139 strains (group I and II strains)or have two CTX prophages arranged in tandem (group III and IV strains). However, as reported elsewhere (9), the 1996 O139 strains have two types of CTX prophages, with the first of the three an El Tor type CTX prophage and the second and third CTX prophages being a new type of CTX prophage that differs primarily in the rstR gene, the gene that codes for the repressor repressor: see nucleic acid. protein of CTX. In 1998, we observed two new clones of O139 at two epicenters, Calcutta and Alleppey. From the restriction profile data of the 1998 O139 strains, it can be predicted that most of the O139 strains from Calcutta have only the El Tor type CTX prophage and not the unique O139 CTX prophage of the 1996 O139 strains, while the reverse is the case with the south Indian (Alleppey) strains. Therefore, two different clones of O139 are circulating at two locations with different types of CTX prophages, indicating that reassortment in the genome is taking place in the O139 strains. Our study indicates a continuous emergence of new clones of toxigenic toxigenic /tox·i·gen·ic/ (tok?si-jen´ik) 1. producing or elaborating toxins. 2. derived from or containing toxins. tox·i·gen·ic adj. Producing a poison; toxicogenic. V. cholerae, possibly through natural selection involving unidentified factors and immunity of the host population (25-28). Another possibility is that the genetic reassortments observed here are random changes in the organism. The strains that gained advantage as a result of this rearrangement may have infected humans and become enriched inside the gastrointestinal tract gastrointestinal tract n. The part of the digestive system consisting of the stomach, small intestine, and large intestine. Gastrointestinal tract so that they became detectable as new toxigenic strains. Molecular analysis of V. cholerae strains isolated during epidemics from 1961 to 1996 in Bangladesh revealed similar clonal diversity among strains isolated during different epidemics (25-29). These studies demonstrated three different ribotypes among the Id. cholerae O139 isolated from Bangladesh, with different ribotypes often showing different CTX prophage genotypes (26,28). Acknowledgment This work was supported in part by the Japan International Cooperation Agency The Japan International Cooperation Agency (独立行政法人国際協力機構 dokuritsu gyōseihōjin kokusai kyōryoku kikō Project 054-1061-E-0). References (1.) Baumann P, Furniss AL, Lee JV. Bergey's manual of systematic bacteriolo Genus 1, Vibrio vibrio Any of a group of aquatic, comma-shaped bacteria in the family Vibrionaceae. Some species cause serious diseases in humans and other animals. They are gram-negative (see P. Klieg NR, Holt JG, editors. Baltimore: Williams and [ILLEGIBLE il·leg·i·ble adj. Not legible or decipherable. il·leg i·bil TEXT] 518-38.(2.) Yamai S, Okitsu T, Shimada T, Katsube Y. Distribution of serogroups of non-O1 non-O139 with specific reference to their ability to produce [ILLEGIBLE TEXT] addition of novel serogroups. Journal of Japanese Association of [ILLEGIBLE TEXT] 1997;71:1037-45. (3.) Ramamurthy T, Garg S, Sharma R, Bhattacharya SK, Nair GB, Shimada [ILLEGIBLE TEXT] of a novel strain of Vibrio cholerae with epidemic potential in southern an [ILLEGIBLE TEXT] Lancet 1993;341:703-4. (4.) Nair GB, Ramammurthy T, Bhattacharya SK, Mukhopadhyay AK, Garg S, et al. Spread of Vibrio cholerae O139 Bengal in India. J Infect Dis 1994; [ILLEGIBLE TEXT] (5.) Nair GB, Albert MJ, Shimada T, Takeda Y. Vibrio cholerae O139 Bengal: causing cholera. Medical Microbiological Reviews 1996;7:43-51. (6.) Sharma C, Nair GB, Mukhopadhyay AK, Bhattacharya SK, Ghosh RK, [ILLEGIBLE TEXT] characterization of V. cholerae O1 biotype El Tor strains isolated between Calcutta, India: evidence for the emergence of a new clone of the El Tor [ILLEGIBLE TEXT] 1997;175:1134-41. (7.) Mukhopadhyay AK, Garg S, Mitra R, Basu A, Dutta D, Bhattacharya SK, shifts in traits of Vibrio cholerae strains isolated from hospitalized patients year (1993-1995) analysis. J Clin Microbiol 1996;34:2537-43. (8.) Sharma C, Maiti S, Mukhopadhyay AK, Basu A, Basu I, Nair GB, et al. [ILLEGIBLE TEXT] of the CTX genetic element in Vibrio cholerae O139 strains which [ILLEGIBLE TEXT] India, in September, 1996. J Clin Microbiol 1997;35:3348-50. (9.) Kimsey H, Nair GB, Ghosh A, Waldor MK. Diverse CTX s and evolution Vibrio cholerae. Lancet 1998;353:457-8. (10.) Mitra R, Basu A, Dutta D, Nair GB, Takeda Y. Resurgence of Vibrio [ILLEGIBLE TEXT] with altered antibiogram in Calcutta, India. Lancet 1996;348:1181. (11.) Mukhopadhyay AK., Basu A, Garg P, Bag PK, Ghosh A, Bhattacharya SK, epidemiology of reemergent Vibrio cholerae O139 Bengal in India. J Clin 1998;36:2149-52. (12.) World Health Organization. Guidelines for cholera control. Geneva Geneva, canton and city, Switzerland Geneva (jənē`və), Fr. Genève, canton (1990 pop. 373,019), 109 sq mi (282 sq km), SW Switzerland, surrounding the southwest tip of the Lake of Geneva. : The [ILLEGIBLE TEXT] (13.) Yamamoto T, Nair GB, Parodi CC, Takeda Y. In vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment. in vi·tro adj. In an artificial environment outside a living organism. susceptibilities to a of V. cholerae O1 and O139. Antimicrob Agents Chemother 1993;39: [ILLEGIBLE TEXT] (14.) Keasler SP, Hall RH. Detecting and biotyping V. cholerae O1 with multiple chain reaction. Lancet 1993;341:1661. (15.) Colombo MM, Mastrandrea S, Santona A, de Amdrade AP, Uzzau S, [ILLEGIBLE TEXT] Distribution of the ace, zot, and ctxA toxin genes in the clinical and [ILLEGIBLE TEXT] cholerae. J Infect Dis 1994;170:750-1. (16.) Basu A, Mukhopadhyay AK, Sharma C, Jyot J, Gupta N, Ghosh A, et al. the organization of the CTX genetic element in strains of Vibrio cholerae isolated from Calcutta, India and Dhaka, Bangladesh and its plausible link incidence of O139 cholera in the two locales. Microb Pathog 1998;24: [ILLEGIBLE TEXT]. (17.) Yamasaki S, Nair GB, Bhattacharya SK, Yamamoto S, Kurazono H, Take appearance of a nevi Nevus (plural, nevi) The medical term for any anomaly of the skin that is present at birth, including moles and birthmarks. Mentioned in: Malignant Melanoma, Moles nevi plural form of nevus. clone of Vibrio cholerae O1 biotype El Tor in Calcutt Immunol 1997;41:1-6. (18.) Waldor MK, Mekalanos JJ. Vibrio cholerae O139 specific gene sequence. 1994;343:1366. (19.) Kaper JB, Morris JG Jr, and Nishibuchi M. DNA probes for pathogenic Vibrio Tenover FC, editor. DNA probes for infectious disease Infectious disease A pathological condition spread among biological species. Infectious diseases, although varied in their effects, are always associated with viruses, bacteria, fungi, protozoa, multicellular parasites and aberrant proteins known as prions. . Boca Raton (FL): 1992. p. 65-77. (20.) Murray MG, Thompson WF. Rapid isolation of high molecular weight [ILLEGIBLE TEXT] Acids Res 1980;8:4321-5. (21.) Pajni S, Sharma C, Bhasin N, Ghosh A, Ramamurthy T, Nair GB, et al. [ILLEGIBLE TEXT] genesis of Vibrio cholerae O139: identification of probable progenitor [ILLEGIBLE TEXT] Microbiol 1994;42:20-5. (22.) Bhadra RK, Roychoudhury S, Banerjee RK, Kar S, Majumdar R, Sengupt toxin (CTX) genetic element in Vibrio cholerae O139. Microbiology 1995 (23.) Mekalanos JJ. Duplication and amplification of cholera toxin cholera toxin Infectious disease A heat-sensitive multimeric enterotoxin produced by Vibrio cholera, which transfers ADP-ribose to a G protein, locking adenyl cyclase in an 'on' position by ADP ribosylation of a Gs protein genes in Vibrio 1983;35:253-63. (24.) Waldor MK, Tschape H, Mekalanos JJ. A new type of conjugative [ILLEGIBLE TEXT] resistance to sulfamethoxazole sulfamethoxazole /sul·fa·meth·ox·a·zole/ (-meth-ok´sah-zol) a sulfonamideantibacterial and antiprotozoal, particularly used in acute urinary tract infections. sul·fa·me·thox·a·zole n. , trimethoprim and streptomycin in Vibrio [ILLEGIBLE TEXT] Bacteriol 1996; 178:4157-65. (25.) Faruque SM, Alim ARMA, Rahman MM, Siddique AK, Sack RB, Albert relationships assay classical Vibrio cholerae O1 strains isolated between [ILLEGIBLE TEXT] Bangladesh. J Clin Microbiol 1993;31:2513-6. (26.) Faruque SM, Ahmed KM, Siddique AK, Zoman K, Alim ARMA, Albert analysis of toxigenic Vibrio cholerae in Bangladesh studied by numerical gene restriction patterns. J Clin Microbiol 1997;35.2299-306. (27.) Faruque SM, Roy SK, Alim ARMA, Siddique AK, Albert MJ. Molecular toxigenic Vibrio cholerae in Bangladesh studied by numerical analysis of [ILLEGIBLE TEXT] restriction patterns. J Clin Microbiol 1995;33:2833-8. (28.) Faruque SM, Ahmed KM, Alim ARMA, Qadri F, Siddique AK, Albert MJ new clone of toxigenic Vibrio cholerae O1 biotype El Tor displacing V. [ILLEGIBLE TEXT] Bengal in Bangladesh. J Clin Microbiol 1997;35:624-30. (29.) Faruque SM, Alim ARMA, Roy SK, Khan F, Nair GB, Sack RB, et al. [ILLEGIBLE TEXT] rRNA and cholera toxin genes carried by the new epidemic strain of toxige cholerae O139 synonym Bengal. J Clin Microbiol 1994;33:1050-3. Arnab Basu,(*) Pallavi Garg,(*) Simanti Datta,(*) Soumen Chakraborty,(*) Tanuja Bhattacharya,(*) Asis Khan,(*) T. Ramamurthy,(*) S.K. Bhattacharya,(*) Shinji Yamasaki,([dagger]) Yoshifumi Takeda,([double dagger]) and G. Balakrish Nair G. Balakrish Nair is an Indian microbiologist who is currently the Director, Laboratory Sciences Division, at the International Center for Diarrhoeal Diseases Research, Bangladesh (ICDDR,B), Dhaka, Bangladesh. (*) (*) National Institute of Cholera and Enteric Diseases, Calcutta, India; ([dagger]) International Medical Center of Japan, Tokyo, Japan; and ([double dagger]) National of Infectious Diseases, Tokyo, Japan Mr. Basu holds a Masters in Biochemistry and is completing his doctoral degree under the supervision of G. Balakrish Nair, Deputy Director of the National Insti Enteric Diseases, the National Reference Centre for Cholera in India. Mr. Basu's an in-depth molecular analysis of the CTX genetic element in strains of Vibrio c the last 3 decades, including recent isolates of V. cholerae O139. Address for correspondence: G. Balakrish Nair, National Institute of Cholera and P-33, CIT n. 1. A citizen; an inhabitant of a city; a pert townsman; - used contemptuously. Which past endurance sting the tender cit. - Emerson. Road, Scheme XM, Beliaghata, Calcutta, 700 010, India; fax: 91-33-3 gbnair@vsnl.com |
|
||||||||||||||||||

i·bil
Printer friendly
Cite/link
Email
Feedback
Reader Opinion